Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples
Abstract
1. Introduction
2. Results
3. Discussion
4. Materials and Methods
4.1. Sample Materials
4.2. Nucleic Acid Extraction and Internal Amplification Control
4.3. Applied Target-Specific PCRs
4.4. Applied Non-Target-Specific PCR
4.5. Statistical Assessment
4.6. Ethical Clearance
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Appendix A
| Real-Time PCR Assay | GenBank Accession Number | Sequence |
| PCR 1 | AF023245 | 5′- AACACGGACCCACCAGGTTGATTCTGCCTGACGTAGATGCTAGTCTCTGAGATTAAGCCATGCATGTCAGTGAAGCCTTACGGTGGAACGGCGAACGGCTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAACTAACCACGGTAACCTGTGGCTAAAAGCGGAGAATAAGGCGCAACCCTATCAGCTTGTTGGTAGTGTAAAGGACTACCAAGGCCATGACGGGTAACGGGAAATCAGGGTTTGATTCCGGAGAGGGAGCCTGAGAGATGGCTCCCACGTCCAAGGACGGCAGCAGGCGCGAAACTTGTCCACTCCTTACGGGGGAGACAGTCATGAGACGTGAGTATAAGACCTGAGTGTAAAGACCTTAGGGTGAAGCAATTGGAGGGCAAGCTTTGGTGCCAGCAGC-3′ |
| PCR 2 | KC513629.1 | 5′- GACGTAGTAGCCATCTCTCAGGCTCCCTCTCCGGAACCAAACCCTGATCCCCCGTATCCCGTCTGCGCCTAGTTAGGCCATTACCCTAACTACCAGCTGATAGGCCCACAACTTACTTGCCAACCCCCACAGGGGCAGACCACTATCTGCAGTTTCCCGCAGCTACTGCTCATCCCGCAAACAAATCATCGTGCTATCACTGAGCCGTCCGCTAATCCCCCACAAAGAGTTCACAAGCATGCATGGCTTAGCCCCAGAGAATAGCATCCACGTCAGGCAGAATCAACCTGATGCCCCACA-3′ |
| PCR 3 | AF024657 | 5′- GGAAAACTTACCAGGGTCAAGTCATTCGTTGATCGAATACGTGAGAATGGCAGGAGTGGTGCATGGCCGTTGGAAATTGATGGGGCGACCTTTAGCTTAAATGCTTAAACCAGTGAGACCTCCTTGACAGGTGTTCTGTAACACAGGAGGGTGGAGGCTATAACAGGTCCGTGATGCCCTTAGATATCCTGGGCAGCAAGCGCAATACAATATCTCTTCAGT-3′ |
| PCR 4 | AF023245 | 5′- GGTGCGGTGGTGTGTGCAGGCGTGAGAGTGTATCTGCAAGTGTGAGGGATGTGGGTGCAGCGAGTTAGAGGTGGTTCCATGTGGAATAGTGGGATTGGTACGTGATGGTTGGATGGGGGAATGAT-3′ |
| PCR 5 | U09929 | 5′- AGGATCATAACACCAGGTTGATTCTGCCTGACGTGGATGCTATTCTCTGGGACTAAGCCATGCATGTTGATGAACCTTGTGGGGGATTGACGGACGGCTCAGTGATAGTACGATGATTTGGTTGGCGGGAGAGCTGTAACTGCGGGAAACTGCAGGTAGGGGGCTAGGAGTGTTTTTGACACGAGCCAAGTAAGTTGTAGGCCTATCAGCTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGG-3′ |
| PCR 6 | GU291265 | 5′- GAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCC-3′ |
References
- Han, B.; Weiss, L.M. Microsporidia: Obligate Intracellular Pathogens Within the Fungal Kingdom. Fungal Kingd. 2017, 5, 97–113. [Google Scholar] [CrossRef] [Scilit]
- Weiss, L.M. Microsporidia: Emerging pathogenic protists. Acta Trop. 2001, 78, 89–102. [Google Scholar] [CrossRef] [Scilit]
- Keeling, P.J.; McFadden, G.I. Origins of microsporidia. Trends Microbiol. 1998, 6, 19–23. [Google Scholar] [CrossRef] [Scilit]
- Keeling, P. Five Questions about Microsporidia. PLoS Pathog. 2009, 5, e1000489. [Google Scholar] [CrossRef] [Scilit]
- Park, E.; Poulin, R. Revisiting the phylogeny of microsporidia. Int. J. Parasitol. 2021. [Google Scholar] [CrossRef] [Scilit]
- Texier, C.; Vidau, C.; Viguès, B.; El Alaoui, H.; Delbac, F. Microsporidia: A model for minimal parasite–host interactions. Curr. Opin. Microbiol. 2010, 13, 443–449. [Google Scholar] [CrossRef] [Scilit]
- Mathis, A.; Weber, R.; Deplazes, P. Zoonotic Potential of the Microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [Scilit]
- Han, B.; Weiss, L.M. Therapeutic targets for the treatment of microsporidiosis in humans. Expert Opin. Ther. Targets 2018, 22, 903–915. [Google Scholar] [CrossRef] [Scilit]
- Anane, S.; Attouchi, H. Microsporidiosis: Epidemiology, clinical data and therapy. Gastroentérol. Clin. Biol. 2010, 34, 450–464. [Google Scholar] [CrossRef] [Scilit]
- Field, A.S.; Milner, D.A., Jr. Intestinal microsporidiosis. Clin. Lab. Med. 2015, 35, 445–459. [Google Scholar] [CrossRef] [Scilit]
- Wang, Z.D.; Liu, Q.; Liu, H.H.; Li, S.; Zhang, L.; Zhao, Y.K.; Zhu, X.Q. Prevalence of Cryptosporidium, microsporidia and Iso-spora infection in HIV-infected people: A global systematic review and meta-analysis. Parasit. Vectors 2018, 11, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qiu, L.; Xia, W.; Li, W.; Ping, J.; Ding, S.; Liu, H. The prevalence of microsporidia in China: A systematic review and me-ta-analysis. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ghoyounchi, R.; Ahmadpour, E.; Spotin, A.; Mahami-Oskouei, M.; Rezamand, A.; Aminisani, N.; Ghojazadeh, M.; Berahmat, R.; Mikaeili-Galeh, T. Microsporidiosis in Iran: A systematic review and meta-analysis. Asian Pac. J. Trop. Med. 2017, 10, 341–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stentiford, G.D.; Becnel, J.J.; Weiss, L.M.; Keeling, P.J.; Didier, E.S.; Bjornson, S.; Kent, M.L.; Freeman, M.; Brown, M.J.F.; Troemel, E.R.; et al. Microsporidia–Emergent Pathogens in the Global Food Chain. Trends Parasitol. 2016, 32, 336–348. [Google Scholar] [CrossRef] [Scilit]
- La Hoz, R.M.; Morris, M.I. Intestinal parasites including Cryptosporidium, Cyclospora, Giardia, and Microsporidia, Entamoeba histolytica, Strongyloides, Schistosomiasis, and Echinococcus: Guidelines from the American Society of Transplantation Infectious Diseases Community of Practice. Clin. Transpl. 2019, 33, e13618. [Google Scholar]
- Han, B.; Takvorian, P.M.; Weiss, L.M. Invasion of Host Cells by Microsporidia. Front. Microbiol. 2020, 11, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Franzen, C.; Müller, A. Microsporidiosis: Human diseases and diagnosis. Microbes Infect. 2001, 3, 389–400. [Google Scholar] [CrossRef] [Scilit]
- Didier, E.S.; Weiss, L.M. Microsporidiosis: Current status. Curr. Opin. Infect. Dis. 2006, 19, 485–492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shadduck, J.A.; Greeley, E. Microsporidia and human infections. Clin. Microbiol. Rev. 1989, 2, 158–165. [Google Scholar] [CrossRef]
- Szumowski, S.C.; Troemel, E.R. Microsporidia-host interactions. Curr. Opin. Microbiol. 2015, 26, 10–16. [Google Scholar] [CrossRef] [Scilit]
- Timofeev, S.; Tokarev, Y.; Dolgikh, V. Energy metabolism and its evolution in Microsporidia and allied taxa. Parasitol. Res. 2020, 119, 1433–1441. [Google Scholar] [CrossRef] [Scilit]
- Valenčáková, A.; Sučik, M. Alternatives in Molecular Diagnostics of Encephalitozoon and Enterocytozoon Infections. J. Fungi 2020, 6, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Arora, D.R.; Arora, B. AIDS-associated parasitic diarrhoea. Indian J. Med. Microbiol. 2009, 27, 185–190. [Google Scholar] [CrossRef] [Scilit]
- Conteas, C.; Didier, E.; Berlin, O. Workup of gastrointestinal microsporidiosis. Dig. Dis. 1997, 15, 330–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ramanan, P.; Pritt, B.S. Extraintestinal Microsporidiosis. J. Clin. Microbiol. 2014, 52, 3839–3844. [Google Scholar] [CrossRef] [Scilit]
- Weber, R.; Bryan, R.T.; Schwartz, D.A.; Owen, R.L. Human microsporidial infections. Clin. Microbiol. Rev. 1994, 7, 426–461. [Google Scholar] [CrossRef] [PubMed]
- Weiss, L.M.; Vossbrinck, C.R. Microsporidiosis: Molecular and Diagnostic Aspects. Adv. Parasitol. 1998, 40, 351–395. [Google Scholar] [CrossRef] [Scilit]
- Dacal, E.; Köster, P.C.; Carmena, D. Diagnóstico molecular de parasitosis intestinales. Enferm. Infecc. Microbiol. Clin. 2020, 38, 24–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Huibers, M.H.W.; Moons, P.; Maseko, N.; Gushu, M.B.; Iwajomo, O.H.; Heyderman, R.S.; Boele van Hensbroek, M.; Brienen, E.A.; van Lieshout, L.; Calis, J.C.J. Multiplex Real-time PCR Detection of Intestinal Protozoa in HIV-infected Children in Malawi: Enterocytozoon Bieneusi Is Common and Associated With Gastrointestinal Complaints and May Delay BMI (Nutri-tional Status) Recovery. Pediatr. Infect. Dis. J. 2018, 37, 910–915. [Google Scholar] [CrossRef] [Scilit]
- Morio, F.; Poirier, P.; Le Govic, Y.; Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; et al. Assessment of the first commercial multiplex PCR kit (ParaGENIE Crypto-Micro Real-Time PCR) for the detection of Cryptosporidium spp., Enterocytozoon bieneusi, and Encephalitozoon intestinalis from fecal samples. Diagn. Microbiol. Infect. Dis. 2019, 95, 34–37. [Google Scholar] [CrossRef] [Scilit]
- Menotti, J.; Cassinat, B.; Sarfati, C.; Liguory, O.; Derouin, F.; Molina, J.M. Development of a real-time PCR assay for quanti-tative detection of Encephalitozoon intestinalis DNA. J. Clin. Microbiol. 2003, 41, 1410–1413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Menotti, J.; Cassinat, B.; Porcher, R.; Sarfati, C.; Derouin, F.; Molina, J.M. Development of a real-time polymer-ase-chain-reaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocom-promised patients with intestinal microsporidiosis. J. Infect. Dis. 2003, 187, 1469–1474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verweij, J.J.; Hove, R.T.; Brienen, E.A.; Van Lieshout, L. Multiplex detection of Enterocytozoon bieneusi and Encephalitozoon spp. in fecal samples using real-time PCR. Diagn. Microbiol. Infect. Dis. 2007, 57, 163–167. [Google Scholar] [CrossRef] [Scilit]
- Menu, E.; Mary, C.; Toga, I.; Raoult, D.; Ranque, S.; Bittar, F. A hospital qPCR-based survey of 10 gastrointestinal parasites in routine diagnostic screening, Marseille, France. Epidemiol. Epidemiol. Infect. 2019, 147, e100. [Google Scholar] [CrossRef] [Scilit]
- Polley, S.D.; Boadi, S.; Watson, J.; Curry, A.; Chiodini, P. Detection and species identification of microsporidial infections using SYBR Green real-time PCR. J. Med. Microbiol. 2011, 60, 459–466. [Google Scholar] [CrossRef] [Scilit]
- Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in hu-man stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [Scilit]
- Taniuchi, M.; Verweij, J.J.; Sethabutr, O.; Bodhidatta, L.; Garcia, L.; Maro, A.; Kumburu, H.; Gratz, J.; Kibiki, G.; Houpt, E.R. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples. Diagn. Microbiol. Infect. Dis. 2011, 71, 386–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, Z.; Orlandi, P.A.; Stenger, D.A. Simultaneous Detection of Four Human Pathogenic Microsporidian Species from Clinical Samples by Oligonucleotide Microarray. J. Clin. Microbiol. 2005, 43, 4121–4128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Qu, Y.; Tan, M.; Kutner, M.H. Random Effects Models in Latent Class Analysis for Evaluating Accuracy of Diagnostic Tests. Biometrics 1996, 52, 797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds-a review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [CrossRef] [Scilit]
- Kock, N.P.; Petersen, H.; Fenner, T.; Sobottka, I.; Schmetz, C.; Deplazes, P.; Pieniazek, N.J.; Albrecht, H.; Schottelius, J. Spe-cies-specific identification of microsporidia in stool and intestinal biopsy specimens by the polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 1997, 16, 369–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kann, S.; Bruennert, D.; Hansen, J.; Mendoza, G.A.C.; Gonzalez, J.J.C.; Quintero, C.L.A.; Hanke, M.; Hagen, R.M.; Backhaus, J.; Frickmann, H. High Prevalence of Intestinal Pathogens in Indigenous in Colombia. J. Clin. Med. 2020, 9, 2786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maaßen, W.; Wiemer, D.; Frey, C.; Kreuzberg, C.; Tannich, E.; Hinz, R.; Wille, A.; Fritsch, A.; Hagen, R.M.; Frickmann, H. Microbiological screenings for infection control in unaccompanied minor refugees: The German Armed Forces Medical Ser-vice’s experience. Mil. Med. Res. 2017, 4, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halfter, M.; Müseler, U.; Hagen, R.M.; Frickmann, H. Enteric pathogens in German police officers after predominantly tropical deployments–A retrospective assessment over 5 years. Eur. J. Microbiol. Immunol. 2020, 10, 172–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Schawaller, M.; Wiemer, D.; Hagen, R.M.; Frickmann, H. Infectious diseases in German military personnel after predominantly tropical deployments: A retrospective assessment over 13 years. BMJ Mil. Health 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Eberhardt, K.A.; Sarfo, F.S.; Dompreh, A.; Kuffour, E.O.; Geldmacher, C.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; et al. Helicobacter pylori Coinfection Is Associated With Decreased Markers of Immune Activation in ART-Naive HIV-Positive and in HIV-Negative Individuals in Ghana. Clin. Infect. Dis. 2015, 61, 1615–1623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Sarfo, F.S.; Eberhardt, K.A.; Dompreh, A.; Kuffour, E.O.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; Oteng-Seifah, E.E.; et al. Helicobacter pylori In-fection Is Associated with Higher CD4 T Cell Counts and Lower HIV-1 Viral Loads in ART-Naïve HIV-Positive Patients in Ghana. PLoS ONE 2015, 10, e0143388. [Google Scholar] [CrossRef] [Scilit]
- Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; De Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef] [Scilit]
- Niesters, H.G. Quantitation of Viral Load Using Real-Time Amplification Techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef] [Scilit]
- Wisselink, G.; van Zanten, E.; Kooistra-Smid, A. Trapped in keratin; a comparison of dermatophyte detection in nail, skin and hair samples directly from clinical samples using culture and real-time PCR. J. Microbiol. Methods 2011, 85, 62–66. [Google Scholar] [CrossRef] [Scilit]
- Landis, J.R.; Koch, G.G. The Measurement of Observer Agreement for Categorical Data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
| Assay or Assay Combination | n | Positives (%) | CT Value Mean (SD), Median (Min, Max)a | Sensitivity (0.95 CI) | Specificity (0.95 CI) |
|---|---|---|---|---|---|
| PCR 1 | 1339 | 87 (6.50) | 24.98 (5.32), 25.70 (14.30, 34.10) | 0.974 (0.899, 0.994) | 0.991 (0.984, 0.995) |
| PCR 2 | 1339 | 47 (3.51) | 29.84 (3.59), 30.10 (23.20, 35.80) | 0.604 (0.492, 0.707) | 1 (n.e.) |
| PCR 3 + 5 | 1339 | 77 (5.75) | 30.22 (5.12), 30.60 (20.50, 38.30) | 0.950 (0.868, 0.982) | 0.998 (0.992, 0.999) |
| PCR 4 + 5 | 1339 | 84 (6.27) | 30.79 (5.34), 31.40 (19.90, 39.50) | 0.961 (0.884, 0.988) | 0.993 (0.986, 0.996) |
| Kappa (0.95 CI) | 1339 | 0.796 (0.742, 0.834) | |||
| PCR 1 | PCR 2 | PCR 3 | PCR 4 | PCR 5 | PCR 6 | |
|---|---|---|---|---|---|---|
| Target specificity | Small subunit ribosomal RNA gene of Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis | Small subunit ribosomal RNA gene of Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis | Small subunit ribosomal RNA gene of Enterocytozoon bieneusi | Internal transcribed spacer (ITS) sequence of Enterocytozoon bieneusi | Small subunit ribosomal RNA gene of Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis | Internal transcribed spacer (ITS) sequence of the non-target microorganism Microsporidium spp. |
| Amplicon length | 394 base pairs | 280 base pairs | 202 base pairs | 105 base pairs | 227 base pairs | 87 base pairs |
| Cycle number | 50 | 40 | 40 | 50 | 40 | 45 |
| Forward primer 1 | 5′-CACCAGGTTGATTCTGCCTGA-3′ | 5′-CAGGTTGATTCTGCCTGACG-3′ | 5′-CCAGGGTCAAGTCATTCGTT-3′ | 5′-TGTGTAGGCGTGAGAGTGTATCTG-3′ | 5′-CACCAGGTTGATTCTGCCTGAC-3′ | 5′-TCTTGCGCGTTAATGATCCTT-3′ |
| Forward primer 2 | 5′-TCCGGAGAGGGAGCCTGAG-3′ | n.a. | n.a. | n.a. | n.a. | n.a. |
| Reverse primer 1 | 5′-GCTTGCCCTCCAATTGCTTC-3′ | 5′-CCATCTCTCAGGCTCCCTC-3′ | 5′-TATTGTATTGCGCTTGCTGC-3′ | 5′-CATCCAACCATCACGTACCAATC-3′ | 5′-CTAGTTAGGCCATTACCCTAACTACCA-3′ | 5′-AGGTTGCGGGCGGC-3′ |
| Reverse primer 2 | 5′-GACTTGCCCTCCAATCACATG-3′ | n.a. | n.a. | n.a. | n.a. | n.a. |
| Reverse primer 3 | 5′-CCGACTTGCCCTCCAGTAAA-3′ | n.a. | n.a. | n.a. | n.a. | n.a. |
| Reverse primer 4 | 5′-CTTGGCCTCCAATCAATCTCG-3′ | n.a. | n.a. | n.a. | n.a. | n.a. |
| Hybridization probe * | 5′-TGGCAGCAGGCGCGAAACTTGT-3′ | n.a. | 5′-GATGCCCTTAGATATCCTGG-3′ | 5′-CACTGCACCCACATCCCTCACCCTT-3′ | 5′-CTATCACTGAG+C+CGT+CC-3′ | 5′-ACGGAAGAGCTTCGGGGGCCA-3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tanida, K.; Hahn, A.; Eberhardt, K.A.; Tannich, E.; Landt, O.; Kann, S.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens 2021, 10, 656. https://doi.org/10.3390/pathogens10060656
Tanida K, Hahn A, Eberhardt KA, Tannich E, Landt O, Kann S, Feldt T, Sarfo FS, Di Cristanziano V, Frickmann H, et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens. 2021; 10(6):656. https://doi.org/10.3390/pathogens10060656
Chicago/Turabian StyleTanida, Konstantin, Andreas Hahn, Kirsten Alexandra Eberhardt, Egbert Tannich, Olfert Landt, Simone Kann, Torsten Feldt, Fred Stephen Sarfo, Veronica Di Cristanziano, Hagen Frickmann, and et al. 2021. "Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples" Pathogens 10, no. 6: 656. https://doi.org/10.3390/pathogens10060656
APA StyleTanida, K., Hahn, A., Eberhardt, K. A., Tannich, E., Landt, O., Kann, S., Feldt, T., Sarfo, F. S., Di Cristanziano, V., Frickmann, H., & Loderstädt, U. (2021). Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens, 10(6), 656. https://doi.org/10.3390/pathogens10060656

