Predation and Biocontrol Potential of Eupeodes corollae Fabricius (Diptera: Syrphidae) on Wheat Aphids

Abstract

Wheat aphids are major pests of wheat and a significant threat to global food security. Eupeodes corollae Fabricius is one of the dominant species of wheat field hoverflies, but its ability and role in wheat aphid control lack systematic research. This study on the predatory function responses of E. corollae to Rhopalosiphum padi Linnaeus, Schizaphis graminum Rondani, and Sitobion miscanthi, Takahashi showed that the maximum daily predation (1/T_h) of 2nd instar E. corollae larvae was 166.67, 125.00, and 142.86, and that of 3rd instar larvae was 333.33, 250.00, and 250.00, respectively. The cage simulation test indicated that the wheat aphid population decline rate was 100% at the 60th hour of inoculation of 3rd instar E. corollae larvae at a 1:100 ratio. Eupeodes corollae exhibited a predatory relationship with all three wheat aphid species in the wheat fields of Hebei Province, China, and the corrected predation detection rates of E. corollae larvae against R. padi, S. graminum, and S. miscanthi were 12.36%, 1.08%, and 28.77% in 2022, and 6.74%, 0.82%, and 37.56% in 2023, respectively. The results of this study clarify the predatory ability of E. corollae on wheat aphids and the predatory relationship between them and provide technical support for the management of wheat aphids using the bio-control ecological service function of E. corollae.

1. Introduction

Wheat is the collective name for Triticum sp., a crop widely cultivated worldwide. After grinding wheat into flour, it can be used to make bread, steamed buns, biscuits, noodles, and other foods, accounting for approximately 20% of the total daily energy and protein intake of the global population [1], which makes wheat one of the staple foods of humans and one of the most widely distributed, largest, and most traded food crops in the world [2]. According to the statistics of the Food and Agriculture Organization of the United Nations (FAO), the annual global wheat production in 2021–2022 was 778.3 million tons, accounting for 27.65% of global cereal production. With an estimated global output of 9 billion by 2050, safe wheat production is important to meet the growing food demand [3].

Wheat aphids are a major pest of the wheat crop, with characteristics such as rapid reproduction, strong adaptability, migration, oligophagia, and frequent outbreaks that result in substantial crop losses [4]. In recent years, with the impacts of global warming and biodiversity loss, the occurrence of wheat aphids has been much more severe [5]. The main species of wheat aphids are Rhopalosiphum padi Linnaeus, Schizaphis graminum Rondani, and Sitobion miscanthi Takahashi [6]. They harm crops by sucking the phloem of plants with their piercing-sucking mouthparts to cause yellow leaves or unsaturated grains, secreting honeydew to cause mold infections, and spreading plant viruses (such as barley yellow dwarf virus (BYDV)), which further lead to a decrease in crop yield and quality [7]. According to reports, the average annual occurrence of wheat aphids in China’s wheat planting areas is 16 million hectares, resulting in an annual yield loss of up to 500 million ~ 900 million kilograms, accounting for 1/3 of the total losses caused by wheat diseases and pests [8]. Different species of wheat aphids have different temporal and spatial niches, but they often occur in mixed populations with overlapping niches. In general, wheat aphids began to occur at the jointing stage of wheat, and the population continued to increase at the heading and flowering stages, and was the most rampant at the grain filling stage, and then decreased sharply with the increase in summer temperature [9]. Insecticides can quickly eliminate wheat aphids in the short term and reduce the population density of aphids, but their long-term use can easily cause a series of problems, such as the resurgence of pests, killing non-target insects, and endangering human and environmental safety [10]. Reducing the use of chemical agents and replacing them with biological control strategies has become a trend in wheat aphid control [11].

Syrphidae, also known as hoverflies or flower flies, comprise 6674 species in 248 genera worldwide and are the most abundant group of Diptera [12]. About 1/3 of the larvae of the Syrphinae subfamily are predatory, preying on aphids, whiteflies, lepidopteran small larvae, leafhoppers, etc. [13,14,15]. Adult female hoverflies are able to locate aphid communities earlier than other natural enemies of aphids (such as ladybugs and lacewings), lay their eggs near or directly within aphid colonies [16], and directly prey on aphids when the eggs hatch into larvae. Eupeodes corollae Fabricius (Diptera: Syrphidae) is one of the dominant species of wheat field hoverflies [17], widely distributed in Japan, India, Myanmar, China, the Americas, Australia, and other parts of the world [18]. The adults visit flowers and are most common in wheat fields during the heading and flowering stage of wheat. In addition to preying on a variety of aphids [18,19], the larvae of E. corollae can also prey on small lepidopteran larvae [13], playing a vital role in biological control in agri-food ecosystems. In Li’s study of the dual ecological service functions of biocontrol and pollination of E. corollae, it was found that E. corollae could inhibit 54–99% and 50–70% of the cotton aphid population on melon and strawberry, respectively [20].

Eupeodes corollae can complete its development and reproduce under laboratory conditions [19], which creates good conditions for artificial breeding and use of it for biological control. Until recently, systematic studies on its ability to prey and control wheat aphid and their predation relationship were lacking. In this study, we mainly evaluated prevention and control capabilities and determined the field predation relationships of E. corollae on R. padi, S. graminum, and S. miscanthi to comprehensively estimate its potential for aphid control and lay a theoretical basis for a biological control strategy for wheat aphids using the natural enemy E. corollae.

2. Materials and Methods

2.1. Insects

Rhopalosiphum. padi, S. graminum, S. miscanthi, and the adult E. corollae (32 females and 19 males) were collected from an experimental field at the Langfang Experimental Station, Chinese Academy of Agricultural Sciences (CAAS; 39°30′29″ N, 116°36′8″ E), in Hebei Province in 2021. The wheat aphids and Myzus persicae Sulzer were reared on wheat seedlings (variety Jimai 22) and broad bean plantlets, respectively, for multiple generations in greenhouses at 20 ± 1 °C, 50 ± 5% RH, and 16:8 (light–dark) hrs. The wheat seedlings and broad bean plantlets were planted in plastic pots (10 cm upper diameter × 7 cm lower diameter × 8 cm height) with nutrient-rich soil and vermiculite. The adult E. corollae were kept in a nylon mesh cage (30 × 40 × 50 cm), and fed 10% v/v honey water and mixed pollen (rape: corn = 3:1). Broad bean plantlets infested with Myzus persicae Sulzer were placed in the cage for E. corollae to lay eggs. After the eggs hatched, larvae were reared with M. persicae to establish experimental populations.

2.2. Predatory Responses of E. corollae to the Wheat Aphids

One 2nd or 3rd instar E. corollae larva (determined by observing the molting of the larvae) of similar size was starved for 24 h, and the wheat seedlings (5 sticks, about 5 cm each) were placed in a Petri dish (9 cm diameter × 1.5 cm height), and then adult aphids of similar size (R. padi, S. graminum, or S. miscanthi) were added as prey, and the number of E. corollae larvae preying on aphids within 24 h was recorded. The prey density of 2nd instar E. corollae larvae was set to 10, 20, 30, 40, and 50 heads/dish, and the 3rd instar E. corollae larvae was set to 40, 60, 80, 100, and 120 heads/dish. Each treatment was repeated five times in an artificial climate chamber (RXZ-436, Ningbo Jiangnan Instrument Factory, Ningbo, China) at 25 ± 1 °C, 50 ± 5% RH, and 16:8 (L:D) h.

2.3. Cage Test

One 3rd instar E. corollae larva of similar size was placed on wheat seedlings infested with S. graminum in a cage (15 × 15 × 30 cm, 200-mesh nylon). The number of primary aphids was set to five gradients (100, 200, 300, 400, and 500) to establish different hoverfly aphid ratios. The control group was set as having no E. corollae larvae, and the number of aphids was 100. The experiment was repeated three times per treatment; one plastic pot (10 cm upper diameter × 7 cm lower diameter × 8 cm height) of wheat seedlings was used per replicate, with 20 plants per pot. The number of aphids was counted at 12, 24, 36, 48, 60, and 72 h. Population decline rate (%) = [(initial number of aphids)−(number of aphids after release with E. corollae)/(initial no. of aphids)] × 100.

2.4. Molecular Detections of E. corollae Feeding on the Wheat Aphids in a Wheat Field

2.4.1. Molecular Method

A single E. corollae sample (the body surface was cleaned with ddH₂O) was placed in a 1.5 mL centrifuge tube, ground with a disposable tissue grinding pestle (Sangon Biotech Co., Ltd., Shanghai, China), and insect DNA was extracted using a TIANapm Genomic DNA Kit (Centrifuge Column Type) (Tiangen Biochemical Technology Co., Ltd., Beijing, China). The extracted DNA samples were frozen at −20 °C for subsequent use. To ensure that the sample DNA extraction process was free of contamination, two negative controls (ddH₂O) were extracted in parallel with all reagents and procedures consistent with those used for sample DNA extraction for each DNA extraction.

DNA molecular detection was performed with reference to the multiplex polymerase chain reaction (PCR) system (10 μL total) described by Yang [21]. The reaction mixture contained ddH₂O (2.0 μL, Tiangen Biochemical Technology Co., Ltd., Beijing, China), 2× Multiplex PCR Master Mix (5.0 μL, QIAGEN, Dusseldorf, Germany), Primer Mix (1.0 μL, Sangon Biotech Co., Ltd., Shanghai, China,

Table 1. Primer sequence information for multiplex PCR systems.

Species	Primers (5′-3′)	Primer Final Concentration (μM)
R. padi	GGTATAATTGGTTCATCCCTTAGAATC	0.8
	ATTGATGAGATTCCTGCTAAATGTAG
S. graminum	CCTGATATATCATTTCCACGATTAAAC	1.0
	ATTGATCAAGGGAACAATGGG
S. miscanthi	CACCATCATTAATAATAATAATCTGTAGTTTC	2.4
	TTGATGAGATTCCTGCTAAATGC
Metopolophium dirhodumu	AGCTATTTTATTAATTTTATCTTTACCAGTC TGCTGGATCAAAAAATGAAGTG	0.8

), BSA (0.5 μL (10 μg/μL), Amresco, Solon, OH, USA), and DNA template (1.5 μL). The PCR reaction was performed using PCR equipment (Veriti TM 96-Well Thermal Cycler, Thermo Fisher Scientific, Beijing, China). PCR reaction pre-denaturation was initiated at 95 °C for 15 min, then denaturation was performed at 94 °C for 30 s, annealing at 63 °C for 1 min 30 s, extension at 72 °C for 1 min (35 cycles total), and finally extension at 72 °C for 10 min. The PCR amplification products were detected on a 3% agarose gel using an electrophoresis instrument (PowerPacTM Universal Power Supply, Bio-Rad, Hercules, CA, USA) and imaged for analysis using a gel UV imager (UVITEC Essential V6, Cambridge, UK). If a target band was present (R. padi 395 bp, S. graminum 296 bp, S. miscanthi 156 bp), it was concluded that the sample contained the corresponding species.

2.4.2. Sensitivity and Specificity of Multiplex PCR Systems

The sensitivity of this multiplex PCR system has been described previously [21]. In addition to the 20 insect species described by Yang (2018), the specificity of this multiplex PCR system was tested using the main insects that occur in the same habitat as the three species of wheat aphids (Table S1) and M. persicae (prey used for the indoor rearing of E. corollae) as templates. All insect samples collected from the field were stored at −80 °C.

2.4.3. Determination of the DNA Detectability Half-Life (t_1/2)

One 3rd instar E. corollae larva (starved for 24 h) and an adult aphid of similar size (R. padi, S. graminum, or S. miscanthi) were placed in a 1.5 mL centrifuge tube, and the larvae that preyed on the aphid were frozen to death with liquid nitrogen at 0, 3, 6, 9, 12, and 15 h and placed at −80 °C. The experimental procedure was described in Section 2.4.1 above. The number of target bands was recorded. Predation detection rate (%) = (no. of target bands detected/no. of samples) × 100. Each treatment was replicated three times, with 10 samples per replicate.

2.4.4. Molecular Detection during Field Predation

The samples of E. corollae larvae (mainly 3rd instar, estimated based on larval size) were collected from the wheat field (a total of 3 plots, each 20 × 40 m) at the Langfang Experimental Station, Chinese Academy of Agricultural Sciences (CAAS; 39°30′29″ N, 116°36′8″ E), in Hebei Province in 2022 and 2023. DNA extraction and PCR detection of the samples were performed as described in Section 2.4.1. The predation detection rate was calculated as described in Section 2.4.2 and corrected using the value of t_1/2 according to the calculation method of Gagnon et al. [22]. The lowest t_1/2 value was set to 1, with this lowest t_1/2 value as the numerator and the other t_1/2 values as the denominators, to obtain the corrected t_1/2 value. The corrected predation detection rate was obtained by multiplying the predation detection rate with the corrected t_1/2 value.

2.5. Data Analysis

The two-step process was followed to analyze the functional response of E. corollae larvae. First, use the following binomial logistic regression function to determine the type of functional response.

N_a/N₀ = exp (P₀ + P₁N₀ + P₂N₀² + P₃N₀³)/1 + exp (P₀ + P₁N₀ + P₂N₀² + P₃N₀³),

where N_a is the number of consumed prey; N₀ is the initial number of prey; and P₀ (intercept), P₁ (linear), P₂ (quadratic), and P₃ (cubic) are the estimated coefficients. The functional response is type I with a constant positive slope and intercept. If P₁ < 0, it is type II. In type III, P₁ > 0 and P₂ < 0. [23]. Next, parameter estimation was performed based on the type of predatory functional response (type II or III).

N_a = aN₀T/(1 + aN₀T_h) (type II),

N_a = (d + bN₀) N₀T/[1 + cN₀ + (d + bN₀) N₀T_h] (Type III),

where a is the instantaneous attack rate; T_h is the prey-handling time; T is the available time for the predator to feed (1 d); and b, c, and d are fitted constants [24].

Differences in the population decline rate, predation detection rate, and corrected predation detection rate were performed using a one-way analysis of variance (ANOVA), followed by Tukey’s honest significant difference (HSD) test, with proportional data first arcsine square root-transformed to meet the assumptions of normality and heteroscedasticity. A logistic model was used to fit the predation detection rates of the three species of wheat aphids in E. corollae larvae. The model equation was:

y = y₀ + a/[1 + (x/x₀) ^b],

where a, b, x₀ and y₀ are model parameters and y is the predation detection rate for x h. The log-rank test was used to test the difference in the predation detection rate-time curves of the three species of wheat aphids in E. corollae larvae. We used SPSS version 25 (IBM, Armonk, NY, USA) to perform all tests, except for the binomial logistic regression function, which we performed in R version 2.0.1 (R Development Core Team 2008). All charts were made using SigmaPlot 12.5 (Systat Software, Inc., Düsseldorf, Germany).

3. Results

3.1. Predatory Responses of E. corollae to the Wheat Aphids

The P₁ values of the 2nd and 3rd instar E. corollae larvae on the three species of wheat aphids were all negative (Table S2), which is in line with a type II functional response. The a of the 2nd instar E. corollae larvae was highest for S. miscanthi (1.180) and lowest for S. graminum (1.065). The attack efficiency (a) of the 3rd instar E. corollae larvae was highest for S. graminum (1.327) and lowest for R. padi (1.178). The handling times (T_h, 0.006 d and 0.003 d) of the 2nd and 3rd instar E. corollae larvae on R. padi were the shortest, and the daily maximum theoretical predation (1/T_h, 166.67 and 333.33) and predation capacity (a/T_h 185.17 and 392.67) were the highest. For the three species of wheat aphids, the predation capacity (a/T_h) of the 3rd instar E. corollae larvae was higher than that of the 2nd instar larvae (

Table 2. The functional responses of 2nd and 3rd instar E. corollae larvae preying on R. padi, S. graminum, and S. miscanthi.

Larval Stage	Model	Prey	Holling II	a	Th (d)	1/Th	a/Th	R2
2nd instar	Type II	R. padi	Na = 1.111N/(1 + 0.0067N)	1.111	0.006	166.67	185.17	0.992
	Type II	S. graminum	Na = 1.065N/(1 + 0.0085N)	1.065	0.008	125.00	133.12	0.876
	Type II	S. miscanthi	Na = 1.180N/(1 + 0.0083N)	1.180	0.007	142.86	168.57	0.983
3rd instar	Type II	R. padi	Na = 1.178N/(1 + 0.0035N)	1.178	0.003	333.33	392.67	0.965
	Type II	S. graminum	Na = 1.327N/(1 + 0.0053N)	1.327	0.004	250.00	331.75	0.946
	Type II	S. miscanthi	Na = 1.264N/(1 + 0.0050N)	1.264	0.004	250.00	316.00	0.934

).

The daily predation of aphids by 2nd and 3rd instar E. corollae larvae on the three species of wheat aphids increased with an increase in prey density, although the rates of predation gradually decreased. When prey density reached a certain level, the daily predation amount tended to stabilize, which was fully compliant with a type II functional response (Figure 1).

3.2. Cage Test

Under different hoverfly–aphid ratios, the aphid population continued to increase in the first 12 h, and the NO. of aphid was 145.00 (1:100), 273.33 (1:200), 336.67 (1:300), 453.33 (1:400), and 576.67 (1:500) at the 12th hour, respectively. Then, the NO. of aphids for the ratios of 1:100, 1:200, 1:400, and 1:500 began to decrease, and the number was 1.67, 20.00, 213.33, and 320.00 at the 72nd hour, respectively. For the ratio of 1:300, the no. of aphids began to decrease at the 24th hour and was 156.67 at the 72nd hour (Figure 2).

Significant differences were observed in the S. graminum population decline rate at 12 (F_5,12 = 9.940, p = 0.001), 24 (F_5,12 = 22.074, p < 0.001), 36 (F_5,12 = 55.780, p < 0.001), 48 (F_5,12 = 67.650, p < 0.001), 60 (F_5,12 = 63.844, p < 0.001), and 72 h (F_5,12 = 117.065, p < 0.001) between treatment groups. The population decline rate for the 1:100, 1:200, 1:300, 1:400, and 1:500 ratios was 98.33%, 90.00%, 47.78%, 46.67%, and 36.00%, respectively, at 72 h (

Table 3. The wheat aphid population decline rate under different treatments.

Treatment	Population Decline Rate (%)
	12 h (1)	24 h	36 h	48 h	60 h	72 h
CK (2)	−58.33 ± 4.41 b	−70.00 ± 10.00 a	−113.33 ± 15.90 c	−150.00 ± 20.82 d	−173.33 ± 26.67 c	−198.33 ± 22.42 d
1:100	−45.00 ± 8.66 b	−5.00 ± 2.89 b	55.00 ± 7.64 a	81.67 ± 6.01 a	88.33 ± 7.26 a	98.33 ± 1.67 a
1:200	−36.67 ± 8.82 ab	−3.33 ± 6.01 b	40.83 ± 8.21 ab	68.33 ± 4.41 ab	74.17 ± 3.00 ab	90.00 ± 2.89 ab
1:300	−12.22 ± 1.11 a	−16.67 ± 6.94 b	3.33 ± 1.92 b	23.33 ± 5.09 bc	31.11 ± 7.29 b	47.78 ± 6.76 bc
1:400	−13.33 ± 3.63 a	8.75 ± 1.91 b	24.17 ± 1.67 ab	25.00 ± 9.46 bc	38.33 ± 3.00 ab	46.67 ± 7.12 bc
1:500	−15.33 ± 6.36 a	−0.33 ± 4.84 b	8.00 ± 2.31 b	18.00 ± 3.05 c	27.33 ± 4.05 b	36.00 ± 3.05 c

⁽¹⁾ At 12, 24, 36, 48, 60, and 72 h after the beginning of the experiment. ⁽²⁾ CK indicates that there were no E. corollae larvae, and the initial number of aphids was 100. Values are mean ± SE. Different lowercase letters in the same column indicate significant differences.

).

3.3. Molecular Detections of E. corollae Feeding on the Wheat Aphids in a Wheat Field

3.3.1. Determination of the DNA Detectability Half-Life (t_1/2)

The multiplex PCR system had good specificity and effectiveness for the detection of these three species of wheat aphids (Figure S1). The predation detection rate-time curves of R. padi (y = 17.419 + 82.952)/[1 + (x/3.896)^2.479], R² = 0.974, F = 24.788, p = 0.0390), S. graminum (y = 2.117 + 72.140)/[1 + (x/7.088)^2.099], R² = 0.985, F = 43.676, p = 0.0225) and S. miscanthi (y = 7.575 + 85.766)/[1 + (x/2.031)^2.194], R² = 0.997, F = 270.548, p = 0.0037) in E. corollae larvae exhibited a declining trend. There was a significant difference in the predation detection rate-time curves of the three species of wheat aphids in the 3rd instar E. corollae larvae (χ² = 9.288, df = 2, p = 0.01). The t_1/2 values of R. padi, S. graminum, and S. miscanthi in the 3rd instar E. corollae larvae were 3.896, 7.088, and 2.031 h, respectively (Figure 3). The predation detection rate-time curves of S. miscanthi decreased by 80.00% from 0 to 6 h, indicating that the degradation of S. miscanthi in E. corollae was rapid during this period. The predation detection rate-time curves of S. graminum decreased slowly by 33.33% from 0 to 6 h. At 6–15 h, the predation detection rate-time curves of R. padi, S. graminum, and S. miscanthi decreased flatly by 20.00%, 26.77%, and 6.67%, respectively.

3.3.2. Molecular Detection during Field Predation

In 2022, significant differences were observed in the corrected predation detection rates of R. padi, S. graminum, and S. miscanthi on May 11 (F_2,6 = 5.161, p = 0.050), May 16 (F_2,6 = 35.427, p < 0.001), May 21 (F_2,6 = 14.133, p = 0.005), and May 26 (F_2,6 = 774.386, p < 0.001). The corrected predation detection rates of S. miscanthi on May 16 (31.67%), May 21 (15.58%), and May 26 (41.79%) were significantly higher than those of R. padi (3.91%, 4.78%, 20.48%) and S. graminum (0.95%, 0.87%, 1.34%). In 2023, there were significant differences in the corrected predation detection rates of R. padi, S. graminum, and S. miscanthi on May 11 (F_2,6 = 126.669, p < 0.001), May 21 (F_2,6 = 540.240, p < 0.001), and May 26 (F_2,6 = 99.948, p < 0.001). The corrected predation detection rates of S. miscanthi on May 11 (35.10%), May 21 (51.28%), and May 26 (47.62%) were significantly higher than those of R. padi (3.91%, 4.78%, 20.48%) and S. graminum (0.95%, 0.87%, 1.34%) (Figure 4).

In 2022 and 2023, there were significant differences between the detection rate (%) (F_2,6 = 103.739, p < 0.001; F_2,6 = 130.033, p < 0.001) and the corrected detection rate (%) (F_2,6 = 240.889, p < 0.001; F_2,6 = 292.577, p < 0.001). The order of the corrected predation detection rates for the three wheat aphid species was S. miscanthi > R. padi > S. graminum, from highest to lowest in both 2022 and 2023 (

Table 4. The predation detection rate and corrected value of field-collected E. corollae larvae.

Year	Prey	Detection Rate (%)	Corrected Detection Rate (%)
2022	R. padi	23.72 ± 1.51 a	12.36 ± 0.78 b
	S. graminum	3.77 ± 1.04 b	1.08 ± 0.29 c
	S. miscanthi	28.77 ± 1.31 a	28.77 ± 1.31 a
2023	R. padi	12.94 ± 2.11 b	6.74 ± 1.10 b
	S. graminum	2.86 ± 0.37 c	0.82 ± 0.11 c
	S. miscanthi	37.56 ± 1.66 a	37.56 ± 1.66 a

Values are mean ± SE. Different lowercase letters in the same column indicate significant differences.

).

4. Discussion

Eupeodes corollae, one of the common natural enemies of aphids in wheat fields [25], provides the dual ecological service functions of biocontrol and pollination that help maintain the ecosystem balance. The voracity of E. corollae larvae (it needs to consume up to 1000 aphids to complete larval development [26]) indicated that they have biocontrol potential for aphids. The results of this study showed that E. corollae larvae can prey on more than one hundred wheat aphids daily and exhibited an inhibitory effect on the growth of S. graminum populations under different hoverfly aphid ratios. At the same time, E. corollae showed predation relationships with R. padi, S. graminum, and S. miscanthi in the wheat fields, but the values of t_1/2 were different. Eupeodes corollae performs the ecological service function of biocontrol in wheat fields and can be regarded as a highly valuable biocontrol agent in the IPM program.

A response in which a predator’s predation rate of prey varies with the density of the prey is called the predatory functional response and is affected by various factors such as the predator’s physiological state, prey species, and the temperature and humidity of the test environment [27,28,29]. In this study, an artificial climate chamber was used to precisely control the temperature and humidity of the test environment, thereby eliminating errors caused by the test environment. According to the trend of predation rate and prey density, predation functional responses are traditionally divided into three types (Holling’s types I, II, and III) [30]. All three types are present in hoverflies. For example, Singh and Mishra found a type I functional response for Ischiodon scutellaris preying on Rhopalosiphum maidis [31]. Holling’s type II has been reported for Episyrphus balteatus and Scaeva albomaculata feeding on M. persicae [32]. Sobhani et al. reported a type III functional response of the third instar of E.balteatus on Aphis gossypii [33]. In this study, we found the 2nd and 3rd instar E. corollae larvae preying on these three wheat aphid species all exhibited Holling’s type II functional response. The 1/T_h of 3rd instar E. corollae on R. padi was 333.33, and the 1/T_h of 3rd instar Episyrphus balteatus was 163.93 [34], which suggests that the E. corollae probably have good biocontrol potential for R. padi. However, we only studied the predation of aphids within 24 h of 2nd and 3rd instar E. corollae larvae, and there is a lack of information on the predation of the whole larval stage, which needs to be improved for a comprehensive understanding of its biocontrol potential. The 1/T_h of the 3rd instar E. corollae larvae for these three wheat aphid species was higher than that of the 2nd instar in this study, which is a logical reflection of their larger size and the additional need for nutrients during their subsequent non-feeding pupal stage.

Biological control plays a non-negligible role in IPM programs [35], and a comprehensive understanding of the effectiveness of natural enemies against pests is important for biological control. Pekas et al. have shown that the aphid populations were reduced by 71% and 80% in the E. corollae treatments compared to the control in the first and second experiments, respectively, which demonstrate that E. corollae can provide pest control services [36]. In this study, the rate of wheat aphid population decline at a ratio of 1:100 to 1:200 was as high as 90% at 72 h. Considering the application cost in production, field prevention and control should be carried out at a ratio of 1:200. When the ratio of E. corollae larvae to wheat aphids in the field is greater than 1:200, slow or no application of chemical pesticides is recommended for the comprehensive control of wheat aphids. Compared with adult E. corollae (the Aphis craccivora population decline rates of the 1:2000 ratios were close to 100% at 12 d after the release of E. corollae adults) [37], the larvae’s control ability was poor, but the effect was quicker. Therefore, this method of using E. corollae larvae could be used as an emergency measure for aphid control. Concurrently, considering the fact that the 3rd instar larvae are nearing pupation [19], their short duration of prevention and control is a disadvantage. Adults and larvae of E. corollae can be considered for the simultaneous control of wheat aphids in later stages.

Natural predators play a crucial role in the agri-food web due to their predation on pests. In general, it is difficult to determine the role of predators that feed on multiple pests (such as ladybirds, grass flies, and hoverflies) in various trophic pathways, making it an important task to study and analyze their nutrient interactions in ecosystems. With the development of molecular biology, DNA molecular detection techniques for target species based on polymerase chain reaction (PCR) have been increasingly applied to the study of predation relationships [22,38,39]. At the same time, the establishment of temporal patterns of prey DNA detectability and the use of t_1/2 to correct predation detection rates are necessary to interpret the study results of field samples in an ecologically meaningful way [40,41]. In this study, the t_1/2 values of the three wheat aphid species in the 3rd instar E. corollae larvae were different, with values ranging from 2.031 to 7.088 h. We accurately reflected the predation relationship between E. corollae and wheat aphids (R. padi, S. graminum, and S. miscanthi) in the field under natural conditions by DNA molecular detection technology and found that the corrected predation detection rates of R. padi and S. miscanthi by field E. corollae larvae were higher than those of S. graminum in both 2022 and 2023, possibly because R. padi and S. miscanthi are the dominant species of wheat aphids [42]. Based on the results of molecular testing of R. padi, S. graminum, and S. miscanthi in E. corollae larvae collected from the field in 2022 and 2023, we can infer that the peak occurrence of these three species of wheat aphids in wheat fields is different, and there is an overlap in the time niche of their occurrence. The DNA molecular detection technology had the characteristics of high efficiency, low price, and high specificity; however, it is affected by factors such as scavenging behavior, indirect predation, and the digestive capacity of predators [43]. In practical application, it is necessary to combine a variety of methods to obtain more complete information and evaluate the predation relationship between natural enemies and pests more scientifically.

In recent years, the landscape pattern of farmlands has undergone tremendous changes, and the service functions of agricultural ecosystems have also been affected [44]. The study of the predation and control capabilities of natural enemy insects against pests is an effective way to analyze their biocontrol service functions [45]. In conclusion, our results show that Eupeodes corollae exhibited high predation and biocontrol potential for the wheat aphids (R. padi, S. graminum, and S. miscanthi), which strengthened the biological control theory of “insect control” and provides a reference for the application of E. corollae as a natural enemy insect. In order to comprehensively evaluate the benefits of biocontrol services in the practical application of E. corollae, the effects of the variable environment, intraspecific competition, and interspecific interference under natural conditions on its predation and control capabilities require further consideration.

5. Conclusions

Herein, our research showed that E. corollae larvae could prey on more than one hundred wheat aphids daily and exhibited an inhibitory effect on the increase in the population of the aphids. The field population tests indicated that E. corollae had a close predation–prey relationship with R. padi, S. graminum, and S. miscanthi in the wheat natural ecosystem. It is suggested that, as a common natural enemy, E. corollae plays an important role in biological control of wheat aphids. Therefore, it is necessary to increase the population density of the hoverfly in wheat fields to reduce the occurrence of pests.