Next Article in Journal
Serial Interferon-Gamma Release Assay (IGRA) Testing to Monitor Treatment Responses in Cases of Feline Mycobacteriosis
Next Article in Special Issue
Comparison of Three In-House Real PCR Assays Targeting Kinetoplast DNA, the Small Subunit Ribosomal RNA Gene and the Glucose-6-Phosphate Isomerase Gene for the Detection of Leishmania spp. in Human Serum
Previous Article in Journal
Detection of Zoonotic Cryptosporidium ubiquitum in Alpine Wild Ruminants
 
 
Correction published on 17 February 2022, see Pathogens 2022, 11(2), 256.
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples

by
Konstantin Tanida
1,
Andreas Hahn
2,
Kirsten Alexandra Eberhardt
3,4,
Egbert Tannich
5,6,
Olfert Landt
7,
Simone Kann
8,
Torsten Feldt
9,
Fred Stephen Sarfo
10,
Veronica Di Cristanziano
11,
Hagen Frickmann
1,2,† and
Ulrike Loderstädt
12,*,†
1
Department of Microbiology and Hospital Hygiene, Bundeswehr Hospital Hamburg, 20359 Hamburg, Germany
2
Department of Medical Microbiology, Virology and Hygiene, University Medicine Rostock, 18057 Rostock, Germany
3
Department of Tropical Medicine, Bernhard Nocht Institute for Tropical Medicine & I. Department of Medicine, University Medical Center Hamburg-Eppendorf, 20251 Hamburg, Germany
4
Institute for Transfusion Medicine, University Medical Center Hamburg-Eppendorf, 20251 Hamburg, Germany
5
Bernhard Nocht Institute for Tropical Medicine Hamburg, 20359 Hamburg, Germany
6
National Reference Centre for Tropical Pathogens, 20359 Hamburg, Germany
7
TIB MolBiol, 12103 Berlin, Germany
8
Medical Mission Institute, 97074 Würzburg, Germany
9
Department of Gastroenterology, Hepatology and Infectious Diseases, University Medical Center Düsseldorf, 40225 Düsseldorf, Germany
10
Department of Medicine, Kwame Nkrumah University of Science and Technology, Kumasi, Ghana
11
Institute of Virology, Faculty of Medicine and University Hospital of Cologne, University of Cologne, 50935 Cologne, Germany
12
Department of Hospital Hygiene & Infectious Diseases, University Medicine Göttingen, 37075 Göttingen, Germany
*
Author to whom correspondence should be addressed.
Hagen Frickmann and Ulrike Loderstädt contributed equally to this work.
Pathogens 2021, 10(6), 656; https://doi.org/10.3390/pathogens10060656
Submission received: 1 May 2021 / Revised: 24 May 2021 / Accepted: 25 May 2021 / Published: 26 May 2021 / Corrected: 17 February 2022
(This article belongs to the Special Issue Molecular Diagnostics for Infectious Diseases)

Abstract

Microsporidiosis is an infection predominantly occurring in immunosuppressed patients and infrequently also in travelers. This study was performed to comparatively evaluate the diagnostic accuracy of real-time PCR assays targeting microsporidia with etiological relevance in the stool of human patients in a latent class analysis-based test comparison without a reference standard with perfect accuracy. Thereby, two one-tube real-time PCR assays and two two-tube real-time PCR assays targeting Enterocytozoon bieneusi and Encephalocytozoon spp. were included in the assessment with reference stool material (20), stool samples from Ghanaian HIV-positive patients (903), and from travelers, migrants and Colombian indigenous people (416). Sensitivity of the assays ranged from 60.4% to 97.4% and specificity from 99.1% to 100% with substantial agreement according to Cohen’s kappa of 79.6%. Microsporidia DNA was detected in the reference material and the stool of the HIV patients but not in the stool of the travelers, migrants, and the Colombian indigenous people. Accuracy-adjusted prevalence was 5.8% (n = 78) for the study population as a whole. In conclusion, reliable detection of enteric disease-associated microsporidia in stool samples by real-time PCR could be demonstrated, but sensitivity between the compared microsporidia-specific real-time PCR assays varied.

1. Introduction

Microsporidiosis is a disease caused by intracellular pathogens related to fungi as indicated by phylogenetical analyses [1]. Although microsporidia were already known at the beginning of the 20th century [2], they had initially been misidentified as primitive protozoa and only later were assigned to the phylum of fungi [3], while the phylogenetic assignment remained controversial [4]. More recent assessments consider microsporidia as “intracellular parasites … related to fungi” [1,5]. Many important metabolic pathways are missing due to their extremely reduced and compacted genomes [6]. The genera Nosema, Vittaforma, Brachiola, Pleistophora, Encephalitozoon, Enterocytozoon, Septata (reclassified to Encephalitozoon), and Trachipleistophora have been associated with human disease [2]. Thereby, the four species Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis are considered as the quantitatively most relevant ones with particular focus on Enterocytozoon bieneusi [7]. Therapeutic options are scarce and poorly standardized, comprising tubulin-inhibiting albendazole (Encephalocytozoon spp.) and methionine aminopeptidase type 2-inhibiting fumagillin or its less toxic derivates (Enterocytozoon bieneusi) [8,9].
Microsporidia-associated diarrhea, the most frequent clinical manifestation, is usually an opportunistic medical condition in immunocompromised individuals [10]. The causative agents are abundant worldwide but with particular emphasis on resource-limited settings like sub-Saharan Africa [11]. However, in industrialized countries like the People’s Republic of China, an infection rate about 8% has also recently been shown for Enterocytozoon bieneusi in the stool of patients with acquired immunodeficiency syndrome (AIDS) [12]. In Iran, intestinal infection rates of more than 10% have been described for immunosuppressed patients with diarrhea and particularly low CD4 cell counts of <200/µL [13]. The well-established zoonotic potential of microsporidia [7,9] as well as health risks for immunocompromised individuals due to enrichment of microsporidia via the food chain have been recently discussed [14].
Due to their likely etiological relevance in immunosuppressed individuals, microsporidia have also been demonstrated as a threat to patients under chemotherapy or immunosuppressive drugs, e.g., after transplantation [15]. Nevertheless, microsporidiosis can also infrequently occur in the immunocompetent host, but severely debilitating and even lethal courses are associated with profound immunosuppression [16,17]. However, among not obviously immunocompromised individuals like children, the elderly and travelers, microsporidia have also been detected with increased frequency, partly as asymptomatic colonization [18]. Asymptomatic, latent infections in individuals with intact T-cell mediate host defense have been shown by serological approaches [19].
While gastrointestinal disease with chronic diarrhea and wasting is the most frequent manifestation of clinically apparent microsporidiosis, focal disease like keratoconjunctivitis, cerebritis, or hepatitis has been described as well [16]. Transmission of the pathogens occurs in a spore stage which uses a polar tube as an invasion apparatus to invade the host cell [16]. Within the host cell, microsporidia affect the transcription of various genes involved in innate immunity, ubiquitylation, metabolism, or hormonal signaling and altered degradation pathways [20]. Further, the microbes efficiently harness the host’s metabolism to facilitate their development and reproduction [21].
Intestinal microsporidiosis can be diagnosed from stool samples or small bowel biopsies applying light microscopy with special stains or electron microscopy of the very small spores as well as molecular tools like real-time PCR [10,22,23]. Regarding traditional microscopy of stool samples on stained slides, especially the combination of chitin-staining fluorochromes like Calcofluor White and the modified trichrome stain, has been associated with acceptable sensitivity, immunofluorescence staining with acceptable specificity [24]. Immunofluorescence assays have also been applied for the identification of microsporidia spores in body fluids and tissues [25,26]. In tissues, alternatives to immunostaining comprise Gram stain and Giemsa stain [24].
In particular, ribosomal RNA sequences of microsporidia are frequently used for molecular diagnostic purposes [2,22,27]. Molecular assays targeting microsporidia are in routine use as cost-efficient alternative to microscopical approaches [28]. Accordingly, a variety of real-time PCR assays have been developed for the identification of the most frequently identified microsporidia in human samples, Enterocytozoon bieneusi and Encephalocytozoon spp., for diagnostic and surveillance purposes [29,30,31,32,33,34,35,36,37,38]. In this study, we have compared the diagnostic performance of different in-house real-time PCR assays for the identification of microsporidia in stool samples without a reference standard with perfect accuracy applying latent class analysis (LCA). Of note, LCA is an indirect method for diagnostic accuracy estimation. As a variant of structural equation models, this approach estimates non-observed variables as the disease status over observed variables, i.e., the results of diagnostic tests [39,40]. Stool samples of various populations that are known to show increased intestinal carriage of microsporidia [18] have been used for the assessment.

2. Results

Depending on the assay or assay combination applied, the number of positive samples within the assessed 1339 samples ranged from 47 (PCR 2) to 87 (PCR 1). Microsporidia-specific DNA was detected in diagnostic samples from the diagnostic department of the Bernhard Nocht Institute in Hamburg and in the samples from the HIV patients from Ghana only, while no microsporidia DNA was identified in stool of any other assessed population. Of note, there was no potentially interfering positivity of PCR 6 with specificity for the non-target fungal agents Microsporidium spp. observed; all samples remained negative in PCR 6.
When applying LCA testing for the estimation of test accuracy, the best sensitivity was recorded for PCR 1, followed by the assays PCR 4 + 5, PCR 3 + 5, and PCR 2 in descending order. With the exception of PCR 2, all assays showed a sensitivity of 95% or better, while the sensitivity of PCR 2 scored considerably poorer with a sensitivity of 60.4%. Focusing on specificity, no major differences were observed with a specificity >99% for all assays or assay combinations assessed.
Focusing on Cohen’s kappa, substantial agreement between the assessed assays could be demonstrated. With focus on media cycle threshold (Ct) values, PCR 1 showed 4–5 cycles earlier signals compared to the competitive assays (Table 1).

3. Discussion

The study was performed to assess the diagnostic accuracy of different published real-time PCR assays for the detection of important microsporidia with pathogenic potential for humans [33,35,37,38,41] in stool samples in a test comparison approach without a reference standard with perfect accuracy. Substantial agreement between the compared assays as well as good specificity of all assessed assays or assay combinations could be observed. Also, cross-reactivity with a real-time PCR for the non-target fungi Microsporidium spp., which are similar only by name but phylogenetically distinct, was excluded to make incidental interference due to non-target fungal DNA occurring in stool less likely. The comparably high limit of detection of the applied Microsporidium spp. PCR weakens the interpretability of this additional specificity control, an admitted limitation of the study.
Although PCR 1, which is also diagnostically applied at the Bernhard Nocht Institute for Tropical Medicine, Hamburg, for routine diagnostic purposes, scored best regarding sensitivity, it was in a range similar to the competitor combinations PCR 3 + 5 and PCR 4 + 5 of ≥95%. Only the SybrGreen assay PCR 2 showed a considerably poorer sensitivity of only 60.4%, so it is likely that microsporidia DNA may be overlooked when applying this approach. The observation of the reduced sensitivity of PCR 2 is in line with previous results from a test comparison using an alternatively composed sample population [36]. An obvious association between amplicon length and sensitivity of the assessed real-time PCR assays was not observed.
As a side effect, an overall prevalence of detected microsporidia DNA ranging between 3.5% (n = 47) and 6.5% (n = 87) of the samples was recorded for the assessed sample population. Upon applying the LCA to calculate test accuracy-adjusted prevalence [38,40], we obtained a prevalence of 5.8% (n = 78). Positive samples were only detected among the reference sample materials from the Bernhard Nocht Institute Hamburg and from the sub-population of the HIV-positive Ghanaian patients. The latter is well in line with the known association of microsporidiosis and immunosuppression [10]. In 416 included samples from travelers, migrants, and Colombian indigenous people as indicated in the methods section below, however, no DNA of microsporidia was detected, so the previously reported association with international travel [18] could not be confirmed by our study.
The study has a few limitations. First, due to a lack of availability of microscopically well-characterized samples, LCA as an indirect method for diagnostic accuracy estimation had to be applied. Second, restrictions associated with the ethical clearance for this test assessment did not allow the presentation of clinical data associated with the assessed samples other than the general descriptions as provided in the methods section. Third, a considerably low proportion of positive samples led to broad 95% confidence intervals for the sensitivity estimations. Fourth, considerable sample age of 10 years and more might have interfered with DNA quality, although the applied mode of DNA storage as detailed below is generally associated with excellent preservation in the authors’ experience.

4. Materials and Methods

4.1. Sample Materials

A total of 1339 residual nucleic acid extractions from stool samples were included in the assessment. Those materials comprised 20 residual samples from patients that had tested positive for intestinal microsporidiosis in the routine diagnostics department of the Bernhard Nocht Institute for Tropical Medicine in Hamburg (which is the German National Reference Center for Tropical Pathogens in Hamburg, Germany), 59 residual samples from a previous study in the Colombian tropics [42], 140 residual samples from migrants [43], 195 residual samples from German policemen deployed in the tropics [44], 22 residual samples from German soldiers [45] returning from tropical deployments, and 903 residual DNA samples from African HIV-positive patients from previous studies from Ghana [46,47]. The samples were chosen to ensure a sufficient likelihood of intestinal carriage of microsporidia as associated with the history of travel [18] or immunosuppression [10]. In line with the ethical clearance for this test comparison, the residual sample materials were anonymized and no patient-specific data could be presented, which would be an admitted violation of the STARD (Standards for Reporting Diagnostic Accuracy) criteria [48]. All samples had been stored at −80 °C prior to their submission for periods between few months and 15 years.

4.2. Nucleic Acid Extraction and Internal Amplification Control

Nucleic acids were extracted applying the QiaAMP DNA Stool Mini kit (Qiagen, Hilden, Germany) as suggested by the manufacturer. The extracted DNA was stored at −80 °C prior to the assessments. Internal amplification control was based upon a real-time PCR targeting a Phocid Herpes Virus (PhV) sequence as described elsewhere [49].

4.3. Applied Target-Specific PCRs

All real-time PCRs were run on magnetic induction cyclers (MIC; Bio Molecular Systems Ltd., London, UK). Positive controls consisting of target sequences within plasmids and negative controls consisting of PCR-grade water were included in each run. Two out of five target-specific real-time PCRs targeted both Enterocytozoon bieneusi as well as the three etiologically relevant Encephalocytozoon spp., Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis.
Real-time PCR 1, targeting small subunit ribosomal RNA, was designed based on sequences from previous papers [38,41]. In particular, the two forward primers were identical with the primers MICRO-F (forward-1) and Msp2 (forward-2) from the work by Wang et al. [38] and amended by a common probe and four different reverse primers specifically targeting Enterocytozoon bieneusi (reverse-1, GenBank accession number: AF023245), Encephalitozoon cuniculi (reverse-2, GenBank accession number: MT483990.1), Encephalitozoon hellem (reverse-3, GenBank accession number: MG584868.1), Encephalitozoon intestinalis (reverse-4, GenBank accession number: CP001949.1), respectively (Table 2). The reaction mix consisted of HotStar Taq Mastermix with a total concentration of 6 mM MgCl2, 40 nM of each primer, 10 nM of the probe, and 2 µL DNA eluate per 20 µL volume. The PCR was run with an initial activation step at 95 °C for 15 min followed by 50 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s and amplification for 30 s at 72 °C, and final cooling down to 40 °C for 20 s. The limit of detection as assessed with a dilution series of the positive control plasmid was 90 copies per reaction mix (calculated for all real-time PCRs with the software SciencePrimer.com, http://scienceprimer.com/copy-number-calculator-for-realtime-pcr, last accessed 30 April 2021).
Real-time PCR 2, also targeting Enterocytozoon bieneusi as well as the three etiologically relevant Encephalocytozoon spp., was adapted from the work by Polley and colleagues as a SybrGreen-based approach [35] (Table 2). The reaction mix consisted of QuantiTect SYBR Green PCR Mastermix (Qiagen) with a total concentration of 2.5 mM MgCl2, 250 nM of each primer, and 2 µL DNA eluate per 20 µL volume. The PCR was run with an initial activation step at 95 °C for 15 min followed by 40 cycles of denaturation at 95 °C for 10 s, annealing at 60 °C for 20 s, and amplification for 20 s at 72 °C. After a hold for 2 min at 95 °C and a subsequent hold for 30 s at 75 °C, a melting curve was measured with the settings ramp from 75 °C to 90 °C, rising 0.6 °C per step, waiting 90 s for pre-melt conditioning at the first step, and waiting 5 s for each step afterwards. The limit of detection as assessed with a dilution series of the positive control plasmid was 87 copies per reaction mix.
The real-time PCRs 3 and 4 specifically targeted Enterocytozoon bieneusi. PCR 3 was adapted from Tainiuchi and colleagues [37] (Table 2). The reaction mix consisted of HotStar Taq Mastermix with a total concentration of 3 mM MgCl2, 160 nM of each primer, 200 nM probe, and 2 µL DNA eluate per 20 µL volume. The PCR was run with an initial activation step at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 15 s, as well as by combined annealing and amplification at 58 °C for 60 s, and final cooling down to 40 °C for 10 s. The limit of detection as assessed with a dilution series of the positive control plasmid was 12 copies per reaction mix.
The oligonucleotides for PCR 4 were taken from the publication by Verweij and colleagues [33] (Table 2). The reaction mix consisted of HotStar Taq Mastermix with a total concentration of 5 mM MgCl2, 80 nM of each primer, 100 nM probe, and 2 µL DNA eluate per 20 µL volume. The PCR was run with an initial activation step at 95 °C for 15 min followed by 50 cycles of denaturation at 95 °C for 8 s, annealing at 60 °C for 15 s, amplification for 15 s at 72 °C, and final cooling down to 40 °C for 10 s. The limit of detection as assessed with a dilution series of the positive control plasmid was 16 copies per reaction mix. Sample inhibition control PCR targeting Phocid Herpes Virus (150 nM of each primer, 100 nM probe) as described [49] was included in a duplex real-time PCR approach together with PCR 4.
PCR 5 was also taken from the publication by Verweij and colleagues [33] (Table 2) but targeted the species Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalis. To increase the annealing temperature, the probe was slightly adapted by the inclusion of locked nucleic acids (LNAs) at three positions. The reaction mix consisted of HotStar Taq Mastermix with a total concentration of 5 mM MgCl2, 240 nM of each primer, 250 nM probe, and 2 µL DNA eluate per 20 µL volume. The PCR was run with an initial activation step at 95 °C for 15 min, followed by 40 cycles of denaturation at 95 °C for 15 s, annealing at 60 °C for 30 s, and amplification for 30 s at 72 °C. The limit of detection as assessed with a dilution series of the positive control plasmid was 175 copies per reaction mix.

4.4. Applied Non-Target-Specific PCR

To assess potential non-specific reactions with other fungal pathogens, a non-target PCR for the arbitrarily chosen, non-microsporidial fungal genus Microsporidium spp. (fungi with relevance for skin infections) according to Wisselink and colleagues [50] (Table 2) was added. The reaction mix consisted of HotStar Taq Mastermix with a total concentration of 1.5 mM MgCl2, 300 nM of each primer, 200 nM probe, and 2 µL DNA eluate per 20 µL volume. The PCR was run with an initial activation step at 95 °C for 15 min, followed by 45 cycles of denaturation at 95 °C for 15 s, as well as combined annealing and amplification at 60 °C for 60 s, and final cooling down to 40 °C for 10 s. The limit of detection as assessed with a dilution series of the positive control plasmid was 1443 copies per reaction mix.
Details of the real-time PCR assays 1–6 are summarized in Table 2 and in the Appendix A.

4.5. Statistical Assessment

Latent Class Analysis (LCA) was applied for the test comparison without a reference standard with perfect accuracy as described [37,38]. In detail, the results of PCR 1 vs. PCR 2 vs. PCRs 4 + 5 vs. PCRs 3 + 5 targeting both Enterocytozoon bieneusi and Encephalocytozoon spp., respectively, were compared. PCR 6 results were assessed for potential interference. By doing so, sensitivity and specificity with 0.95 confidence intervals were calculated. Cohen’s kappa indicated the agreement between the qualitative results of the real-time PCRs with the strata poor (below 0.00), slight (0.00–0.20), fair (0.21–0.40), moderate (0.41–0.60), substantial (0.61–0.80), and almost perfect (0.81–1.00), as described elsewhere [51]. Cycle threshold (Ct) values were descriptively assessed. Stata/IC 15.1 for Mac 64-bit Intel (College Station, TX, USA) was applied for the calculations.

4.6. Ethical Clearance

Ethical clearance was obtained from the medical association of Hamburg, Germany, (reference number: WF-011/19) without requirement for obtaining informed consent.

5. Conclusions

In spite of the abovementioned limitations, i.e., the use of residual samples of varying age without microscopic assessment, without detailed clinical information, and showing only a low positivity rate, the described test comparison without a reference standard with perfect accuracy suggests excellent specificity and—with one exception—good sensitivity and agreement for the assessed molecular real-time PCR assays targeting microsporidia in stool samples.

Author Contributions

Conceptualization, H.F. and U.L.; methodology, K.T., A.H. and H.F.; software, A.H.; validation, K.T., A.H. and H.F.; formal analysis, A.H.; investigation, K.T., A.H.; resources, H.F., E.T., K.A.E., T.F., F.S.S., V.D.C., S.K. and U.L.; data curation, K.T., A.H. and H.F.; writing—original draft preparation, H.F. and A.H.; writing—review and editing, K.T., A.H., K.A.E., T.F., F.S.S., V.D.C., E.T., O.L., S.K., H.F. and U.L.; visualization, not applicable; supervision, H.F.; project administration, H.F.; funding acquisition, H.F. and U.L. All authors have read and agreed to the published version of the manuscript.

Funding

The study was funded by grant 36K2-S-45 1922, “Evaluation and optimization of molecular diagnostic tests for tropical parasitic diseases for surveillance and risk assessment purposes in tropical deployment settings—a German-French cooperation project between the German Armed Forces Hospital Hamburg and the Military Hospital Laveran, Marseille” of the German Ministry of Defense (MoD) awarded to Hagen Frickmann. Open access publishing was supported by the open access publishing fund of the University Medical Center, Göttingen, Germany.

Institutional Review Board Statement

Ethical clearance was obtained from the Medical Association of Hamburg, Germany (reference number: WF-011/19) without the requirement for obtaining informed consent.

Informed Consent Statement

Not applicable as waived by the ethics committee.

Data Availability Statement

All relevant data are provided in the manuscript. Raw data can be made available upon reasonable request.

Acknowledgments

Simone Priesnitz and Annett Michel are gratefully acknowledged for excellent technical assistance.

Conflicts of Interest

Olfert Landt is head of the company TIB MolBiol. The funders had no role in the design of the study; in the collection, analyses, or interpretation of data; in the writing of the manuscript, or in the decision to publish the results.

Appendix A

Table A1. Sequences of the Positive Control Plasmid Inserts and Their Origins.
Table A1. Sequences of the Positive Control Plasmid Inserts and Their Origins.
Real-Time PCR AssayGenBank Accession NumberSequence
PCR 1AF0232455′-
AACACGGACCCACCAGGTTGATTCTGCCTGACGTAGATGCTAGTCTCTGAGATTAAGCCATGCATGTCAGTGAAGCCTTACGGTGGAACGGCGAACGGCTCAGTAATGTTGCGGTAATTTGGTCTCTGTGTGTAAACTAACCACGGTAACCTGTGGCTAAAAGCGGAGAATAAGGCGCAACCCTATCAGCTTGTTGGTAGTGTAAAGGACTACCAAGGCCATGACGGGTAACGGGAAATCAGGGTTTGATTCCGGAGAGGGAGCCTGAGAGATGGCTCCCACGTCCAAGGACGGCAGCAGGCGCGAAACTTGTCCACTCCTTACGGGGGAGACAGTCATGAGACGTGAGTATAAGACCTGAGTGTAAAGACCTTAGGGTGAAGCAATTGGAGGGCAAGCTTTGGTGCCAGCAGC-3′
PCR 2KC513629.15′-
GACGTAGTAGCCATCTCTCAGGCTCCCTCTCCGGAACCAAACCCTGATCCCCCGTATCCCGTCTGCGCCTAGTTAGGCCATTACCCTAACTACCAGCTGATAGGCCCACAACTTACTTGCCAACCCCCACAGGGGCAGACCACTATCTGCAGTTTCCCGCAGCTACTGCTCATCCCGCAAACAAATCATCGTGCTATCACTGAGCCGTCCGCTAATCCCCCACAAAGAGTTCACAAGCATGCATGGCTTAGCCCCAGAGAATAGCATCCACGTCAGGCAGAATCAACCTGATGCCCCACA-3′
PCR 3AF0246575′-
GGAAAACTTACCAGGGTCAAGTCATTCGTTGATCGAATACGTGAGAATGGCAGGAGTGGTGCATGGCCGTTGGAAATTGATGGGGCGACCTTTAGCTTAAATGCTTAAACCAGTGAGACCTCCTTGACAGGTGTTCTGTAACACAGGAGGGTGGAGGCTATAACAGGTCCGTGATGCCCTTAGATATCCTGGGCAGCAAGCGCAATACAATATCTCTTCAGT-3′
PCR 4AF0232455′-
GGTGCGGTGGTGTGTGCAGGCGTGAGAGTGTATCTGCAAGTGTGAGGGATGTGGGTGCAGCGAGTTAGAGGTGGTTCCATGTGGAATAGTGGGATTGGTACGTGATGGTTGGATGGGGGAATGAT-3′
PCR 5U099295′-
AGGATCATAACACCAGGTTGATTCTGCCTGACGTGGATGCTATTCTCTGGGACTAAGCCATGCATGTTGATGAACCTTGTGGGGGATTGACGGACGGCTCAGTGATAGTACGATGATTTGGTTGGCGGGAGAGCTGTAACTGCGGGAAACTGCAGGTAGGGGGCTAGGAGTGTTTTTGACACGAGCCAAGTAAGTTGTAGGCCTATCAGCTGGTAGTTAGGGTAATGGCCTAACTAGGCGGAGACGG-3′
PCR 6GU2912655′-
GAACCTGCGGAAGGATCATTAACGCGCAAGAGGTCGAAGTTGGCCCCCGAAGCTCTTCCGTCTCCCCCCCGGGCCTCCCGGGGAGGTTGCGGGCGGCGAGGGGTGCC-3′

References

  1. Han, B.; Weiss, L.M. Microsporidia: Obligate Intracellular Pathogens Within the Fungal Kingdom. Fungal Kingd. 2017, 5, 97–113. [Google Scholar] [CrossRef] [Scilit]
  2. Weiss, L.M. Microsporidia: Emerging pathogenic protists. Acta Trop. 2001, 78, 89–102. [Google Scholar] [CrossRef] [Scilit]
  3. Keeling, P.J.; McFadden, G.I. Origins of microsporidia. Trends Microbiol. 1998, 6, 19–23. [Google Scholar] [CrossRef] [Scilit]
  4. Keeling, P. Five Questions about Microsporidia. PLoS Pathog. 2009, 5, e1000489. [Google Scholar] [CrossRef] [Scilit]
  5. Park, E.; Poulin, R. Revisiting the phylogeny of microsporidia. Int. J. Parasitol. 2021. [Google Scholar] [CrossRef] [Scilit]
  6. Texier, C.; Vidau, C.; Viguès, B.; El Alaoui, H.; Delbac, F. Microsporidia: A model for minimal parasite–host interactions. Curr. Opin. Microbiol. 2010, 13, 443–449. [Google Scholar] [CrossRef] [Scilit]
  7. Mathis, A.; Weber, R.; Deplazes, P. Zoonotic Potential of the Microsporidia. Clin. Microbiol. Rev. 2005, 18, 423–445. [Google Scholar] [CrossRef] [Scilit]
  8. Han, B.; Weiss, L.M. Therapeutic targets for the treatment of microsporidiosis in humans. Expert Opin. Ther. Targets 2018, 22, 903–915. [Google Scholar] [CrossRef] [Scilit]
  9. Anane, S.; Attouchi, H. Microsporidiosis: Epidemiology, clinical data and therapy. Gastroentérol. Clin. Biol. 2010, 34, 450–464. [Google Scholar] [CrossRef] [Scilit]
  10. Field, A.S.; Milner, D.A., Jr. Intestinal microsporidiosis. Clin. Lab. Med. 2015, 35, 445–459. [Google Scholar] [CrossRef] [Scilit]
  11. Wang, Z.D.; Liu, Q.; Liu, H.H.; Li, S.; Zhang, L.; Zhao, Y.K.; Zhu, X.Q. Prevalence of Cryptosporidium, microsporidia and Iso-spora infection in HIV-infected people: A global systematic review and meta-analysis. Parasit. Vectors 2018, 11, 28. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  12. Qiu, L.; Xia, W.; Li, W.; Ping, J.; Ding, S.; Liu, H. The prevalence of microsporidia in China: A systematic review and me-ta-analysis. Sci. Rep. 2019, 9, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  13. Ghoyounchi, R.; Ahmadpour, E.; Spotin, A.; Mahami-Oskouei, M.; Rezamand, A.; Aminisani, N.; Ghojazadeh, M.; Berahmat, R.; Mikaeili-Galeh, T. Microsporidiosis in Iran: A systematic review and meta-analysis. Asian Pac. J. Trop. Med. 2017, 10, 341–350. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  14. Stentiford, G.D.; Becnel, J.J.; Weiss, L.M.; Keeling, P.J.; Didier, E.S.; Bjornson, S.; Kent, M.L.; Freeman, M.; Brown, M.J.F.; Troemel, E.R.; et al. Microsporidia–Emergent Pathogens in the Global Food Chain. Trends Parasitol. 2016, 32, 336–348. [Google Scholar] [CrossRef] [Scilit]
  15. La Hoz, R.M.; Morris, M.I. Intestinal parasites including Cryptosporidium, Cyclospora, Giardia, and Microsporidia, Entamoeba histolytica, Strongyloides, Schistosomiasis, and Echinococcus: Guidelines from the American Society of Transplantation Infectious Diseases Community of Practice. Clin. Transpl. 2019, 33, e13618. [Google Scholar]
  16. Han, B.; Takvorian, P.M.; Weiss, L.M. Invasion of Host Cells by Microsporidia. Front. Microbiol. 2020, 11, 172. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  17. Franzen, C.; Müller, A. Microsporidiosis: Human diseases and diagnosis. Microbes Infect. 2001, 3, 389–400. [Google Scholar] [CrossRef] [Scilit]
  18. Didier, E.S.; Weiss, L.M. Microsporidiosis: Current status. Curr. Opin. Infect. Dis. 2006, 19, 485–492. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Shadduck, J.A.; Greeley, E. Microsporidia and human infections. Clin. Microbiol. Rev. 1989, 2, 158–165. [Google Scholar] [CrossRef]
  20. Szumowski, S.C.; Troemel, E.R. Microsporidia-host interactions. Curr. Opin. Microbiol. 2015, 26, 10–16. [Google Scholar] [CrossRef] [Scilit]
  21. Timofeev, S.; Tokarev, Y.; Dolgikh, V. Energy metabolism and its evolution in Microsporidia and allied taxa. Parasitol. Res. 2020, 119, 1433–1441. [Google Scholar] [CrossRef] [Scilit]
  22. Valenčáková, A.; Sučik, M. Alternatives in Molecular Diagnostics of Encephalitozoon and Enterocytozoon Infections. J. Fungi 2020, 6, 114. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  23. Arora, D.R.; Arora, B. AIDS-associated parasitic diarrhoea. Indian J. Med. Microbiol. 2009, 27, 185–190. [Google Scholar] [CrossRef] [Scilit]
  24. Conteas, C.; Didier, E.; Berlin, O. Workup of gastrointestinal microsporidiosis. Dig. Dis. 1997, 15, 330–345. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  25. Ramanan, P.; Pritt, B.S. Extraintestinal Microsporidiosis. J. Clin. Microbiol. 2014, 52, 3839–3844. [Google Scholar] [CrossRef] [Scilit]
  26. Weber, R.; Bryan, R.T.; Schwartz, D.A.; Owen, R.L. Human microsporidial infections. Clin. Microbiol. Rev. 1994, 7, 426–461. [Google Scholar] [CrossRef] [PubMed]
  27. Weiss, L.M.; Vossbrinck, C.R. Microsporidiosis: Molecular and Diagnostic Aspects. Adv. Parasitol. 1998, 40, 351–395. [Google Scholar] [CrossRef] [Scilit]
  28. Dacal, E.; Köster, P.C.; Carmena, D. Diagnóstico molecular de parasitosis intestinales. Enferm. Infecc. Microbiol. Clin. 2020, 38, 24–31. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  29. Huibers, M.H.W.; Moons, P.; Maseko, N.; Gushu, M.B.; Iwajomo, O.H.; Heyderman, R.S.; Boele van Hensbroek, M.; Brienen, E.A.; van Lieshout, L.; Calis, J.C.J. Multiplex Real-time PCR Detection of Intestinal Protozoa in HIV-infected Children in Malawi: Enterocytozoon Bieneusi Is Common and Associated With Gastrointestinal Complaints and May Delay BMI (Nutri-tional Status) Recovery. Pediatr. Infect. Dis. J. 2018, 37, 910–915. [Google Scholar] [CrossRef] [Scilit]
  30. Morio, F.; Poirier, P.; Le Govic, Y.; Laude, A.; Valot, S.; Desoubeaux, G.; Argy, N.; Nourrisson, C.; Pomares, C.; Machouart, M.; et al. Assessment of the first commercial multiplex PCR kit (ParaGENIE Crypto-Micro Real-Time PCR) for the detection of Cryptosporidium spp., Enterocytozoon bieneusi, and Encephalitozoon intestinalis from fecal samples. Diagn. Microbiol. Infect. Dis. 2019, 95, 34–37. [Google Scholar] [CrossRef] [Scilit]
  31. Menotti, J.; Cassinat, B.; Sarfati, C.; Liguory, O.; Derouin, F.; Molina, J.M. Development of a real-time PCR assay for quanti-tative detection of Encephalitozoon intestinalis DNA. J. Clin. Microbiol. 2003, 41, 1410–1413. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  32. Menotti, J.; Cassinat, B.; Porcher, R.; Sarfati, C.; Derouin, F.; Molina, J.M. Development of a real-time polymer-ase-chain-reaction assay for quantitative detection of Enterocytozoon bieneusi DNA in stool specimens from immunocom-promised patients with intestinal microsporidiosis. J. Infect. Dis. 2003, 187, 1469–1474. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  33. Verweij, J.J.; Hove, R.T.; Brienen, E.A.; Van Lieshout, L. Multiplex detection of Enterocytozoon bieneusi and Encephalitozoon spp. in fecal samples using real-time PCR. Diagn. Microbiol. Infect. Dis. 2007, 57, 163–167. [Google Scholar] [CrossRef] [Scilit]
  34. Menu, E.; Mary, C.; Toga, I.; Raoult, D.; Ranque, S.; Bittar, F. A hospital qPCR-based survey of 10 gastrointestinal parasites in routine diagnostic screening, Marseille, France. Epidemiol. Epidemiol. Infect. 2019, 147, e100. [Google Scholar] [CrossRef] [Scilit]
  35. Polley, S.D.; Boadi, S.; Watson, J.; Curry, A.; Chiodini, P. Detection and species identification of microsporidial infections using SYBR Green real-time PCR. J. Med. Microbiol. 2011, 60, 459–466. [Google Scholar] [CrossRef] [Scilit]
  36. Köller, T.; Hahn, A.; Altangerel, E.; Verweij, J.J.; Landt, O.; Kann, S.; Dekker, D.; May, J.; Loderstädt, U.; Podbielski, A.; et al. Comparison of commercial and in-house real-time PCR platforms for 15 parasites and microsporidia in hu-man stool samples without a gold standard. Acta Trop. 2020, 207, 105516. [Google Scholar] [CrossRef] [Scilit]
  37. Taniuchi, M.; Verweij, J.J.; Sethabutr, O.; Bodhidatta, L.; Garcia, L.; Maro, A.; Kumburu, H.; Gratz, J.; Kibiki, G.; Houpt, E.R. Multiplex polymerase chain reaction method to detect Cyclospora, Cystoisospora, and Microsporidia in stool samples. Diagn. Microbiol. Infect. Dis. 2011, 71, 386–390. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Wang, Z.; Orlandi, P.A.; Stenger, D.A. Simultaneous Detection of Four Human Pathogenic Microsporidian Species from Clinical Samples by Oligonucleotide Microarray. J. Clin. Microbiol. 2005, 43, 4121–4128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  39. Qu, Y.; Tan, M.; Kutner, M.H. Random Effects Models in Latent Class Analysis for Evaluating Accuracy of Diagnostic Tests. Biometrics 1996, 52, 797. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  40. Hahn, A.; Podbielski, A.; Meyer, T.; Zautner, A.E.; Loderstädt, U.; Schwarz, N.G.; Krüger, A.; Cadar, D.; Frickmann, H. On detection thresholds-a review on diagnostic approaches in the infectious disease laboratory and the interpretation of their results. Acta Trop. 2020, 205, 105377. [Google Scholar] [CrossRef] [Scilit]
  41. Kock, N.P.; Petersen, H.; Fenner, T.; Sobottka, I.; Schmetz, C.; Deplazes, P.; Pieniazek, N.J.; Albrecht, H.; Schottelius, J. Spe-cies-specific identification of microsporidia in stool and intestinal biopsy specimens by the polymerase chain reaction. Eur. J. Clin. Microbiol. Infect. Dis. 1997, 16, 369–376. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  42. Kann, S.; Bruennert, D.; Hansen, J.; Mendoza, G.A.C.; Gonzalez, J.J.C.; Quintero, C.L.A.; Hanke, M.; Hagen, R.M.; Backhaus, J.; Frickmann, H. High Prevalence of Intestinal Pathogens in Indigenous in Colombia. J. Clin. Med. 2020, 9, 2786. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  43. Maaßen, W.; Wiemer, D.; Frey, C.; Kreuzberg, C.; Tannich, E.; Hinz, R.; Wille, A.; Fritsch, A.; Hagen, R.M.; Frickmann, H. Microbiological screenings for infection control in unaccompanied minor refugees: The German Armed Forces Medical Ser-vice’s experience. Mil. Med. Res. 2017, 4, 13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  44. Halfter, M.; Müseler, U.; Hagen, R.M.; Frickmann, H. Enteric pathogens in German police officers after predominantly tropical deployments–A retrospective assessment over 5 years. Eur. J. Microbiol. Immunol. 2020, 10, 172–177. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  45. Schawaller, M.; Wiemer, D.; Hagen, R.M.; Frickmann, H. Infectious diseases in German military personnel after predominantly tropical deployments: A retrospective assessment over 13 years. BMJ Mil. Health 2020. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  46. Eberhardt, K.A.; Sarfo, F.S.; Dompreh, A.; Kuffour, E.O.; Geldmacher, C.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; et al. Helicobacter pylori Coinfection Is Associated With Decreased Markers of Immune Activation in ART-Naive HIV-Positive and in HIV-Negative Individuals in Ghana. Clin. Infect. Dis. 2015, 61, 1615–1623. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  47. Sarfo, F.S.; Eberhardt, K.A.; Dompreh, A.; Kuffour, E.O.; Soltau, M.; Schachscheider, M.; Drexler, J.F.; Eis-Hübinger, A.M.; Häussinger, D.; Oteng-Seifah, E.E.; et al. Helicobacter pylori In-fection Is Associated with Higher CD4 T Cell Counts and Lower HIV-1 Viral Loads in ART-Naïve HIV-Positive Patients in Ghana. PLoS ONE 2015, 10, e0143388. [Google Scholar] [CrossRef] [Scilit]
  48. Bossuyt, P.M.; Reitsma, J.B.; Bruns, D.E.; Gatsonis, C.A.; Glasziou, P.P.; Irwig, L.; Lijmer, J.G.; Moher, D.; Rennie, D.; De Vet, H.C.W.; et al. STARD 2015: An updated list of essential items for reporting diagnostic accuracy studies. BMJ 2015, 351, h5527. [Google Scholar] [CrossRef] [Scilit]
  49. Niesters, H.G. Quantitation of Viral Load Using Real-Time Amplification Techniques. Methods 2001, 25, 419–429. [Google Scholar] [CrossRef] [Scilit]
  50. Wisselink, G.; van Zanten, E.; Kooistra-Smid, A. Trapped in keratin; a comparison of dermatophyte detection in nail, skin and hair samples directly from clinical samples using culture and real-time PCR. J. Microbiol. Methods 2011, 85, 62–66. [Google Scholar] [CrossRef] [Scilit]
  51. Landis, J.R.; Koch, G.G. The Measurement of Observer Agreement for Categorical Data. Biometrics 1977, 33, 159–174. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Table 1. Number of positives, sensitivity, and specificity as calculated applying latent class analysis (LCA) for the different assessed microsporidia-specific real-time PCR screening assays targeting Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem and Encephalitozoon intestinalis as well as agreement according to Cohen’s kappa.
Table 1. Number of positives, sensitivity, and specificity as calculated applying latent class analysis (LCA) for the different assessed microsporidia-specific real-time PCR screening assays targeting Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem and Encephalitozoon intestinalis as well as agreement according to Cohen’s kappa.
Assay or Assay CombinationnPositives (%)CT Value
Mean (SD),
Median (Min, Max)a
Sensitivity
(0.95 CI)
Specificity
(0.95 CI)
PCR 1133987 (6.50)24.98 (5.32),
25.70 (14.30, 34.10)
0.974 (0.899, 0.994)0.991 (0.984, 0.995)
PCR 2133947 (3.51)29.84 (3.59),
30.10 (23.20, 35.80)
0.604 (0.492, 0.707)1 (n.e.)
PCR 3 + 5133977 (5.75)30.22 (5.12),
30.60 (20.50, 38.30)
0.950 (0.868, 0.982)0.998 (0.992, 0.999)
PCR 4 + 5133984 (6.27)30.79 (5.34),
31.40 (19.90, 39.50)
0.961 (0.884, 0.988)0.993 (0.986, 0.996)
Kappa (0.95 CI)13390.796 (0.742, 0.834)
n.e. = not estimable. 0.95 CI = 95% confidence interval. Min = minimum. Max = maximum.
Table 2. Details of the real-time PCR assays 1–6, which were included in the test comparison without a reference standard with perfect accuracy for the diagnosis of microsporidia in stool samples. Positive control plasmid inserts are provided in Appendix A.
Table 2. Details of the real-time PCR assays 1–6, which were included in the test comparison without a reference standard with perfect accuracy for the diagnosis of microsporidia in stool samples. Positive control plasmid inserts are provided in Appendix A.
PCR 1PCR 2PCR 3PCR 4PCR 5PCR 6
Target specificitySmall subunit ribosomal RNA gene of Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalisSmall subunit ribosomal RNA gene of Enterocytozoon bieneusi, Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalisSmall subunit ribosomal RNA gene of Enterocytozoon bieneusiInternal transcribed spacer (ITS) sequence of Enterocytozoon bieneusiSmall subunit ribosomal RNA gene of Encephalitozoon cuniculi, Encephalitozoon hellem, and Encephalitozoon intestinalisInternal transcribed spacer (ITS) sequence of the non-target microorganism Microsporidium spp.
Amplicon length394 base pairs280 base pairs202 base pairs105 base pairs227 base pairs87 base pairs
Cycle number504040504045
Forward primer 15′-CACCAGGTTGATTCTGCCTGA-3′5′-CAGGTTGATTCTGCCTGACG-3′5′-CCAGGGTCAAGTCATTCGTT-3′5′-TGTGTAGGCGTGAGAGTGTATCTG-3′5′-CACCAGGTTGATTCTGCCTGAC-3′5′-TCTTGCGCGTTAATGATCCTT-3′
Forward primer 25′-TCCGGAGAGGGAGCCTGAG-3′n.a.n.a.n.a.n.a.n.a.
Reverse primer 15′-GCTTGCCCTCCAATTGCTTC-3′5′-CCATCTCTCAGGCTCCCTC-3′5′-TATTGTATTGCGCTTGCTGC-3′5′-CATCCAACCATCACGTACCAATC-3′5′-CTAGTTAGGCCATTACCCTAACTACCA-3′5′-AGGTTGCGGGCGGC-3′
Reverse primer 25′-GACTTGCCCTCCAATCACATG-3′n.a.n.a.n.a.n.a.n.a.
Reverse primer 35′-CCGACTTGCCCTCCAGTAAA-3′n.a.n.a.n.a.n.a.n.a.
Reverse primer 45′-CTTGGCCTCCAATCAATCTCG-3′n.a.n.a.n.a.n.a.n.a.
Hybridization probe *5′-TGGCAGCAGGCGCGAAACTTGT-3′n.a.5′-GATGCCCTTAGATATCCTGG-3′5′-CACTGCACCCACATCCCTCACCCTT-3′5′-CTATCACTGAG+C+CGT+CC-3′5′-ACGGAAGAGCTTCGGGGGCCA-3′
n.a. = not applicable. * Bases with a plus (+) in front of them are locked nucleic acid (LNA) bases.
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Share and Cite

MDPI and ACS Style

Tanida, K.; Hahn, A.; Eberhardt, K.A.; Tannich, E.; Landt, O.; Kann, S.; Feldt, T.; Sarfo, F.S.; Di Cristanziano, V.; Frickmann, H.; et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens 2021, 10, 656. https://doi.org/10.3390/pathogens10060656

AMA Style

Tanida K, Hahn A, Eberhardt KA, Tannich E, Landt O, Kann S, Feldt T, Sarfo FS, Di Cristanziano V, Frickmann H, et al. Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens. 2021; 10(6):656. https://doi.org/10.3390/pathogens10060656

Chicago/Turabian Style

Tanida, Konstantin, Andreas Hahn, Kirsten Alexandra Eberhardt, Egbert Tannich, Olfert Landt, Simone Kann, Torsten Feldt, Fred Stephen Sarfo, Veronica Di Cristanziano, Hagen Frickmann, and et al. 2021. "Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples" Pathogens 10, no. 6: 656. https://doi.org/10.3390/pathogens10060656

APA Style

Tanida, K., Hahn, A., Eberhardt, K. A., Tannich, E., Landt, O., Kann, S., Feldt, T., Sarfo, F. S., Di Cristanziano, V., Frickmann, H., & Loderstädt, U. (2021). Comparative Assessment of In-House Real-Time PCRs Targeting Enteric Disease-Associated Microsporidia in Human Stool Samples. Pathogens, 10(6), 656. https://doi.org/10.3390/pathogens10060656

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop