Ability of Soil Isolated Actinobacterial Strains to Prevent, Bind and Biodegrade Ochratoxin A
Abstract
1. Introduction
2. Results
2.1. Kinetics of OTA Binding to Actinobacterial Cell Wall
2.2. Detoxification of OTA by Actinobacterial Strains and Their Supernatant
2.3. Effect of Actinobacteria on A. carbonarius Dry Weight, OTA Production and Genes Expression
3. Discussion
4. Materials and Methods
4.1. Actinobacteria and A. carbonarius Strains
4.2. Preparation of Ochratoxin A contaminated PBS
4.3. Binding Assay
4.3.1. Preparation of Actinobacteria Suspension
4.3.2. OTA Binding Kinetics
4.4. Detoxification Activity of the Actinobacteria
4.5. Coculture of A. carbonarius and Actinobacteria Study
4.5.1. Effect on Growth of A. carbonarius
4.5.2. Total RNA Extraction, cDNA Synthesis and qRT-PCR for Gene Expression Analysis
4.6. OTA Extraction
4.7. HPLC Analysis
4.8. Statistical Analysis
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
| A. carbonarius | Aspergillus carbonarius |
| qRT-PCR | Quantitative Reverse Transcription-Polymerase Chain Reaction |
| OTA | Ochratoxin A |
| LAB | Lactic Acid Bacteria |
| AFB | Aflatoxin |
| PDA | Potato Dextrose Agar |
| ISP2 | International Streptomyces Project-2 |
| PBS | Phosphate Buffer Solution |
| HPLC | High Performance Liquid Chromatography |
| rpm | Round per minute |
References
- Park, J.W.; Chung, S.-H.; Kim, Y.-B. Ochratoxin A in Korean food commodities: Occurrence and safety evaluation. J. Agric. Food Chem. 2005, 53, 4637–4642. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Overy, D.P.; Seifert, K.A.; Savard, M.E.; Frisvad, J.C. Spoilage fungi and their mycotoxins in commercially marketed chestnuts. Int. J. Food Microbiol. 2003, 88, 69–77. [Google Scholar] [CrossRef] [Scilit]
- Juodeikiene, G.; Bartkiene, E.; Basinskiene, L.; Matusevicius, P. Mycotoxin decontamination aspects in food, feed and renewables using fermentation processes. In Agricultural and Biological Sciences; Eissa, A.A., Ed.; InTech: Rijeka, Croatia, 2012. [Google Scholar]
- El Khoury, A.; Rizk, T.; Lteif, R.; Azouri, H.; Delia, M.-L.; Lebrihi, A. Occurrence of ochratoxin A and aflatoxin b1-producing fungi in lebanese grapes and ochratoxin A content in musts and finished wines during 2004. J. Agric. Food Chem. 2006, 54, 8977–8982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- International Agency for Research on Cancer. Some naturally occuring substances: Food items and constituents, heterocyclic aromatic amines and mycotoxins. In IARC Monographs on the Evaluation of Carcinogenic Risks to Humans; World Health Organization: Lyon, France, 1993; Volume 56, pp. 489–521. [Google Scholar]
- Wu, F.; Bui-Klimke, T.; Naumoff Shields, K. Potential economic and health impacts of ochratoxin A regulatory standards. World Mycotoxin J. 2014, 7, 387–398. [Google Scholar] [CrossRef] [Scilit]
- Hua, H.; Xing, F.; Selvaraj, J.N.; Wang, Y.; Zhao, Y.; Zhou, L.; Liu, X.; Liu, Y. Inhibitory effect of essential oils on Aspergillus ochraceus growth and ochratoxin A production. PLoS ONE 2014, 9, e108285. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Murthy, P.S.; Borse, B.B.; Khanum, H.; Srinivas, P. Inhibitory effects of ajowan (Trachyspermum ammi) ethanolic extract on A. ochraceus growth and ochratoxin production. Turk. J. Biol. 2009, 33, 211–217. [Google Scholar]
- El Khoury, R.; Atoui, A.; Verheecke, C.; Maroun, R.; El Khoury, A.; Mathieu, F. Essential oils modulate gene expression and ochratoxin A production in Aspergillus carbonarius. Toxins 2016, 8, 242. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Abrunhosa, L.; Paterson, R.R.; Venancio, A. Biodegradation of ochratoxin A for food and feed decontamination. Toxins 2010, 2, 1078–1099. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Böhm, J.; Grajewski, J.; Asperger, H.; Cecon, B.; Rabus, B.; Razzazi, E. Study on biodegradation of some a-and b-trichothecenes and ochratoxin A by use of probiotic microorganisms. Mycotoxin Res. 2000, 16, 70–74. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bejaoui, H.; Mathieu, F.; Taillandier, P.; Lebrihi, A. Ochratoxin a removal in synthetic and natural grape juices by selected oenological Saccharomyces strains. J. Appl. Microbiol. 2004, 97, 1038–1044. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Brady, D.; Stoll, A.; Starke, L.; Duncan, J. Chemical and enzymatic extraction of heavy metal binding polymers from isolated cell walls of Saccharomyces cerevisiae. Biotechnol. Bioeng. 1994, 44, 297–302. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bolognani, F.; Rumney, C.; Rowland, I. Influence of carcinogen binding by lactic acid-producing bacteria on tissue distribution and in vivo mutagenicity of dietary carcinogens. Food Chem. Toxicol. 1997, 35, 535–545. [Google Scholar] [CrossRef] [Scilit]
- Santos, A.; Marquina, D.; Leal, J.; Peinado, J. (1→6)-β-d-glucan as cell wall receptor for pichia membranifaciens killer toxin. Appl. Environ. Microbiol. 2000, 66, 1809–1813. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bata, Á.; Lásztity, R. Detoxification of mycotoxin-contaminated food and feed by microorganisms. Trends Food Sci. Technol. 1999, 10, 223–228. [Google Scholar] [CrossRef] [Scilit]
- Patharajan, S.; Reddy, K.; Karthikeyan, V.; Spadaro, D.; Lore, A.; Gullino, M.; Garibaldi, A. Potential of yeast antagonists on invitro biodegradation of ochratoxin A. Food Control 2011, 22, 290–296. [Google Scholar] [CrossRef] [Scilit]
- Styriak, I.; Conková, E. Microbial binding and biodegradation of mycotoxins. Vet. Hum. Toxicol. 2002, 44, 358–361. [Google Scholar] [PubMed]
- Varga, J.; Péteri, Z.; Tábori, K.; Téren, J.; Vágvölgyi, C. Degradation of ochratoxin A and other mycotoxins by rhizopus isolates. Int. J. Food Microbiol. 2005, 99, 321–328. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bielecki, S.; Tramper, J.; Polak, J. The biodegradation of ochratoxin A in food products by lactic acid bacteria and baker’s yeast. Food Biotechnol. 2000, 17, 307–310. [Google Scholar]
- Turbic, A.; Ahokas, J.; Haskard, C. Selective in vitro binding of dietary mutagens, individually or in combination, by lactic acid bacteria. Food Addit. Contam. 2002, 19, 144–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ningthoujam, S.; Sanasam, S.; Tamreihao, K.; Nimaich, S. Antagonistic activities of local actinomycete isolates against rice fungal pathogens. Afr. J. Microbiol. Res. 2009, 3, 737–742. [Google Scholar]
- Hogan, C.M. Bacteria. In Encyclopedia of Earth; National Council for Science and the Environment: Washington, DC, USA, 2010. [Google Scholar]
- Verheecke, C.; Liboz, T.; Darriet, M.; Sabaou, N.; Mathieu, F. In vitro interaction of actinomycetes isolates with Aspergillus flavus: Impact on aflatoxins b1 and b2 production. Lett. Appl. Microbiol. 2014, 58, 597–603. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piotrowska, M.; Zakowska, Z. The elimination of ochratoxin A by lactic acid bacteria strains. Pol. J. Microbiol. 2005, 54, 279–286. [Google Scholar] [PubMed]
- Pereyra, C.M.; Cavaglieri, L.R.; Keller, K.M.; Maris, S.; Chiacchiera, C.A.D.R.; Dalcero, A.M. In vitro ochratoxin A adsorption by commercial yeast cell walls. Rev. Bras. Med. Vet. 2015, 7, 25–28. [Google Scholar]
- Yiannikouris, A.; André, G.; Poughon, L.; François, J.; Dussap, C.-G.; Jeminet, G.; Bertin, G.; Jouany, J.-P. Chemical and conformational study of the interactions involved in mycotoxin complexation with β-d-glucans. Biomacromolecules 2006, 7, 1147–1155. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piotrowska, M. The adsorption of ochratoxin A by lactobacillus species. Toxins 2014, 6, 2826–2839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- El-Nezami, H.; Kankaanpaa, P.; Salminen, S.; Ahokas, J. Ability of dairy strains of lactic acid bacteria to bind a common food carcinogen, aflatoxin b 1. Food Chem. Toxicol. 1998, 36, 321–326. [Google Scholar] [CrossRef] [Scilit]
- Haskard, C.A.; El-Nezami, H.S.; Kankaanpää, P.E.; Salminen, S.; Ahokas, J.T. Surface binding of aflatoxin b1 by lactic acid bacteria. Appl. Environ. Microbiol. 2001, 67, 3086–3091. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fuchs, S.; Sontag, G.; Stidl, R.; Ehrlich, V.; Kundi, M.; Knasmüller, S. Detoxification of patulin and ochratoxin A, two abundant mycotoxins, by lactic acid bacteria. Food Chem. Toxicol. 2008, 46, 1398–1407. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schatzmayr, G.; Heidler, D.; Fuchs, E.; Nitsch, S.; Mohnl, M.; Täubel, M.; Loibner, A.; Braun, R.; Binder, E. Investigation of different yeast strains for the detoxification of ochratoxin A. Mycotoxin Res. 2003, 19, 124–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verheecke, C.; Liboz, T.; Anson, P.; Diaz, R.; Mathieu, F. Reduction of aflatoxin production by Aspergillus flavus and Aspergillus parasiticus in interaction with streptomyces. Microbiology 2015, 161, 967–972. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallo, A.; Perrone, G.; Solfrizzo, M.; Epifani, F.; Abbas, A.; Dobson, A.D.; Mule, G. Characterisation of a pks gene which is expressed during ochratoxin A production by Aspergillus carbonarius. Int. J. Food Microbiol. 2009, 129, 8–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallo, A.; Knox, B.P.; Bruno, K.S.; Solfrizzo, M.; Baker, S.E.; Perrone, G. Identification and characterization of the polyketide synthase involved in ochratoxin A biosynthesis in Aspergillus carbonarius. Int. J. Food Microbiol. 2014, 179, 10–17. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gallo, A.; Bruno, K.S.; Solfrizzo, M.; Perrone, G.; Mule, G.; Visconti, A.; Baker, S.E. New insight into the ochratoxin A biosynthetic pathway through deletion of a nonribosomal peptide synthetase gene in Aspergillus carbonarius. Appl. Environ. Microbiol. 2012, 78, 8208–8218. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Crespo-Sempere, A.; Marin, S.; Sanchis, V.; Ramos, A.J. Vea and laea transcriptional factors regulate ochratoxin A biosynthesis in Aspergillus carbonarius. Int. J. Food Microbiol. 2013, 166, 479–486. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Strains | Time (min) | OTA Concentration in PBS (ng/mL) (% of Reduction) | OTA Concentration after Bacterial Pellet Washing (ng/mL) |
|---|---|---|---|
| Control | 0 | 45.12 ± 1.2 a | |
| AT10 | 0 | 39.59 ± 1.1 *,e (12.37) | 5.53 ± 0.12 |
| 30 | 38.19 ± 0.9 *,d (15.46) | 6.82 ± 0.09 | |
| 60 | 33.60 ± 0.91 *,c (25.62) | 11.42 ± 0.08 | |
| AT8 | 0 | 41.64 ± 1.12 *,f (7.82) | 3.13 ± 0.10 |
| 30 | 39.75 ± 1.4 *,e (12.02) | 5.19 ± 0.02 | |
| 60 | 37.92 ± 1.2 *,d (16.07) | 7.06 ± 0.10 | |
| SN7 | 0 | 43.40 ± 1.8 *,g (3.94) | 1.68 ± 0.20 |
| 30 | 39.96 ± 1.1 *,e (11.55) | 4.425 ± 0.01 | |
| 60 | 29.85 ± 0.47 *,b (33.93) | 15.13 ± 0.31 | |
| MS1 | 0 | 43.73 ± 0.4 *,g (3.20) | 0.64 ± 0.01 |
| 30 | 43.26 ± 0.7 *,g (4.25) | 0.74 ± 0.01 | |
| 60 | 41.88 ± 1.1 *,f (4.33) | 1.54 ± 0.01 | |
| ML5 | 0 | 43.00 ± 0.9 *,g (4.82) | 1.79 ± 0.04 |
| 30 | 42.45 ± 0.84 *,f (6.03) | 1.73 ± 0.01 | |
| 60 | 40.85 ± 0.1 *,e (9.46) | 2.65 ± 0.40 | |
| G10 | 0 | 40.68 ± 1.02 *,e (9.95) | 3.50 ± 0.31 |
| 30 | 39.45 ± 1.1 *,e (12.68) | 4.67 ± 0.10 | |
| 60 | 37.82 ± 0.9 *,d (16.28) | 6.73 ± 0.10 | |
| PT1 | 0 | 41.01 ± 0.1 *,f (9.23) | 3.06 ± 0.12 |
| 30 | 39.88 ± 0.41 *,e (11.73) | 4.39 ± 0.20 | |
| 60 | 33.95 ± 0.1 *,c (24.85) | 10.62 ± 1.02 |
| Strains | Detoxification Activity of the Actinobacterial Strains | Detoxification Activity of the Supernatants |
|---|---|---|
| OTA Concentration with Strains (ng/mL) (% of Reduction) | OTA Concentration with Supernatant (ng/mL) (% of Reduction) | |
| Control | 95.45 ± 1.7 a | 95.45 ± 1.7 a |
| AT10 | 45.84 ± 1.05 *,b (51.94) | 75.51 ± 1.4 *,b (20.89) |
| AT8 | 55.23 ± 0.7 *,c (42.13) | 74.05 ± 2.8 *,b (22.42) |
| SN7 | 45.16 ± 1.13 *,b (52.68) | 80.10 ± 2.4 *,c (16.08) |
| MS1 | 73.65 ± 0.6 *,d (22.83) | 79.38 ± 1.7 *,c (16.83) |
| ML5 | 63.70 ± 1.13 *,e (33.24) | 75.69 ± 0.43 *,b (20.70) |
| G10 | 59.52 ± 2.6 *,f (37.65) | 79.73 ± 0.7 *,c (16.46) |
| PT1 | 52.52 ± 1.25 *,c (44.97) | 82.01 ± 1.03 *,d (14.08) |
| Strain | Fungal Dry Weight (g) | Radial Growth (cm) | OTA Production (ng/mL) (% of Reduction) |
|---|---|---|---|
| Control | 3.06 ± 0.015 a | 4.5 ± 0.35 a | 14.45 ± 0.33 a |
| AT10 | 3.17 ± 0.02 *,d | 4.9 ± 0.1 *,d | 13.73 ± 0.56 a (4.90%) |
| AT8 | 3.08 ± 0.01 a | 3.8 ± 0.05 *,b | 13.68 ± 0.16 a (5.32%) |
| SN7 | 3.01 ± 0.01 a | 3.7 ± 0.1 *,b | 13.90 ± 0.09 a (3.78%) |
| MS1 | 2.84 ± 0.015 *,c | 4.3 ± 0.05 a | 10.99 ± 0.28 *,c (23.94%) |
| ML5 | 2.75 ± 0.01 *,c | 4.0 ± 0.02 *,c | 12.47 ± 0.22 *,b (13.70%) |
| G10 | 3.03 ± 0.01 a | 4.25 ± 0.04 a | 12.51 ± 0.09 *,b (13.50%) |
| PT1 | 2.08 ± 0.01 *,b | 2.15 ± 0.1 *,e | 12.76 ± 0.20 *,b (11.69%) |
| Strains | AT10 | AT8 | SN7 | MS1 | ML5 | G10 | PT1 |
|---|---|---|---|---|---|---|---|
| Gene | Normalized Relative Expression | ||||||
| acpks | 1.00 | 1.02 | 0.99 | 0.629 * | 0.61 * | 0.91 * | 0.99 |
| acOTApks | 0.998 | 1.02 | 1.01 | 0.761 * | 0.77 * | 0.817 * | 1.01 |
| acOTAnrps | 1.01 | 0.993 | 0.992 | 0.79 * | 0.881 * | 0.881 * | 0.992 |
| laeA | 1.01 | 1.01 | 1.03 * | 1.09 * | 1.01 | 1.01 | 1.03 * |
| veA | 0.998 | 0.98 * | 0.9 * | 0.886 * | 1.00 | 0.93 * | 0.9 * |
| Primer Name | Primer Sequence (5′-3′) | References | Efficiency |
|---|---|---|---|
| acpks-F | GAGTCTGACCATCGACACGG | [33] | 95.0% |
| acpks-R | GGCGACTGTGACACATCCAT | ||
| acOTApks-F | CGTGTCCGATACTGTCTGTGA | [34] | 98.5% |
| acOTApks-R | GCATGGAGTCCTCAAGAACC | ||
| acOTAnrps-F | ATCCCCGGAATATTGGCACC | [35] | 102.1% |
| acOTAnrps-R | CCTTCGATCAAGAGCTCCCC | ||
| laeA-F | CACCTATACAACCTCCGAACC | [36] | 100.7% |
| laeA-R | GGTTCGGCCAACCGACGACGC | ||
| veA-F | TCCCGGTTCTCACAGGCGTA | [36] | 99.3% |
| veA-R | GCTGTCCTTGGTCTCCTCGTA | ||
| β-tubulin-F | CGCATGAACGTCTACTTCAACG | [37] | 101.1% |
| β-tubulin-R | AGTTGTTACCAGCACCGGA |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Khoury, R.E.; Mathieu, F.; Atoui, A.; Kawtharani, H.; Khoury, A.E.; Afif, C.; Maroun, R.G.; Khoury, A.E. Ability of Soil Isolated Actinobacterial Strains to Prevent, Bind and Biodegrade Ochratoxin A. Toxins 2017, 9, 222. https://doi.org/10.3390/toxins9070222
Khoury RE, Mathieu F, Atoui A, Kawtharani H, Khoury AE, Afif C, Maroun RG, Khoury AE. Ability of Soil Isolated Actinobacterial Strains to Prevent, Bind and Biodegrade Ochratoxin A. Toxins. 2017; 9(7):222. https://doi.org/10.3390/toxins9070222
Chicago/Turabian StyleKhoury, Rachelle El, Florence Mathieu, Ali Atoui, Hiba Kawtharani, Anthony El Khoury, Charbel Afif, Richard G. Maroun, and André El Khoury. 2017. "Ability of Soil Isolated Actinobacterial Strains to Prevent, Bind and Biodegrade Ochratoxin A" Toxins 9, no. 7: 222. https://doi.org/10.3390/toxins9070222
APA StyleKhoury, R. E., Mathieu, F., Atoui, A., Kawtharani, H., Khoury, A. E., Afif, C., Maroun, R. G., & Khoury, A. E. (2017). Ability of Soil Isolated Actinobacterial Strains to Prevent, Bind and Biodegrade Ochratoxin A. Toxins, 9(7), 222. https://doi.org/10.3390/toxins9070222

