Next Article in Journal
Assessment of the Spatial Variability and Uncertainty of Shreddable Pruning Biomass in an Olive Grove Based on Canopy Volume and Tree Projected Area
Previous Article in Journal
Two-Dimensional Correlation IR Spectroscopy of Humic Substances of Chernozem Size Fractions of Different Land Use
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe

1
Interdisciplinary Program in Smart Science, Kangwon National University, Chuncheon 24341, Republic of Korea
2
Research Institute of Biotechnology, Hwajinbiocosmetic, Chuncheon 24232, Republic of Korea
3
Department of Hotel Culinary Arts, Songho University, Hoengseong 25242, Republic of Korea
4
Division of Bioresource Sciences, Department of Applied Plant Sciences, Kangwon National University, Chuncheon 24341, Republic of Korea
*
Author to whom correspondence should be addressed.
These authors contributed equally to this work.
Agronomy 2023, 13(7), 1698; https://doi.org/10.3390/agronomy13071698
Submission received: 8 June 2023 / Revised: 20 June 2023 / Accepted: 23 June 2023 / Published: 25 June 2023
(This article belongs to the Section Plant-Crop Biology and Biochemistry)

Abstract

Functionality based on the biological activity of sorghum such as antioxidant activity is known worldwide for its excellence. In this study, we investigated the reactive oxygen species (ROS) scavenging activity, total phenolic and flavonoid contents, phenol compounds, and changes in antioxidant gene expression in sorghum seed cells collected from five countries (Australia, former Soviet Union, USA, Sudan, and Guadeloupe). Sorghum seeds were obtained from 12 genetic resources (K159041, K159042, K159078, K159081, K159088, K159089, K159093, K159097, K159100, K159096, K159048, and K159077). ROS scavenging activity was analyzed using 1,1-diphenyl-2-picrylhydrazyl (DPPH) and 2,20-azinobis 3-ethylbenzothiazoline-6-sulfonate (ABTS). K159097 showed high antioxidant activity values of 33.52 ± 0.70 μg/mL (DPPH) and 271.06 ± 13.41 μg/mL (ABTS), respectively. The reducing power of the resources improved in a concentration-dependent manner, and 10 sorghum resources, except K159078 and K159048, showed high reducing power. K159042 had the highest total phenol content (231 ± 2.17 mg·GAE/g), and K159081 had the highest total flavonoid content (67.71 ± 5.38 mg·QE/g). Among the six phenolic compounds (protocatechuic acid, caffeic acid, p-coumaric acid, ferulic acid, taxifolin, and naringenin) analyzed, the compound with the highest content was taxifolin (203.67 ± 4.99 mg/L in K159093). K159041, K159042, and K159048 had the highest expression levels of superoxide dismutase (SOD), ascorbate peroxidase 1 (APX1), and catalase (CAT), which are indicators of antioxidant activity. An evaluation of the diversity of sorghum provided useful information on antioxidant activity, physicochemical content, and antioxidant gene expression in seed cells, suggesting that sorghum can be used as a biomaterial from natural resources.

1. Introduction

Sorghum is a C4 crop native to Africa and was cultivated in Asia, Africa, and Central America. It is a food crop that grows well even when the annual rainfall is <400 mm, because it requires only half the amount of corn and less fertilizer [1]. Currently, global sorghum production is known to be over 61 million tonnes, and Israel, Jordan, France, and Italy showed the highest yields in small-scale cultivation. Sorghum is the most cultivated crop among grain sorghum, sorghum, and broomcorn, depending on its use, and is an important grain resource, followed by rice, barley, wheat, and corn worldwide [2]. Broomcorn has no nodes on the ear, and the skin of the fruit is difficult to thresh; therefore, it is used only as a seed. Since ancient times, it was used by the private sector to promote digestion, maintain body temperature, and protect the stomach [2]. Recently, as studies on the biological functionality of sorghum grew, there were reports on its active ingredients, such as flavonoids and various phenolic components, including tannins [3]. Polyphenol extracts from sorghum exhibit antioxidant activity and inhibit the activity of enzymes related to cholesterol biosynthesis [4]. Biologically active substances related to polyphenols in sorghum suppress blood LDL (low density lipoprotein)-cholesterol and increase HDL (high density lipoprotein)-cholesterol and have excellent hypocholesterolemic effects [5]. Compared to cereals such as wheat, oats, and millet, the cholesterol-lowering effect of sorghum was known for a long time [5].
Recently, phenolic compounds were recognized as substances that provide health benefits by reducing oxidative stress. Phenolic acids, flavonoids, and tannins belonging to these phenolic compounds are also present in sorghum grains [6]. In particular, large amounts of flavonoids are present in the seed coat of sorghum, and the enhancement in their content appears to be related to the color or thickness of the seed coat [7]. Sorghum is a crop that adapts well to environments with insufficient moisture; therefore, it is easy to grow even in regions with irregular precipitation distributions and high temperatures [8]. Studies on the relationship between the biological activity of sorghum and the precipitation and climate of the growing region were conducted; however, it is difficult to determine their correlation because sorghum grows well even in a barren climate [9]. A study on the antioxidant activity and nutritional value of alfalfa leaves found that they were greatly influenced by climate according to seasonal changes [10]. The ascorbic acid content in potatoes varies considerably among cultivars exposed to different environments in Europe [11]. In addition, the mineral content of potatoes is influenced by various factors, including the cultivar and growing site [12]. It was reported that the sorghum genotype has a reduced photosystem II efficiency under high salinity stress, leading to a decrease in CO2 and stomatal closure, which inhibits leaf expansion, and so, the salinity level should also be considered when selecting a cultivation area [1,13]. In sorghum, active components, such as phenol content, correlate with the environment and the local climate in which they are grown.
ROS cause oxidative damage upon exposure to various biotic and abiotic stress conditions, and when they accumulate in excessive amounts, they impair biomolecules, induce cell damage, and activate cell death mechanisms [14,15]. When plants are stressed, redox homeostasis is maintained by activating related enzymes to combat oxidative stress [16,17]. These enzymes protect against stress and detoxify ROS. The enzymes involved in this enzymatic antioxidant system include APX, dehydroascorbate reductase (DHAR), glutathione reductase (GR), monodehydroascorbic acid reductase (MDHAR), SOD, and CAT [18]. Compounds involved in the opposite non-enzymatic antioxidant system include ascorbate, glutathione (GSH), proline, and α-tocopherol, which regulate gene expression during biotic and abiotic stress responses [19,20]. Such an antioxidant system makes plants resistant to stress and regulates the expression of signal transduction genes in plant growth promotion pathways [21]. Several reports revealed the relationship between different antioxidant enzyme activities; however, few studies revealed the relationship among the transcription levels of antioxidant enzyme genes.
In this study, we aimed to investigate the changes in antioxidant activity and total phenol, total flavonoid, and phenolic contents in sorghum according to the climate of each cultivation area by using sorghum genetic resources collected from Australia, the former Soviet Union, USA, Sudan, and Guadeloupe, and to verify the relevance between the expression level of APX, SOD, and CAT genes and antioxidant activity.

2. Materials and Methods

2.1. Plant Material and Extract Manufacture

The genetic resource numbers were K159041, K159042, K159078, K159081, K159088, K159089, K159093, K159097, K159100, K159096, K159048, and K159077. Sorghum seeds were obtained from 12 genetic resources collected from five regions of the National Agrobiodiversity Center, National Institute of Agricultural Sciences, Rural Development Administration, South Korea. The collection regions for each sorghum genetic resource were Australia, the former Soviet Union, USA, Sudan, and Guadeloupe. Sorghum seeds (2 g) were finely crushed using a grinder (HG-7113; Haeger, Barcelona, Spain) and extracted by soaking in 100% methanol at room temperature for 48 h at 10 times the weight of the seeds. The extract was filtered through a filter paper (Watman No. 42) and concentrated under reduced pressure using a rotary vacuum concentrator (EYELA N-1110, Tokyo Rikakikai Co. Ltd., Tokyo, Japan) via heating in a water bath at 45 °C.

2.2. Measurement of ROS Scavenging Activity

To measure ROS scavenging ability, the DPPH and ABTS methods were used. For DPPH free radical scavenging activity, 1 mL of 0.15 M DPPH solution was mixed with 4 mL sorghum extract diluted with methanol. After quantifying the final concentrations of samples to 10, 50, 100, and 500 μg/mL, DPPH was added and allowed to react at room temperature for 30 min. Thereafter, a UV spectrophotometer (Multiskan FC Microplate Photometer, Thermo Fisher Scientific Inc., Waltham, MA, USA) was used to measure the absorbance of samples at 517 nm [22]. For ABTS free radical scavenging activity, the ABTS solution was obtained by mixing 2.6 mM potassium persulfate and 7.4 mM ABTS in a 1:1 ratio and, subsequently, leaving them to react in the dark for 15 h. After mixing 100 μL of the diluted sample with 90 μL of ABTS solution at concentrations of 100, 500, and 1000 μg/mL, the solutions were allowed to react at room temperature for 10 min. Thereafter, the absorbance was measured at 734 nm using a UV spectrophotometer [23]. The values calculated using the DPPH and ABTS methods were expressed as RC50 (the concentration of the compound that reduced the value of the control group, to which no compound was added, by 50%).

2.3. Measurement of Reducing Power

The reducing power was determined by mixing 100, 500, and 1000 µL of 100% methanol extract (10 µg/mL) with 500 µL of 0.2 M sodium phosphate buffer (pH 6.6) and 500 µL of 1% potassium ferricyanide at 50 °C for 20 min. Then, 2.5 mL of 10% trichloroacetic acid was added. After centrifuging this reaction solution at 1000 rpm for 10 min, 500 μL of the supernatant was separated, and the reaction solution was mixed with 500 μL distilled water and 100 μL 1% ferric chloride. The absorbance was measured at 700 nm using a UV spectrophotometer (UV-1800, SHIMADZU Corp., Kyoto, Japan) [24].

2.4. Analysis of Total Phenolic and Flavonoid Contents

The total polyphenol content in sorghum genetic resources was determined according to the method by Appel et al. (2001) with minor modifications [25]. After adding 400 μL of distilled water to 20 μL of 2 mg/mL sorghum sample, 40 μL of 2N Folin–Ciocalteu phenol reagent (Sigma-Aldrich, St. Louis, MO, USA) was added and stirred. Thereafter, 400 μL of 30% Na2CO3 was added to this solution and reacted for 1 h. The absorbance was measured at 765 nm using a UV spectrophotometer (Multiskan FC Microplate Photometer, Thermo Fisher Scientific Inc., Waltham, MA, USA). The total flavonoid content was checked by adding 100 μL of 10% aluminum nitrate and 1 M potassium acetate to 500 μL of the sample at a concentration of 1000 ppm, and the absorbance was measured at 415 nm using a UV spectrophotometer (Multiskan FC Microplate Photometer, Thermo Fisher Scientific Inc., Waltham, MA, USA) [26]. Gallic acid (Sigma-Aldrich) and Qucetin (Sigma-Aldrich) was used to quantify the total polyphenol and total flavonoid, and there were expressed as mg gallic acid equivalents (GAE) and mg qucetin equivalents per gram dry weight.

2.5. Phenol Component Analysis Using High-Performance Liquid Chromatography (HPLC)

Samples were prepared at a concentration of 10,000 μg/mL using 100% methanol, filtered through a 0.45 μm syringe filter (Hyundai Micro Co. Ltd., Seoul, Republic of Korea), and used for subsequent experiments. Protocatechuic acid, caffeic acid, ferulic acid, p-coumaric acid, taxifolin, and naringenin were used as standards. Taxifolin was diluted to 100, 250, and 500 μg/mL, whereas the others were diluted to 12.5, 25, and 50 μg/mL. Phenolic content was analyzed using a HPLC Agilent 1260 series (Agilent Technologies Inc., Santa Clara, CA, USA) instrument and an HC-C18 column (Agilent Technologies Inc.). The wavelength was set to 288 and 360 nm, column temperature to 25 °C, and the sample injection volume to 10 µL. HPLC water (solvent A) and acetonitrile (solvent B) were used as mobile phases, and 0.1% formic acid was added. The flow rate was 0.5 mL/min, and the linear gradient elution was 5–15% B (5 min), 15–50% B (40 min), 50–70% B (2 min), 70–100% B (1 min), 100% B (7 min), 100–5% B (1 min), and 5% B (9 min).

2.6. Expression Confirmation of Antioxidant Genes Using qPCR

Total RNA extraction for cDNA synthesis from 12 sorghum seeds was performed using TRIzol reagent (Thermo Fisher Scientific Inc.). The total RNA was quantified using a Microvolume Spectrophotometer (Keen Innovative Solutions, Daejeon, Republic of Korea). cDNA was synthesized using PrimeScript™ RT Master Mix (Perfect Real Time; Takara Korea Biomedical Inc., Seoul, Republic of Korea), and the total RNA content was adjusted. The CronoSTAR 96 Real-Time PCR System (Takara Korea Biomedical Inc.) was used for real-time PCR analysis. The conditions were as follows: initial denaturation at 95 °C for 30 s with a total volume of 25 μL, 40 cycles of 2-step amplification (denaturation 95 °C for 5 s, annealing at 60 °C for 30 s), and an experimental melting step at 95 °C for 1 min, 60 °C for 15 s, and 98 °C for 5 s. The expression levels of SOD, APX1, CAT, and housekeeping gene (pp2a), known as antioxidant genes in sorghum, were evaluated using the method by Bruno et al. (2020) [27].

2.7. Statistical Analysis

All data are expressed as the mean ± standard deviation of >3 replicates of the experiment. One way analysis of variance was used, and Duncan’s multiple range test was used at p < 0.05. IBM SPSS Statistics 26 was used for statistical analysis, and the presence or absence of significance was indicated using different letters.

3. Results and Discussion

3.1. Analysis of the Climate, Morphological Characteristics, and Antioxidant Activity of 12 Sorghum Genetic Resource Seeds

The sorghum genetic resources provided by the National Agrobiodiversity Center, National Institute of Agricultural Sciences, and Rural Development Administration in South Korea are shown in Figure 1. These data were collected from each of the five regions as indicated in Figure 1. The five regions were Australia, the former Soviet Union, the USA (Nebraska, Texas, and Virginia), Sudan, and Guadeloupe. Among the five regions, the average annual temperature of the sorghum seed collection area was lowest in Virginia, USA (−18.3 °C), and highest in Sudan (35.79 °C). The highest annual average precipitation was recorded in Virginia (USA) at 1086 mm, while Texas (USA) reported the lowest at 27.25 mm (Table 1).
The morphological characteristics of the sorghum resources used for antioxidant activity analysis were observed (Figure 2). The shapes of seven sorghum seeds, K159041, K159042, K159081, K159088, K159089, K159100, and K159077, were ovoid, and the remaining resources were classified as globose (yellow brown): K159081 (reddish-brown), K159089 (black), K159093 (yellow brown), K159048 (ivory), and K159077 (light brown). The remaining seeds (K159041, K159042, K159088, K159097, K159100, and K159096) had mixed colors (Table 2).
To investigate the antioxidant activity of sorghum by measuring ROS scavenging activity, the DPPH and ABTS methods were used. K159097 showed the highest DPPH free radical scavenging activity (33.52 ± 0.70 μg/mL), and K159078 showed the lowest (582.83 ± 219.07 μg/mL). There were numerical differences among the nine resources, K159041, K159042, K159081, K159088, K159089, K159093, K159097, K159100, and K159096, for DPPH analysis; however, no significant differences were observed. These nine resources showed higher ROS-scavenging activity in DPPH analysis than the remaining three resources. In ABTS analysis, K159097, K159081, K159096, K159089, K159042, K159093, K159088, K159100, K159041, K159077, K159048, and K159078 showed ROS scavenging activity in the order of high. Compared with the DPPH analysis, the ABTS analysis showed statistically significant (p < 0.05) results among the 12 resources; the values of the resources with the highest and lowest ROS scavenging activities measured in most DPPH analyses correlated with each other, indicating that there was a relationship among the 12 sorghum resources (Table 3). This confirmed the reliability of the overall data.
To measure the reducing power and ROS scavenging activity of sorghum, the absorbance of each sorghum resource was measured using the reducing power method. The reducing power measured according to the concentration of each sorghum seed extract confirmed that there was a correlation between the reducing power results according to the concentrations of 100, 500, and 1000 μg/mL. At the highest concentration of 1000 μg/mL, K159078 and K159048 showed absorbance values ≤0.8, indicating lower reducing power than other sorghum resources (Figure 3). This demonstrated the same trend as the antioxidant activity values obtained using DPPH and ABTS between sorghum resources; it was confirmed that the reducing power also correlated with ROS scavenging activity.
Measurement of the antioxidant activity of the 12 sorghum resources used in this study confirmed that there were no significant differences in seed shape, color, and antioxidant activity. Analysis of the antioxidant activity according to the collection area revealed that the USA sorghum resources had the highest antioxidant activity, while the Sudan (K159048) and former Soviet Union (K159078) resources had the lowest antioxidant activity. The differences in antioxidant activity according to the genetic characteristics of sorghum were analyzed. In addition, the range of antioxidant values (RC50) between sorghum resources measured in this experiment was 33.52 ± 0.70 to 582.83 ± 219.07 μg/mL for DPPH analysis and 271.06 ± 13.41 to 2874.26 ± 252.45 μg/mL for ABTS analysis, showing a wide range of values. This was similar to the results of a study that investigated a broad spectrum of antioxidant activities in sorghum collected from 15 different regions [28]. An analysis of five different sorghum genotypes collected in India revealed that red sorghum had high antioxidant activity [29]. Shen et al. (2018) and Wu et al. (2016) also reported similar results. However, in the present study, the seed shape and color did not affect antioxidant activity. Grain color is one of the reasons that lead to differences in total phenol and flavonoid contents between these cultivars, but it can also be caused by other reasons such as genetic variation and growing environment [30,31].

3.2. Total Phenolic and Flavonoid Contents

The total polyphenol content of the 12 sorghum resources ranged from 16.33 ± 0.32 mg·GAE/g to 231.21 ± 2.17 mg·GAE/g. The difference between the highest and lowest total polyphenol content was >14-fold. K159048, which had the lowest ROS-scavenging ability, showed the lowest polyphenol content, and a correlation with antioxidant activity was established. The highest total phenol content was observed in K159042 (231.21 ± 2.17 mg·GAE/g) and K159041 (125.71 ± 0.91 mg·GAE/g) collected from the same area, and a significant difference (p < 0.05) in total phenol content was noted. A difference in the total phenol content among sorghum resources collected from the same area (the former Soviet Union) was also observed for K159078 and K159081. The difference in their total phenol content was more than 4-fold (Table 4). It is possible that even genetic resources collected from the same region can cause such differences in the genetic characteristics and inherent properties of the resources; nonetheless, other studies showed similar results [32]. A study of sorghum populations by Ghimire (2021) showed similar results, with a significant difference in total phenol content between resources collected in the same country. This study confirmed the correlation between the antioxidant activity variation pattern and total phenol content. Among the 12 genetic resources, K159081 demonstrated the highest total flavonoid content of 67.71 ± 5.28 mg·QE/g. The lowest total flavonoid content was observed for K159078 (16.46 ± 5.38 mg·QE/g), which showed a >4-fold difference between the same resources collected from the former Soviet Union region. This was also observed for the total phenol content. The genetic characteristics of the plant, climate, and exposure environment lead to variations in total flavonoid content [33,34].

3.3. Phenol Composition Analysis

The phenolic content was measured using the sorghum seed extract. The six phenolic compounds examined in this study were protocatechuic acid, caffeic acid, p-coumaric acid, ferulic acid, taxifolin, and naringenin. Protocatechuic acid content ranged from 7.63 ± 0.03 mg/L to 21.14 ± 0.09 mg/L. The content of caffeic acid ranged from 0.46 ± 0.02 mg/L to 10.73 ± 0.11 mg/L and that of p-coumaric acid ranged from 2.40 ± 0.07 mg/L to 22.44 ± 0.94 mg/L. The content of ferulic acid ranged from 0.86 ± 0.03 mg/L to 4.21 ± 0.30 mg/L, while that of taxifolin ranged from 2.30 ± 0.32 mg/L to 203.67 ± 4.99 mg/L. Naringenin was not detected in four (K159041, K159081, K159100, and K159077) of the 12 resources; its content ranged from 5.54 ± 0.33 mg/L to 43.93 ± 0.49 mg/L in eight resources. K159089 had the highest protocatechuic acid, caffeic acid, ferulic acid, and naringenin contents. K159097 had the highest p-coumaric acid content, while K159093 had the highest taxifolin content. Ferulic acid was the phenolic compound with the lowest content in all the 12 sorghum seeds. Statistical analysis revealed a significant component of the content of six phenolic compounds in sorghum resources (p < 0.05) (Table 5).
Phenolic compounds are widely distributed throughout the plant kingdom and have various structures and molecular weights. When a phenolic hydroxyl group is combined with a macromolecule, it exhibits physiological functions such as antioxidant, anticancer, and antibacterial properties [35]. Polyphenolic compounds present in cereals were reported to exhibit excellent antioxidant properties [36]. Phenolic acids are classified as simple substances that are abundant in the seed coat of almost all sorghum seeds [37]. The contents of gallic acid, chlorogenic acid, caffeic acid, ellagic acid, and p-coumaric acid were examined in a study on the change in antioxidant activity according to the seed roasting temperature and maintenance conditions of phenolic compounds in sorghum seed extracts [38]. In the study by Punia et al. (2021), the contents of nine phenolic compounds in five sorghum varieties were analyzed; the highest taxifolin content reported was 34.96 ± 0.23 mg/L, which was significantly lower than that in the present study (203.67 ± 4.99 mg/L). In their study, the contents of naringenin and other phenolic compounds were also significantly lower than those in the present study. This is because the sorghum genetic resources in this study had a significantly higher phenolic content, and the use of antioxidants and functional foods was considerably high.

3.4. Differences in Expression Levels of Antioxidant-Related Genes in Sorghum Genetic Resources

The correlation between antioxidant activity and the expression of antioxidant enzyme genes was examined by designed primers in the cells of 12 sorghum cultivars (Table 6). The transcription levels of APX1, SOD, and CAT were compared in seed cells. The highest SOD activity was observed in K159041, followed by K159048, K159042, and K159081; the remaining resources showed little expression of SOD in seed cells. Unlike SOD, the expression patterns of APX1 and CAT correlated with the resources. The expression levels of APX1 and CAT were significantly higher in K159041, K159042, and K159048 (Figure 4). This indicated that in resources with high antioxidant activity in DPPH and ABTS assays, ROS scavenging activity did not correlate with the expression levels of antioxidant enzyme genes at the cellular level. Several studies reported results for the enzymatic activity of APX1, SOD, and CAT; however, only a few studies reported the correlation between gene expression levels and ROS scavenging activity [39,40,41]. Antioxidant enzymes typically include SOD, CAT, and APX, and their function is to protect plants from active oxygen under environmental stress, thereby inducing the resistance mechanism against stress. Antioxidant enzymes show physiological activity related to biological health via various adult disease prevention and anti-aging functions, as well as plant defense mechanisms, revealing their value as a health supplement [42]. This finding is in agreement with that of a previous study examining the antioxidant activity of plant-derived natural pigments, wherein plants with the highest antioxidant activity (DPPH assay performed using various plant extracts) and those with high APX, SOD, and CAT activities differed from each other in various patterns [43]. This is because in experiments such as DPPH and ABTS assays, organic solvents are used for extraction and antioxidant activity is determined via absorbance. However, the gene expression of antioxidant enzymes is determined via total RNA extraction, and the expression level detected is examined according to a specific gene sequence. Therefore, the results obtained using different experimental methods could vary. This indicates that the expression levels of APX, SOD, and CAT, which play a role in inactivating H2O2 in the cells of sorghum resources, may differ.

4. Conclusions

Based on the data from this study, the antioxidant activity of sorghum resources adapted and grown in cultivation regions with different climate conditions did not correlate with the precipitation, temperature, or type of climate of the cultivation region. The differences in antioxidant activity varied according to the genetic characteristics of each sorghum resource. Among the six verified phenolic compounds, taxifolin showed the highest content. In addition, K159041, 159042, and 159048, which showed high levels of SOD, APX, and CAT antioxidant enzymes.

Author Contributions

Conceptualization, E.S.S. and M.J.K.; methodology, J.W.S., D.Y.H., J.G.L. and N.Y.K.; supervision, C.Y.Y. and E.S.S.; investigation, E.S.S.; writing, E.S.S. All authors have read and agreed to the published version of the manuscript.

Funding

This research received no external funding.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are contained within the article.

Acknowledgments

This study was supported by the Bioherb Research Institute, Kangwon National University, Republic of Korea.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Zhang, H.H.; Xu, N.; Wu, X.; Wang, J.; Ma, S.; Li, X.; Sun, G. Effects of four types of sodium salt stress on plant growth and photosynthetic apparatus in sorghum leaves. J. Plant Interact. 2018, 13, 506–513. [Google Scholar] [CrossRef] [Scilit]
  2. Zhu, M.; Chen, J.; Yuyama, N.; Luo, L.; Xiao, X.; Lv, Y.; Liu, Y.; Cai, H. Genetic diversity and population structure of broomcorn Sorghum investigated with simple sequence repeat markers. Trop. Plant Biol. 2020, 13, 62–72. [Google Scholar] [CrossRef] [Scilit]
  3. Kaufman, R.C.; Herald, T.J.; Bean, S.R.; Wilsona, J.D.; Tuinstra, M.R. Variability in tannin content, chemistry and activity in a diverse group of tannin containing sorghum cultivars. J. Sci. Food Agric. 2013, 93, 1233–1241. [Google Scholar] [CrossRef] [Scilit]
  4. Kim, J.; Noh, S.K.; Woo, K.S.; Seo, M.C. Sorghum extract lowers lymphatic absorption of trans fat and cholesterol in rats. J. Korean Soc. Food Sci. Nutr. 2016, 45, 783–788. [Google Scholar] [CrossRef] [Scilit]
  5. Liu, H.; Huang, L.; Pei, X. Effects of sorghum rice and black rice on genes associated with cholesterol metabolism in hypercholesterolemic mice liver and intestine. Food Sci. Nutr. 2021, 9, 217–229. [Google Scholar] [CrossRef] [Scilit]
  6. Stefoska-Needham, A.; Beck, E.J.; Johnson, S.K.; Tapsell, L.C. Sorghum: An underutilized cereal whole grain with the potential to assist in the prevention of chronic disease. Food Rev. Inter. 2015, 31, 401–437. [Google Scholar] [CrossRef] [Scilit]
  7. Taleon, V.; Dykes, L.; Rooney, L.W. Rooney Effect of genotype and environment on flavonoid concentration and profile of black sorghum grains. J. Cereal Sci. 2012, 56, 470–475. [Google Scholar] [CrossRef] [Scilit]
  8. Griebel, S.; Web, M.M.; Campanella, O.H.; Craig, B.A.; Weil, C.F.; Tuinstra, M.R. The alkali spreading phenotype in Sorghum bicolor and its relationship to starch gelatinization. J. Cereal Sci. 2019, 86, 41–47. [Google Scholar] [CrossRef] [Scilit]
  9. Hossain, M.S.; Islam, M.N.; Rahman, M.M.; Mostofa, M.G.; Khan, M.A.R. Sorghum: A prospective crop for climatic vulnerability, food and nutritional security. J. Agri. Food Res. 2022, 8, 100300. [Google Scholar] [CrossRef] [Scilit]
  10. Soufan, W.; Okla, M.K.; Salamatullah, A.; Hayat, K.; Abdel-Maksoud, M.A.; Al-Amri, S.S. Seasonal variation in yield, nutritive value, and antioxidant capacity of leaves of alfalfa plants grown in arid climate of Saudi Arabi. Chil. J. Agri. Res. 2021, 81, 182–190. [Google Scholar] [CrossRef] [Scilit]
  11. Joshi, A.; Kaundal, B.; Raigond, P.; Singh, B.; Sethi, S.; Bhowmik, A.; Kumar, R. Low-volume procedure to determine phytate and ascorbic acid in potatoes: Standardization and analysis of Indian cultivars. J. Food Composit. Anal. 2021, 102, 103998. [Google Scholar] [CrossRef] [Scilit]
  12. Nassar, A.M.K.; Sabally, K.; Kubow, S.; Leclerc, Y.N.; Donnelly, D.J. Some canadian-grown potato cultivars contribute to a substantial content of essential dietary minerals. J. Agric. Food Chem. 2012, 60, 4688–4696. [Google Scholar] [CrossRef] [Scilit]
  13. Amombo, E.; Ashilenje, D.; Hirich, A.; Kouisni, L.; Oukarroum, A.; Ghoulam, C.; Gharous, M.E.; Nilahyane, A. Exploring the correlation between salt tolerance and yield: Research advances and perspectives for salt-tolerant forage sorghum selection and genetic improvement. Planta 2022, 255, 71. [Google Scholar] [CrossRef] [Scilit]
  14. Das, K.; Roychoudhury, A. Reactive oxygen species (ROS) and response of antioxidants as ROS-scavengers during environmental stress in plants. Front Environ. Sci. 2014, 2, 53. [Google Scholar] [CrossRef] [Scilit]
  15. Nimse, S.B.; Pal, D. Free radicals, natural antioxidants, and their reaction mechanisms. RSC Adv. 2015, 5, 27986–28006. [Google Scholar] [CrossRef] [Scilit]
  16. Bita, C.; Gerats, T. Plant tolerance to high temperature in a changing environment: Scientifc fundamentals and production of heat stress-tolerant crops. Front. Plant Sci. 2013, 4, 273. [Google Scholar] [CrossRef] [Scilit]
  17. Gill, S.S.; Tuteja, N. Reactive oxygen species and antioxidant machinery in abiotic stress tolerance in crop plants. Plant Physiol. Biochem. 2010, 48, 909–930. [Google Scholar] [CrossRef] [Scilit]
  18. Sang, Q.Q.; Shu, S.; Shan, X.; Guo, S.R.; Sun, J. Effects of exogenous spermidine on antioxidant system of tomato seedlings exposed to high temperature stress. Russ. J. Plant Physiol. 2016, 63, 645–655. [Google Scholar] [CrossRef] [Scilit]
  19. Sharma, S.S.; Dietz, K.J. The relationship between metal toxicity and cellular redox imbalance. Trends Plant Sci. 2009, 14, 43–50. [Google Scholar] [CrossRef] [Scilit]
  20. Hossain, M.A.; Piyatida, P.; Da Silva, J.A.T.; Fujita, M. Molecular mechanism of heavy metal toxicity and tolerance in plants: Central role of glutathione in detoxification of reactive oxygen species and methylglyoxal and in heavy metal chelation. J. Bot. 2012, 2012, 872875. [Google Scholar] [CrossRef] [Scilit]
  21. Ranjan, A.; Sinha, R.; Sharma, T.R.; Pattanayak, A.; Singh, A.K. Alleviating aluminum toxicity in plants: Implications of reactive oxygen species signaling and crosstalk with other signaling pathways. Physiol. Plant. 2021, 173, 1765–1784. [Google Scholar] [CrossRef] [Scilit]
  22. Xiong, Q.; Kadota, S.; Tani, T.; Namba, T. Antioxidative effects of phenylethanoids from Cistanche deserticola. Biol. Pharm. Bull. 1996, 19, 1580–1585. [Google Scholar] [CrossRef] [Scilit]
  23. Ozgen, M.; Reese, R.N.; Jr Tulio, A.Z.; Scheerens, J.C.; Miller, A.R. Modified 2,2-azino-bis-3-ethylbenzothiazoline-6-sulfonic acid(abts) method to measure antioxidant capacity of Selected small fruits and comparison to ferric reducing antioxidant power(FRAP) and 2,2′-diphenyl-1-picrylhydrazyl(DPPH) methods. J. Agri. Food Chem. 2006, 54, 1151–1157. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  24. Oyaizu, M. Studies on products of browning reactions: Antioxidative activities of products of browning reaction prepared from glucosamine. Jpn. J. Nutr. 1986, 44, 307–315. [Google Scholar] [CrossRef] [Scilit]
  25. Appel, H.M.; Governor, H.L.; D’Ascenzo, M.; Siska, E.; Schultz, J.C. Limitations of folin assays of foliar phenolics in ecological studies. J. Chem. Ecol. 2001, 27, 761–778. [Google Scholar] [CrossRef] [Scilit]
  26. Kim, S.H.; Lee, S.Y.; Cho, S.M.; Hong, C.Y.; Park, M.J.; Choi, I.G. Evaluation on anti-fungal activity and synergy effects of essential oil and their constituents from Abies holophylla. J. Korean Wood Sci. Technol. 2016, 44, 113–123. [Google Scholar] [CrossRef] [Scilit]
  27. Bruno, L.B.; Karthik, C.; Ma, Y.; Kadirvelu, K.; Freitas, H.; Rajkumar, M. Amelioration of chromium and heat stresses in Sorghum bicolor by Cr6þ reducing-thermotolerant plant growth promoting bacteria. Chemosphere 2020, 244, 125521. [Google Scholar] [CrossRef] [Scilit]
  28. Ghimire, B.K.; Seo, J.W.; Yu, C.Y.; Kim, S.H.; Chung, I.M. Comparative study on seed characteristics, antioxidant activity, and total phenolic and flavonoid contents in accessions of Sorghum bicolor (L.) Moench. Molecules 2021, 26, 3964. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Punia, H.; Tokas, J.; Malik, A.; Sangwan, S. Characterization of phenolic compounds and antioxidant activity in Sorghum [Sorghum bicolor (L.) Moench] Grains. Cereal Res. Com. 2021, 49, 343–353. [Google Scholar] [CrossRef] [Scilit]
  30. Shen, S.; Huang, R.; Li, C.; Wu, W.; Chen, H.; Shi, J.; Chen, S.; Ye, X. Phenolic compositions and antioxidant activities differ significantly among sorghum grains with different applications. Molecules 2018, 23, 1203. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  31. Wu, G.; Johnson, S.K.; Bornman, J.F.; Bennett, S.J.; Clarke, M.W.; Singh, V.; Fang, Z. Growth temperature and genotype both play important roles in sorghum grain phenolic composition. Sci. Rep. 2016, 6, 21835. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Iqbal, S.; Bhanger, M.I. Effect of season and production location on antioxidant activity of Moringa oleifera leaves grown in Pakistan. J. Food Compos. Anal. 2006, 19, 544–551. [Google Scholar] [CrossRef] [Scilit]
  33. Pirbalouti, A.G.; Hashemi, M.; Ghahfarokhi, F.T. Essential oil and chemical compositions of wild and cultivated Thymus daenensis Celak and Thymus vulgaris L. Ind. Crops Prod. 2013, 48, 43–48. [Google Scholar] [CrossRef] [Scilit]
  34. Jugran, A.K.; Bahukhandi, A.; Dhyani, P.; Bhatt, I.D.; Rawal, R.S.; Nandi, S.K. Impact of altitudes and habitats on valerenic acid, total phenolics, flavonoids, tannins, and antioxidant activity of Valeriana jatamansi. Appl. Biochem. Biotechnol. 2016, 179, 911–926. [Google Scholar] [CrossRef] [Scilit]
  35. Olszowy, M. What is responsible for antioxidant properties of polyphenolic compounds from plants? Plant Physiol. Biochem. 2019, 144, 135–143. [Google Scholar] [CrossRef] [Scilit]
  36. Wang, M.; Zhao, H.; Wen, X.; Ho, C.T.; Li, S. Citrus flavonoids and the intestinal barrier: Interactions and effects. Compr. Rev. Food Sci. Food Saf. 2021, 20, 225–251. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  37. Vanamala, J.K.; Massey, A.R.; Pinnamaneni, S.R.; Reddivari, L.; Reardon, K.F. Grain and sweet sorghum (Sorghum bicolor L. Moench) serves as a novel source of bioactive compounds for human health. Crit. Rev. Food Sci. Nutr. 2018, 58, 2867–2881. [Google Scholar] [CrossRef] [Scilit]
  38. Irondi, E.A.; Adegokea, B.M.; Effiona, E.S.; Oyewoa, S.O.; Alamuc, E.O.; Boligond, A.A. Enzymes inhibitory property, antioxidant activity and phenolics profile of raw and roasted red sorghum grains in vitro. Food Sci. Human Well. 2019, 8, 142–148. [Google Scholar] [CrossRef] [Scilit]
  39. Mulaudzi, T.; Nkuna, M.; Sias, G.; Doumbia, I.Z.; Njomo, N.; Iwuoha, E. Antioxidant capacity of chitosan on sorghum plants under salinity stress. Agriculture 2022, 12, 1544. [Google Scholar] [CrossRef] [Scilit]
  40. Zhao, Y.; Zhai, G.; Li, X.; Tao, H.; Li, L.; He, Y.; Zhang, X.; Wang, F.; Hong, G.; Zhu, Y. Metabolomics reveals nutritional diversity among six coarse cereals and antioxidant activity analysis of grain sorghum and sweet sorghum. Antioxidants 2022, 11, 1984. [Google Scholar] [CrossRef] [Scilit]
  41. Boo, H.O.; Hwang, S.J.; Bae, C.S.; Park, S.H.; Song, W.S. Antioxidant activity according to each kind of natural plant pigments. Korean J. Plant Res. 2011, 24, 105–112. [Google Scholar] [CrossRef] [Scilit]
  42. McEwen, B.J. The influence of diet and nutrients on platelet function. Semin. Thromb. Hemost. 2014, 40, 214–226. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Chun, H.C.; Jung, K.Y.; Choi, Y.D.; Lee, S.H.; Kang, H.W. The growth and yield changes of foxtail millet (Setaria italic L.), proso millet (Panicum miliaceum L.), sorghum (Sorghum bicolor L.), adzuki bean (Vigna angularis L.), and sesame (Sesamum indicum L.) as affected by excessive soil-water. Korean J. Agri. Sci. 2016, 43, 547–559. [Google Scholar]
Figure 1. Locations of Sorghum bicolor genetic resources collected from seven different regions. (A) Australia, New South Wales, (B) former Soviet Union, (C) United States, Nebraska, (D) United States, Texas, (E) United States, Virginia, (F) Sudan, Kordofan, (G) Guadeloupe, Basse-Terre.
Figure 1. Locations of Sorghum bicolor genetic resources collected from seven different regions. (A) Australia, New South Wales, (B) former Soviet Union, (C) United States, Nebraska, (D) United States, Texas, (E) United States, Virginia, (F) Sudan, Kordofan, (G) Guadeloupe, Basse-Terre.
Agronomy 13 01698 g001
Figure 2. Seed shape and colors of Sorghum bicolor genetic resources collected from seven different regions.
Figure 2. Seed shape and colors of Sorghum bicolor genetic resources collected from seven different regions.
Agronomy 13 01698 g002
Figure 3. Reducing power analysis depending on concentrations from seed extract of Sorghum bicolor genetic resources collected from seven different regions. Values represent mean ± S.D. of data obtained from three independent experiments.
Figure 3. Reducing power analysis depending on concentrations from seed extract of Sorghum bicolor genetic resources collected from seven different regions. Values represent mean ± S.D. of data obtained from three independent experiments.
Agronomy 13 01698 g003
Figure 4. Comparative analysis of transcriptional level for antioxidant genes related to ROS scavenging activity using total RNA isolated from seeds of Sorghum bicolor genetic resources collected from seven different regions. (A) SOD, (B) APX1, (C) CAT. Values represent mean ± S.D. of data obtained from three independent experiments.
Figure 4. Comparative analysis of transcriptional level for antioxidant genes related to ROS scavenging activity using total RNA isolated from seeds of Sorghum bicolor genetic resources collected from seven different regions. (A) SOD, (B) APX1, (C) CAT. Values represent mean ± S.D. of data obtained from three independent experiments.
Agronomy 13 01698 g004
Table 1. Average annual temperature and annual precipitation of Sorghum bicolor collection regions.
Table 1. Average annual temperature and annual precipitation of Sorghum bicolor collection regions.
LocationAnnual Average Temperature (°C)Annual Average Precipitation (mm)
LowHigh
Australia, New South Wales16.0026.00863.60
Former Soviet Union8.0018.50488.58
United States, Nebraska2.3016.60882.00
United States, Texas3.8035.5027.25
United States, Virginia−18.3025.001086.00
Sudan, Kordofan23.0535.79104.44
Guadeloupe, Basse-Terre20.5531.1175.73
Table 2. Morphological characteristics of collected Sorghum bicolor seeds.
Table 2. Morphological characteristics of collected Sorghum bicolor seeds.
Accession No.ColorShape
K159041Brown and blackovoid
K159042Light brown and blackovoid
K159078Yellow brownglobose
K159081Reddish brownovoid
K159088Yellow brown and blackovoid
K159089Blackovoid
K159093Yellow brownglobose
K159097Yellow brown and light brownglobose
K159100Reddish brown and yellow brownovoid
K159096Dark brown and yellow brownglobose
K159048Ivoryglobose
K159077Light brownovoid
Table 3. Antioxidant activities of Sorghum bicolor genetic resources collected using DPPH and ABTS analyses.
Table 3. Antioxidant activities of Sorghum bicolor genetic resources collected using DPPH and ABTS analyses.
Accession No.DPPH Activity
(RC50)
ABTS Activity
(RC50)
K15904161.01 ± 2.26 a536.45 ± 11.63 cd
K15904235.64 ± 1.08 a362.74 ± 1.91 ab
K159078582.83 ± 219.07 c1252.60 ± 33.84 e
K15908171.63 ± 0.56 a336.77 ± 24.39 ab
K15908855.56 ± 1.92 a430.01 ± 7.81 bc
K15908938.28 ± 1.50 a356.29 ± 7.05 ab
K15909343.84 ± 1.53 a380.56 ± 8.44 ab
K15909733.52 ± 0.70 a271.06 ± 13.41 a
K15910059.30 ± 1.62 a465.96 ± 42.51 bcd
K15909644.36 ± 0.67 a343.50 ± 12.07 ab
K159048−289.44 ± 22.99 b2874.26 ± 252.45 f
K159077186.80 ± 14.33 b569.89 ± 25.47 d
Values represent mean ± S.D. of data obtained from three independent experiments. Duncan’s Multiple Range Test at 5% level (DMRT, p < 0.05). Significant statistical differences are indicated by different letters.
Table 4. Content comparison for total phenol and total flavonoid in Sorghum bicolor genetic resources collected.
Table 4. Content comparison for total phenol and total flavonoid in Sorghum bicolor genetic resources collected.
Accession No.Total Phenol Contents
(mg∙GAE/g)
Total Flavonoid Contents
(mg∙QE/g)
K159041125.71 ± 0.91 h17.94 ± 0.36 c
K159042231.21 ± 2.17 a17.17 ± 0.14 c
K15907832.14 ± 0.30 k16.46 ± 2.78 c
K159081147.54 ± 1.07 f67.71 ± 5.38 a
K159088139.08 ± 1.55 g21.48 ± 1.38 c
K159089199.00 ± 0.99 c47.04 ± 22.10 b
K159093162.39 ± 1.65 e17.02 ± 1.03 c
K159097216.02 ± 5.52 b23.72 ± 1.51 c
K159100120.60 ± 1.43 i22.32 ± 0.09 c
K159096182.32 ± 0.89 d17.00 ±0.27 c
K15904816.33 ± 0.32 l24.93 ± 1.08 c
K15907780.95 ± 1.73 j41.18 ± 5.11 b
Values represent mean ± S.D. of data obtained from three independent experiments. Duncan’s Multiple Range Test at 5% level (DMRT, p < 0.05). Significant statistical differences are indicated by different letters.
Table 5. Analysis of phenolic compounds from seed extracts of Sorghum bicolor genetic resources collected using HPLC analysis.
Table 5. Analysis of phenolic compounds from seed extracts of Sorghum bicolor genetic resources collected using HPLC analysis.
AccessionsProtocatechuic
Acid
Caffeic Acidp-Coumaric AcidFerulic AcidTaxifolinNaringenin
K15904112.64 ± 0.11 g1.86 ± 0.02 f8.49 ± 0.43 c2.40 ± 0.21 b32.11 ± 0.07 hND
K15904219.54 ± 0.27 b3.95 ± 0.19 c7.83 ± 1.08 c1.55 ± 0.04 cd189.27 ± 2.61 b20.69 ± 0.76 b
K1590787.63 ± 0.03 j4.09 ± 0.09 c7.83 ± 1.98 c2.23 ± 0.08 b2.30 ± 0.32 j5.54 ± 0.33 g
K15908111.21 ± 0.16 i1.48 ± 0.03 g3.18 ± 0.05 e2.15 ± 0.15 b134.10 ± 0.71 cND
K15908814.63 ± 0.25 de4.40 ± 0.16 b5.94 ± 1.47 d2.15 ± 0.26 b66.27 ± 3.21 de1.92 ± 0.74 h
K15908921.14 ± 0.09 a10.37 ± 0.11 a8.69 ± 0.33 c4.21 ± 0.30 a19.11 ± 0.42 i43.93 ± 0.49 a
K15909314.37 ± 0.11 e2.51 ± 0.22 d11.27 ± 0.21 b2.47 ± 0.12 b203.67 ± 4.99 a14.09 ± 0.40 d
K15909712.04 ± 0.22 h1.24 ± 0.02 g22.44 ± 0.94 a1.43 ± 0.26 d61.83 ± 2.02 ef7.25 ± 0.24 f
K15910013.31 ± 0.83 f1.92 ± 0.34 f4.90 ± 0.60 d2.32 ± 0.30 b71.52 ± 10.52 dND
K15909612.14 ± 0.18 gh2.24 ± 0.03 e2.63 ± 0.14 e1.51 ± 0.10 cd59.32 ± 1.88 f11.95 ± 0.24 e
K15904814.90 ± 0.10 d4.47 ± 0.05 b3.03 ± 0.06 e1.77 ± 0.05 c2.36 ± 0.66 j17.78 ± 0.30 c
K15907716.90 ± 0.28 c0.46 ± 0.02 h2.40 ± 0.07 e0.86 ± 0.03 e51.88 ± 1.74 gND
Values represent mean ± S.D. of data obtained from three independent experiments. Duncan’s Multiple Range Test at 5% level (DMRT, p < 0.05). Significant statistical differences are indicated by different letters.
Table 6. Primer sequences used in qPCR analysis to detect the transcriptional expression of APX, SOD and CAT genes.
Table 6. Primer sequences used in qPCR analysis to detect the transcriptional expression of APX, SOD and CAT genes.
Gene Reference IDPrimer Sequence (5′ → 3′)
SODForward: TCGAGTCAAGGCTCACGAAA
Reverse: CTGGCGACTTCTTGGTCTCC
CATForward: GGCAAGTCCCACTACGTCAA
Reverse: AGCTGCTCGTTCTCGTTGAA
APX1Forward: AGAGCGGTCTGGTTTTGAGG
Reverse: GAGCTTGAGGTGGGCTTCTT
pp2aForward: AACCCGCAAAACCCCAGACTA
Reverse: TACAGGTCGGGCTCATGGAAC
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Seo, J.W.; Ham, D.Y.; Lee, J.G.; Kim, N.Y.; Kim, M.J.; Yu, C.Y.; Seong, E.S. Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy 2023, 13, 1698. https://doi.org/10.3390/agronomy13071698

AMA Style

Seo JW, Ham DY, Lee JG, Kim NY, Kim MJ, Yu CY, Seong ES. Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy. 2023; 13(7):1698. https://doi.org/10.3390/agronomy13071698

Chicago/Turabian Style

Seo, Ji Won, Da Ye Ham, Jae Geun Lee, Na Young Kim, Myong Jo Kim, Chang Yeon Yu, and Eun Soo Seong. 2023. "Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe" Agronomy 13, no. 7: 1698. https://doi.org/10.3390/agronomy13071698

APA Style

Seo, J. W., Ham, D. Y., Lee, J. G., Kim, N. Y., Kim, M. J., Yu, C. Y., & Seong, E. S. (2023). Antioxidant Activity, Phenolic Content, and Antioxidant Gene Expression in Genetic Resources of Sorghum Collected from Australia, Former Soviet Union, USA, Sudan and Guadeloupe. Agronomy, 13(7), 1698. https://doi.org/10.3390/agronomy13071698

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop