Dinoflagellate Proton-Pump Rhodopsin Genes in Long Island Sound: Diversity and Spatiotemporal Distribution
Abstract
:1. Introduction
2. Materials and Methods
2.1. Water Sample Collection
2.2. Genomic DNA Extraction
2.3. Development of Specific Primers for Typical Dinoflagellate Proton-Pump Rhodopsin (DiPPR) Genes and Quantitative Real-Time Quantitative PCR (qPCR)
2.4. DiPPR Gene Cloning and Sequencing of the LIS Water Samples
2.5. RNA Extraction, cDNA Synthesis, and Full-Length cDNA Isolation of DiPPR in the Field and from Karlodinium Veneficum
2.6. Phylogenetic Analysis
2.7. Statistical Analyses of DiPPR/18S rDNA Gene Abundance and Relationships with Environmental Factors
3. Results
3.1. Temporal and Spatial Variations of Phytoplankton Cell Abundance
3.2. Seasonal Changes of Gene Abundance of DiPPR and Phytoplankton 18S rDNA in LIS
3.3. Correlation between DiPPR/18S rDNA Gene Abundance and Environmental Factors
3.4. Correlation between DiPPR/18S rDNA Gene Abundance and Total Phytoplankton Cell Abundance
3.5. DiPPR Gene Diversity in LIS
3.6. Full-Length cDNAs of DiPPRs from the Field Water Sample and K. veneficum
4. Discussion
4.1. Dinoflagellate Specific PPR Primers
4.2. Spatial and Seasonal Changes of Dinoflagellate PPR Gene Abundance in Long Island Sound
4.3. DiPPR Gene Diversity in LIS
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Falkowski, P.G. The role of phytoplankton photosynthesis in global biogeochemical cycles. Photosynth. Res. 1994, 39, 235–258. [Google Scholar] [CrossRef] [PubMed]
- Field, C.B.; Behrenfeld, M.J.; Randerson, J.T.; Falkowski, P.G. Primary production of the biosphere:integrating terrestrial and oceanic components. Science 1998, 281, 237–240. [Google Scholar] [CrossRef] [PubMed]
- Beja, O.; Aravind, L.; Koonin, E.V.; Suzuki, M.T.; Hadd, A.; Nguyen, L.P.; Jovanovich, S.B.; Gates, C.M.; Feldman, R.A.; Spudich, J.L.; et al. Bacterial Rhodopsin: Evidence for a New Type of Phototrophy in the Sea. Science 2000, 289, 1902–1906. [Google Scholar] [CrossRef]
- Beja, O.; Spudich, E.N.; Spudich, J.L.; Leclerc, M.; DeLong, E.F. Proteorhodopsin phototrophy in the ocean. Nature 2001, 411, 786–789. [Google Scholar] [CrossRef] [PubMed]
- Vader, A.; Laughinghouse, H.D., IV; Griffiths, C.; Jakobsen, K.S.; Gabrielsen, T.M. Proton–pumping rhodopsins are abundantly expressed by microbial eukaryotes in a high–Arctic fjord. Environ. Microbiol. 2018, 20, 890–902. [Google Scholar] [CrossRef] [PubMed]
- Gómez–Consarnau, L.; González, J.M.; Riedel, T.; Jaenicke, S.; Wagner–Döbler, I.; Sañudo–Wilhelmy, S.A.; Fuhrman, J.A. Proteorhodopsin light–enhanced growth linked to vitamin–B1 acquisition in marine Flavobacteria. ISME J. 2016, 10, 1102–1112. [Google Scholar] [CrossRef] [PubMed]
- Gómez–Consarnau, L.; RavenNaomi, J.A.; Levine, N.M.; Cutter, L.S.; Wang, D.; Seegers, B.; Arístegu, J.; Fuhrman, J.A. Microbial rhodopsins are major contributors to the solar energy captured in the sea. Sci. Adv. 2019, 5, eaaw8855. [Google Scholar] [CrossRef]
- Lin, S.; Zhang, H.; Zhuang, Y.; Tran, B.; Gill, J. Spliced leader–based metatranscriptomic analyses lead to recognition of hidden genomic features in dinoflagellates. PNAS 2010, 107, 20033–20038. [Google Scholar] [CrossRef]
- Ernst, O.P.; Lodowski, D.T.; Elstner, M.; Hegemann, P.; Brown, L.S.; Kandori, H. Microbial and animal rhodopsins: Structures, functions, and molecular mechanisms. Chem. Rev. 2014, 114, 126–163. [Google Scholar] [CrossRef]
- Guo, Z.; Zhang, H.; Lin, S. Light–Promoted Rhodopsin Expression and Starvation Survival in the Marine Dinoflagellate Oxyrrhis marina. PLoS ONE 2014, 9, e114941. [Google Scholar] [CrossRef]
- Marchetti, A.; Catlett, D.; Hopkinson, B.M.; Ellis, K.; Cassar, N. Marine diatom proteorhodopsins and their potential role in coping with low iron availability. ISME J. 2015, 9, 2745–2748. [Google Scholar] [CrossRef] [PubMed]
- Sabehi, G.; Loy, A.; Jung, K.-H.; Partha, R.; Spudich, J.L.; Isaacson, T.; Hirschberg, J.; Wagner, M.; Béjà, O. New insights into metabolic properties of marine bacteria encoding proteorhodopsins. PLoS Biol. 2005, 3, e273. [Google Scholar] [CrossRef] [PubMed]
- Campbell, B.J.; Waidner, L.A.; Cottrell, M.T.; Kirchman, D.L. Abundant proteorhodopsin genes in the North Atlantic Ocean. Environ. Microbiol. 2008, 10, 99–109. [Google Scholar] [CrossRef] [PubMed]
- Maresca, J.A.; Miller, K.J.; Keffer, J.L.; Sabanayagam, C.R.; Campbell, B.J. Distribution and Diversity of Rhodopsin–Producing Microbes in the Chesapeake Bay. Appl. Environ. Microbiol. 2018, 84, e00137-18. [Google Scholar] [CrossRef] [PubMed]
- Guerrero, L.D.; Vikram, S.; Makhalanyane, T.P.; Cowan, D.A. Evidence of microbial rhodopsins in Antarctic Dry Valley edaphic systems. Environ. Microbiol. 2017, 19, 3755–3767. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, M.; Hosaka, T.; Kojima, K.; Nishimura, Y.; Nakajima, Y.; Kimura-Someya, T.; Shirouzu, M.; Sudo, Y.; Yoshizawa, S. A unique clade of light-driven proton-pumping rhodopsins evolved in the cyanobacterial lineage. Sci. Rep. 2020, 10, 16752. [Google Scholar] [CrossRef] [PubMed]
- Lin, S. Genomic understanding of dinoflagellates. Res. Microbiol. 2011, 162, 551–569. [Google Scholar] [CrossRef]
- Okamoto, O.K.; Hastings, J.W. Novel dinoflagellate clock–related genes identified through microarray analysis. J. Phycol. 2003, 39, 519–526. [Google Scholar] [CrossRef]
- Zhang, H.; Hou, Y.; Miranda, L.; Campbell, D.A.; Sturm, N.R.; Gaasterland, T.; Lin, S. Spliced leader RNA trans–splicing in dinoflagellates. Proc. Natl. Acad. USA 2007, 104, 4618–4623. [Google Scholar] [CrossRef]
- Slamovits, C.H.; Okamoto, N.; Burri, L.; James, E.R.; Keeling, P.J. A bacterial proteorhodopsin proton pump in marine eukaryotes. Nat. Commun. 2011, 2, 183. [Google Scholar] [CrossRef]
- Shi, X.; Li, L.; Guo, C.; Lin, X.; Li, M.; Lin, S. Rhodopsin gene expression regulated by the light dark cycle, light spectrum and light intensity in the dinoflagellate Prorocentrum. Front. Microbiol. 2015, 6, 555. [Google Scholar] [CrossRef]
- Meng, R.; Zhou, C.; Zhu, X.; Huang, H.; Xu, J.; Luo, Q.; Yan, X. Critical light–related gene expression varies in two different strains of the dinoflagellate Karlodinium veneficum in response to the light spectrum and light intensity. J. Photochem. Photobiol. B Biol. 2019, 194, 76–83. [Google Scholar] [CrossRef]
- Zhang, Y.; Lin, X.; Shi, X.; Lin, L.-X.; Luo, H.; Li, L.; Lin, S. Metatranscriptomic signatures associated with regime shift from diatom dominance to a dinoflagellate bloom. Front. Microbiol. 2019, 10, 590. [Google Scholar] [CrossRef]
- Yu, L.; Zhang, Y.; Li, M.; Wang, C.; Lin, X.; Li, L.; Shi, X.; Guo, C.; Lin, S. Comparative metatranscriptomic profiling and microRNA sequencing to reveal active metabolic pathways associated with a dinoflagellate bloom. Sci. Total Environ. 2020, 699, 134323. [Google Scholar] [CrossRef]
- Zhang, H.; Lin, S. Detection and quantification of Pfiesteria piscicida using mitochondrial cytochrome b gene sequence. Appl. Environ. Microbiol. 2002, 68, 989–994. [Google Scholar] [CrossRef]
- Zhang, H.; Lin, S. Development of a cob-18S dual-gene Real-Time PCR assay for Pfiesteria shumwayae and quantification of this species in the natural environment. Appl. Environ. Microbiol. 2005, 71, 7053–7063. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Bhattacharya, D.; Lin, S. Phylogeny of dinoflagellates based on mitochondrial cytochrome b and nuclear small subunit rDNA sequence comparisons. J. Phycol. 2005, 41, 411–420. [Google Scholar] [CrossRef]
- Zhang, H.; Lin, S. Status of mRNA editing and SL RNA trans–splicing groups Oxyrrhis, Noctiluca, Heterocapsa, and Amphidinium as basal lineages of dinoflagellates. J. Phycol. 2008, 44, 703–711. [Google Scholar] [CrossRef] [PubMed]
- Finiguerra, M.; Avery, D.E.; Dam, H.G. No evidence for induction or selection of mutant sodium channel expression in the copepod Acartia husdsonica challenged with the toxic dinoflagellate Alexandrium fundyense. Ecol Evol. 2014, 4, 3470–3481. [Google Scholar] [CrossRef]
- Thompson, J.D.; Higgins, D.G.; Gibson, T.J. CLUSTAL W: Improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res. 1994, 22, 4673–4680. [Google Scholar] [CrossRef] [PubMed]
- Hasegawa, M.; Kishino, H.; Yano, T. Dating the human-ape split by a molecular clock of mitochondrial DNA. J. Mol. Evol. 1985, 22, 160–174. [Google Scholar] [CrossRef]
- Felsenstein, J. Confidence limits on phylogenies: An approach using the bootstrap. Evolution 1985, 39, 783–791. [Google Scholar] [CrossRef] [PubMed]
- Gascuel, O. BIONJ: An improved version of the NJ algorithm based on a simple model of sequence data. Mol. Biol. Evol. 1997, 14, 685–695. [Google Scholar] [CrossRef] [PubMed]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular Evolutionary Genetics Analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547–1549. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Gao, S.; Lercher, M.J.; Hu, S.; Chen, W.H. EvolView, an online tool for visualizing, annotating and managing phylogenetic trees. Nucleic Acids Res. 2012, 40, 569–572. [Google Scholar] [CrossRef] [PubMed]
- Ma, M.; Li, H.; Wang, C.; Li, T.; Wang, J.; Yuan, H.; Yu, L.; Wang, J.; Li, L.; Lin, S. A comparative study reveals the relative importance of prokaryotic and eukaryotic proton pump rhodopsins in a subtropical marginal sea. ISME Commun. 2023, 3, 79. [Google Scholar] [CrossRef] [PubMed]
- Lonsdale, D.J.; Greenfield, D.I.; Hillebrand, E.M.; Nuzzi, R.; Taylor, G.T. Contrasting microplanktonic composition and food web structure in two coastal embayments (Long Island, NY, USA). J. Plankton Res. 2006, 28, 891–905. [Google Scholar] [CrossRef]
- Zhang, H.; Litaker, W.; Vandersea, M.W.; Tester, P.; Lin, S. Geographic distribution of Karlodinium veneficum in the US east coast as detected by ITS– ferredoxin Real–Time PCR assay. J. Plankton Res. 2008, 30, 905–922. [Google Scholar] [CrossRef]
- Gong, W.; Marchetti, A. Estimation of 18S Gene Copy Number in Marine Eukaryotic Plankton Using a Next-Generation Sequencing Approach. Front. Mar. Sci. 2019, 6, 219. [Google Scholar] [CrossRef]
Month | Station | Sample # | Month | Station | Sample # | Month | Station | Sample # |
---|---|---|---|---|---|---|---|---|
January | A4 | 1 | C1 | 33 | F2 | 65 | ||
B3 | 2 | D3 | 34 | H4 | 66 | |||
C1 | 3 | E1 | 35 | I2 | 67 | |||
D3 | 4 | F2 | 36 | October | A4 | 68 | ||
E1 | 5 | H4 | 37 | B3 | 69 | |||
F2 | 6 | I2 | 38 | C1 | 70 | |||
H4 | 7 | K2 | 39 | D3 | 71 | |||
I2 | 8 | May | A4 | 40 | E1 | 72 | ||
J2 | 9 | B3 | 41 | F2 | 73 | |||
K2 | 10 | C1 | 42 | H4 | 74 | |||
February | A4 | 11 | D3 | 43 | I2 | 75 | ||
B3 | 12 | E1 | 44 | J2 | 76 | |||
C1 | 13 | F2 | 45 | K2 | 77 | |||
D3 | 14 | H4 | 46 | November | A4 | 78 | ||
E1 | 15 | I2 | 47 | B3 | 79 | |||
F2 | 16 | J2 | 48 | C1 | 80 | |||
H4 | 17 | K2 | 49 | D3 | 81 | |||
I2 | 18 | July | A4 | 50 | E1 | 82 | ||
J2 | 19 | B3 | 51 | F2 | 83 | |||
K2 | 20 | D3 | 52 | H4 | 84 | |||
March | A4 | 21 | E1 | 53 | I2 | 85 | ||
B3 | 22 | F2 | 54 | J2 | 86 | |||
C1 | 23 | H4 | 55 | December | A4 | 87 | ||
D3 | 24 | August | A4 | 56 | B3 | 88 | ||
E1 | 25 | B3 | 57 | C1 | 89 | |||
F2 | 25 | C1 | 58 | D3 | 90 | |||
H4 | 27 | D3 | 59 | E1 | 91 | |||
I2 | 28 | F2 | 60 | F2 | 92 | |||
J2 | 29 | H4 | 61 | H4 | 93 | |||
K2 | 30 | September | B3 | 62 | I2 | 94 | ||
April | A4 | 31 | D3 | 63 | J2 | 95 | ||
B3 | 32 | E1 | 64 |
Primer Name | Sequence Information | Reference |
---|---|---|
DinoRhodF1N | TACAATGCRCTSTCSTTCGGNATHGC | This study |
DinoRhodF2N | CTCTCGTTCGGCATHGCNGCNATGGG | This study |
DinoRhodF3N | ATGGGYTCYGCAACCRTYTTCTTYTGG | This study |
SymkaLHC3R1 | TCTCTCGAATTCCGTGTGCTTGTGAAACTTTTATC | This study |
DinoRhodR3N | CTCACCNGGRTASCCCARNGCNACCAT | This study |
DinoRhodR2N | CAGAGATCAAGACATGCTTCAGGAC | This study |
DinoRhodR1N | ATGTACACYAANGGGTAAGTGMRCCA | This study |
2-22RhodF1 | GACCTTCATCGCAGCATACC | This study |
2-22RhodF2 | ATGGATTGGTTGCTGACAGTG | This study |
YachtRhod1+2F | GCCATGGCCCCCCTTGC | This study |
YachtRhod3F | GCCATGGCCCCACTTTCCG | This study |
YachtRhod4+5F | GCCATGGCGCCTCTCCCTAC | This study |
YachtRhod1Ra | TCAGCGGAGCAAACGGCCATC | This study |
YachtRhod1Rb | CCAGCGGAGCAAACGGCCATC | This study |
YachtRhod2Ra | TCACTGCAGGGAGCAGCCGC | This study |
YachtRhod2Rb | CCACTGCAGGGAGCAGCCGC | This study |
YachtRhod3Ra | TCAGCGCAACAAGCGGCC | This study |
YachtRhod3Rb | CCAGCGCAACAAGCGGCC | This study |
18SCOMF | TGCATGGCCGTTCTTAGTTGGTGG | [26] |
18SCOMR | CACCTACGGAAACCTTGTTACGAC | [26] |
DinoSL | DCCGTAGCCATTTTGGCTCAAG | [19] |
DinoSL | DCCGTAGCCATTTTGGCTCAAG | [19] |
Racer3 | TGTCAACGATACGCTACGTAACG | Invitrogen |
DinoSL | DCCGTAGCCATTTTGGCTCAAG | [19] |
Racer3 | TGTCAACGATACGCTACGTAACG | Invitrogen |
KarveRhodF1 | CGATTTCTTTCTGGATAATCTCCATT | This study |
KarveRhodF2 | GTTCACTACTTCTACATGCGTGAG | This study |
KarveRhodF3 | TACATGCGTGAGTTCTGGGT | This study |
KarveRhodR1 | TCACCCATGAAGATCTCAAACAAGAT | This study |
KarveRhodR2 | CAATGGGTAAATGCACCAACCAA | This study |
KarveRhodR3 | TCTGCCAAGTCATACGCCAAGTT | This study |
Phytoplankton Species | Strain | cDNA * | gDNA * |
---|---|---|---|
Dinoflagellates | |||
Alexandrium catenella (Whedon and Kofoid) Balech (formally A. fundyence Balech) | CCMP1719 | + | + |
Alexandrium pacificum Litaker | ACHK | + | − |
Amphidinium carterae Hulburth | AC | + | + |
Fugacium kawagutii (formerly Symbiodinium kawagutii) | CCMP2468 | − | − |
Heterocapsa triquetra (Ehrenberg) Stein | CCMP 448 | − | − |
Karenia brevis (Davis) Hansen and Moestrup | Wilson | − | − |
Karlodinium veneficum Larsen | CCMP1975 | − | − |
Oxyrrhis marina Dujardin | CCMP1795 | + | + |
Pfiesteria piscicida Steidinger and Burkholder, 1996 | CCMP1831 | − | − |
Pfiesteria shumwayae Glasgow and Burkholder | CCMP2359 | − | − |
Polarella glacialis Montresor, Procaccini, and Stoecker | CCMP2088 | + | + |
Prorocentrum shikokuense Hada (=P. donghaiense Lu) | − | − | |
Prorocentrum minimum (Pavillard) Schiller | CCMP696 | − | − |
Pyrocystis lunula Schütt | + | − | |
Pyrocystis noctiluca Murray ex Haeckel | CCMP732 | + | − |
Symbiodinium microadriaticum Freudenthal | CCMP 2458 | + | − |
Symbiodinium sp. | SSB01 | − | − |
Non-dinoflagellates | |||
Ditylum brightwellii (T. West) Grunow | CCMP 2227 | − | − |
Dunaliella tertiolecta Butcher | CCMP1320 | − | − |
Emiliania huxleyi (Lohmann) Hay and Mohler | − | − | |
Heterosigma akashiwo Hada ex Hara and Chihara | CCMP 452 | − | − |
Odontella sinensis (Greville) Grunow | CCMP 1815 | − | − |
Rhodomonas sp. | CCMP768 | − | − |
Skeletonema costatum (Greville) Cleve | China30 | − | − |
Thalassiosira pseudonana Hasle and Heimdal | CCMP1335 | − | − |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, H.; Nulick, K.J.; Burris, Z.; Pierce, M.; Ma, M.; Lin, S. Dinoflagellate Proton-Pump Rhodopsin Genes in Long Island Sound: Diversity and Spatiotemporal Distribution. Microorganisms 2024, 12, 628. https://doi.org/10.3390/microorganisms12030628
Zhang H, Nulick KJ, Burris Z, Pierce M, Ma M, Lin S. Dinoflagellate Proton-Pump Rhodopsin Genes in Long Island Sound: Diversity and Spatiotemporal Distribution. Microorganisms. 2024; 12(3):628. https://doi.org/10.3390/microorganisms12030628
Chicago/Turabian StyleZhang, Huan, Kelly J. Nulick, Zair Burris, Melissa Pierce, Minglei Ma, and Senjie Lin. 2024. "Dinoflagellate Proton-Pump Rhodopsin Genes in Long Island Sound: Diversity and Spatiotemporal Distribution" Microorganisms 12, no. 3: 628. https://doi.org/10.3390/microorganisms12030628