Characterization of Circular RNAs in Chinese Buffalo (Bubalus bubalis) Adipose Tissue: A Focus on Circular RNAs Involved in Fat Deposition
Abstract
:Simple Summary
Abstract
1. Introduction
2. Materials and Methods
2.1. Animal Ethics
2.2. Animals and Tissue Samples
2.3. RNA Isolation and Sequencing
2.4. Quality Control, Transcriptome Assembly, and CircRNA Prediction
2.5. Differential Expression, Functional Enrichment, and Co-Expression Analysis
2.6. Validation Assay
3. Results
3.1. Overview of Sequencing and Quality Control
3.2. CircRNAs Expressed in Back Subcutaneous Adipose Tissue of Buffalo
3.3. Identification of DE circRNAs and Functional Enrichment
3.4. Co-Expression Analysis Revealed circRNAs Associated with Fat Deposition
3.5. Validation of DE circRNAs and circRNA–mRNA Pairs
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Sanger, H.L.; Klotz, G.; Riesner, D.; Gross, H.J.; Kleinschmidt, A.K. Viroids are single-stranded covalently closed circular RNA molecules existing as highly base-paired rod-like structures. PNAS 1976, 73, 3852–3856. [Google Scholar] [CrossRef] [PubMed]
- Hsu, M.T.; Coca-Prados, M. Electron microscopic evidence for the circular form of RNA in the cytoplasm of eukaryotic cells. Nature 1993, 280, 339–340. [Google Scholar] [CrossRef] [PubMed]
- Cocquerelle, C.; Mascrez, B.; Hetuin, D.; Bailleul, B. Mis-splicing yields circular RNA molecules. FASEB J. 1993, 7, 155–160. [Google Scholar] [CrossRef] [PubMed]
- Saad, F.A.; Vitiello, L.; Merlini, L.; Mostacciuolo, M.L.; Oliviero, S.; Danieli, G.A. A 3′ consensus splice mutation in the human dystrophin gene detected by a screening for intra-exonic deletions. Hum. Mol. Genet. 1992, 1, 345–346. [Google Scholar] [CrossRef] [PubMed]
- Cocquerelle, C.; Daubersies, P.; Majérus, M.A.; Kerckaert, J.P.; Bailleul, B. Splicing with inverted order of exons occurs proximal to large introns. EMBO J. 1992, 11, 1095–1098. [Google Scholar] [CrossRef] [PubMed]
- Memczak, S.; Jens, M.; Elefsinioti, A.; Torti, F.; Krueger, J.; Rybak, A.; Maier, L.; Mackowiak, S.D.; Gregersen, L.H.; Munschauer, M.; et al. Circular RNAs are a large class of animal RNAs with regulatory potency. Nature 2014, 495, 333–338. [Google Scholar] [CrossRef] [PubMed]
- Li, F.; Zhang, L.; Li, W.; Deng, J.; Zheng, J.; An, M.; Lu, J.; Zhou, Y. Circular RNA ITCH has inhibitory effect on ESCC by suppressing the Wnt/β-catenin pathway. Oncotarget 2015, 6, 6001–6013. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Wang, J.; Khanabdali, R.; Kalionis, B.; Tai, X.; Xia, S. Circular RNAs: Isolation, characterization and their potential role in diseases. RNA Biol. 2017, 14, 1715–1721. [Google Scholar] [CrossRef] [Green Version]
- Szabo, L.; Morey, R.; Palpant, N.J.; Wang, P.L.; Afari, N.; Jiang, C.; Parast, M.M.; Murry, C.E.; Laurent, L.C.; Salzman, J. Statistically based splicing detection reveals neural enrichment and tissue-specific induction of circular RNA during human fetal development. Genome Biol. 2015, 16, 1–26. [Google Scholar] [CrossRef] [Green Version]
- Tan, W.L.; Lim, B.T.; Anene-Nzelu, C.G.; Ackers-Johnson, M.; Dashi, A.; See, K.; Tiang, Z.; Lee, D.P.; Chua, W.W.; Luu, T.D.; et al. A landscape of circular RNA expression in the human heart. Cardiovasc. Res. 2017, 113, 298–309. [Google Scholar] [CrossRef]
- Xia, S.; Feng, J.; Lei, L.; Hu, J.; Xia, L.; Wang, J.; Xiang, Y.; Liu, L.; Zhong, S.; Han, L.; et al. Comprehensive characterization of tissue-specific circular RNAs in the human and mouse genomes. Brief Bioinform. 2017, 18, 984–992. [Google Scholar] [CrossRef] [PubMed]
- Lukiw, W.J. Circular RNA (circRNA) in Alzheimer’s disease AD. Front Genet. 2013, 4, 307. [Google Scholar] [CrossRef] [PubMed]
- Xie, H.; Ren, X.; Xin, S.; Lan, X.; Lu, G.; Lin, Y.; Yang, S.; Zeng, Z.; Liao, W.; Ding, Y.Q.; et al. Emerging roles of circRNA_001569 targeting mir-145 in the proliferation and invasion of colorectal cancer. Oncotarget 2016, 7, 26680–26691. [Google Scholar] [CrossRef] [PubMed]
- Meng, S.; Zhou, H.; Feng, Z.; Xu, Z.; Tang, Y.; Li, P.; Wu, M. CircRNA: Functions and properties of a novel potential biomarker for cancer. Mol. Cancer 2017, 16, 94. [Google Scholar] [CrossRef] [PubMed]
- Zhou, B.; Yu, J.W. A novel identified circular RNA, circRNA_010567, promotes myocardial fibrosis via suppressing miR-141 by targeting TGF-β1. Biochem. Biophysiol. Res. Commun. 2017, 487, 769–775. [Google Scholar] [CrossRef]
- Chen, G.W.; Shi, Y.T.; Zhang, Y.; Sun, J. CircRNA_100782 regulates pancreatic carcinoma proliferation through the il6-stat3 pathway. Oncotarg. Ther. 2017, 10, 5783–5794. [Google Scholar] [CrossRef] [PubMed]
- Pei, W.; Tao, L.; Zhang, L.W.; Zhang, S.; Cao, J.; Jiao, Y.; Tong, J.; Nie, J. Circular RNA profiles in mouse lung tissue induced by radon. Environ. Health Prev. 2017, 22, 36. [Google Scholar] [CrossRef]
- Tao, H.; Xiong, Q.; Zhang, F.; Zhang, N.; Liu, Y.; Suo, X.; Li, X.; Yang, Q.; Chen, M. Circular RNA profiling reveals chi_circ_0008219 function as microRNA sponges in pre-ovulatory ovarian follicles of goats (Capra hircus). Genomics 2017, 110, 257–266. [Google Scholar] [CrossRef]
- Sun, J.; Xie, M.; Huang, Z.; Li, H.; Chen, T.; Sun, R.; Wang, J.; Xi, Q.; Wu, T.; Zhang, Y. Integrated analysis of non-coding RNA and mRNA expression profiles of 2 pig breeds differing in muscle traits. J. Anim. Sci. 2017, 95, 1092–1103. [Google Scholar] [CrossRef]
- Wei, X.; Li, H.; Yang, J.; Hao, D.; Dong, D.; Huang, Y.; Lan, X.; Plath, M.; Lei, C.; Lin, F.; et al. Circular RNA profiling reveals an abundant circLMO7 that regulates myoblasts differentiation and survival by sponging miR-378a-3p. Cell Death Dis. 2017, 8, e3153. [Google Scholar] [CrossRef]
- FAO. Available online: http://www.fao.org/faostat/zh/#data/TP/visualize (accessed on 1 July 2019).
- Tao, L.; Li, J.; Zhang, Y.; Tang, S.; Huang, A. Study on the meat quality of buffalo in Dehong. Food Ind. 2014, 35, 61–65. Available online: http://www.cqvip.com/QK/93886X/201407/661588046.html (accessed on 1 July 2019).
- Newcom, D.W.; Baas, T.J.; Schwab, C.R.; Stalder, K.J. Genetic and phenotypic relationships between individual subcutaneous backfat layers and percentage of longissimus intramuscular fat in Duroc swine. J. Anim. Sci. 2005, 83, 316–323. [Google Scholar] [CrossRef] [PubMed]
- Jacyno, E.; Pietruszka, A.; Kawęcka, M.; Biel, W.; Kołodziej-Skalska, A. Phenotypic correlations of backfat thickness with meatiness traits, intramuscular fat, longissimus muscle cholesterol and fatty acid composition in pigs. S. Afr. J. Anim. Sci. 2015, 45, 122. [Google Scholar] [CrossRef]
- Zhang, C.; Yin, R.; Sheng, Y.; Yang, C.; He, X.; Xue, W.; Huang, K. Comprehensive analysis of the characteristics and differences in adult and newborn brown adipose tissue. Diabetes 2018, 67, 1759. [Google Scholar] [CrossRef]
- Long, T.; Guo, Z.; Han, L.; Yuan, X.; Liu, L.; Jing, W.; Tian, W.; Zheng, X.; Tang, W.; Long, J. Differential expression profiles of circular RNAs during osteogenic differentiation of mouse adipose-derived stromal cells. Calcif. Tissue Int. 2018, 103, 338–352. [Google Scholar] [CrossRef] [PubMed]
- Li, A.; Huang, W.; Zhang, X.; Xie, L.; Miao, X. Identification and characterization of circRNAs of two pig breeds as a new biomarker in metabolism-related diseases. Cell Physiol. Biochem. 2018, 47, 2458–2470. [Google Scholar] [CrossRef]
- Krueger, F. Trim Galore!: A Wrapper Tool around Cutadapt and FastQC to Consistently Apply Quality and Adapter Trimming to FastQ Files. Available online: http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/ (accessed on 1 July 2019).
- Dobin, A.; Davis, C.A.; Schlesinger, F.; Drenkow, J.; Zaleski, C.; Jha, S.; Batut, P.; Chaisson, M.; Gingeras, T.R. STAR: Ultrafast universal RNA-seq aligner. Bioinformatics 2013, 29, 15–21. [Google Scholar] [CrossRef] [PubMed]
- Zhang, X.O.; Dong, R.; Zhang, Y.; Zhang, J.L.; Luo, Z.; Zhang, J.; Chen, L.L.; Yang, L. Diverse alternative back-splicing and alternative splicing landscape of circular RNAs. Genome Res. 2016, 26, 1277–1287. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Love, M.; Simon, A.; Huber, W. Differential analysis of count data-the DESeq2 package. Genome Biol 2014, 15, 550. [Google Scholar] [CrossRef]
- DAVID. Available online: http://david.abcc.ncifcrf.gov/ (accessed on 1 July 2019).
- De Sá, P.M.; Richard, A.J.; Hang, H.; Stephens, J.M. Transcriptional regulation of adipogenesis. Comp. Physiol. 2017, 7, 635–674. [Google Scholar] [CrossRef]
- Schering, L.; Albrecht, E.; Komolka, K.; Kühn, C.; Maak, S. Increased expression of thyroid hormone responsive protein (THRSP) is the result but not the cause of higher intramuscular fat content in cattle. Int. J. Biol. Sci. 2017, 13, 532. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Sun, X.; Cai, H.; Sun, Y.; Plath, M.; Li, C.; Lan, X.; Lei, C.; Lin, F.; Bai, Y.; et al. Long non-coding RNA ADNCR suppresses adipogenic differentiation by targeting miR-204. BBA Gene Regul. Mech. 2016, 1859, 871–882. [Google Scholar] [CrossRef] [PubMed]
- Chaabane, M.; Rouchka, E.C.; Park, J.W. Circular RNA Detection from High-throughput Sequencing. In Proceedings of the International Conference ACM, Krakow, Poland, 20–23 September 2017; pp. 19–24. [Google Scholar]
- Qu, S.; Yang, X.; Li, X.; Wang, J.; Gao, Y.; Shang, R.; Sun, W.; Dou, K.; Li, H. Circular RNA: A new star of noncoding RNAs. Cancer Lett. 2015, 365, 141–148. [Google Scholar] [CrossRef] [PubMed]
- Legnini, I.; Di Timoteo, G.; Rossi, F.; Morlando, M.; Briganti, F.; Sthandier, O.; Fatica, A.; Santini, T.; Andronache, A.; Wade, M.; et al. Circ-ZNF609 is a circular RNA that can be translated and functions in myogenesis. Mol. Cell 2017, 66, 22–37. [Google Scholar] [CrossRef] [PubMed]
- Huang, D.W.; Sherman, B.T.; Lempicki, R.A. Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nat. Protoc. 2009, 4, 44–57. [Google Scholar] [CrossRef]
- Zhang, Y.; Zhang, X.O.; Chen, T.; Xiang, J.F.; Yin, Q.F.; Xing, Y.H.; Zhu, S.; Yang, L.; Chen, L.L. Circular intronic long noncoding RNAs. Mol. Cell 2013, 51, 792–806. [Google Scholar] [CrossRef]
- Wright, M.H.; Heal, W.P.; Mann, D.J.; Tate, E.W. Protein myristoylation in health and disease. J. Chem. Biol. 2010, 3, 19–35. [Google Scholar] [CrossRef]
- Lennerz, J.K.; Hurov, J.B.; White, L.S.; Lewandowski, K.T.; Prior, J.L.; Planer, G.J.; Gereau, R.W.; Piwnica-Worms, D.; Schmidt, R.E.; Piwnica-Worms, H. Loss of Par-1a/MARK3/C-TAK1 kinase leads to reduced adiposity, resistance to hepatic steatosis, and defective gluconeogenesis. Mol. Cell. Biol. 2010, 30, 5043–5056. [Google Scholar] [CrossRef]
- Seale, P.; Kajimura, S.; Yang, W.; Chin, S.; Rohas, L.M.; Uldry, M.; Tavernier, G.; Langin, D.; Spiegelman, B.M. Transcriptional control of brown fat determination by PRDM16. Cell Metab. 2007, 6, 38–54. [Google Scholar] [CrossRef]
- Kajimura, S.; Seale, P.; Tomaru, T.; Erdjument-Bromage, H.; Cooper, M.P.; Ruas, J.L.; Chin, S.; Tempst, P.; Lazar, M.A.; Spiegelman, B.M. Regulation of the brown and white fat gene programs through a PRDM16/CtBP transcriptional complex. Genes Dev. 2008, 22, 1397–1409. [Google Scholar] [CrossRef]
- Asano, H.; Yamada, T.; Hashimoto, O.; Umemoto, T.; Sato, R.; Ohwatari, S.; Kanamori, Y.; Terachi, T.; Funaba, M.; Matsui, T. Diet-induced changes in Ucp1 expression in bovine adipose tissues. Gen. Comp. Endocrinol. 2013, 184, 87–92. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Komolka, K.; Albrecht, E.; Gotoh, T.; Maak, S. Abundance of beige and brown adipocyte markers in different adipose depots of cattle at 26 months of age. Adv. Anim. Biosci. 2017, 8, 38–41. [Google Scholar] [CrossRef]
CircRNA 1/mRNA | Forward primer (5′–3′) | Reverse primer (5′–3′) | Product Length (bp) |
---|---|---|---|
X:79761001|79786582 | GCTAAGAACAGAAACACAAAATGCT | CCTCATCTCCAGGGTTTTCTTCA | 225 |
16:34132574|34371163 | TCGAACACTCTCTTCAGATGCAA | TGGGGTTTGGATTCTCTGCT | 213 |
22:36903411|36917263 | CAGACGGCTCTGGTGCAATA | GTCATCAGCCAGGCTACTCC | 180 |
25:10461217|10480061 | AAGGAGTGGGACCTAAAGCC | GGCATTGAAGCGGAAGAAGTC | 183 |
10:44952496|44976492 | AACACAGACCTACCGCATCC | GAAAGAGGGCGTAGGTGTCA | 234 |
1:106999005|107007859 | CCAGATGTGTGGAGATTGCC | TCCTGGTGGCTGGAAATACC | 227 |
21:69696877|69753491 | ATGCAAGTGGAGGTGAAGTGT | TAACTTCTTGCCGCCCATCT | 117 |
19:45387150|45389986 | TGGAAGAGGCTAGCAAACGA | GGGCTGAATCTGTCTCGCTG | 152 |
PRDM16 | TACAGGGTGGAGAAGCGGAA | GTACCTGCACGTGTATCGCT | 264 |
GAPDH | CACTCACTCTTCTACCTT | GCCAAATTCATTGTCGTA | 91 |
Number | circRNA_ID 1 | Symbol | r Value | Number | circRNA_ID 1 | Symbol | r-Value |
---|---|---|---|---|---|---|---|
1 | 10:11563837|11593862 | SREBF2 | −0.9975 | 20 | 12:52715274|52733582 | PRDM16 | 0.9834 |
2 | 15:83640019|83640860 | THRSP | −0.9960 | 21 | 15:22884720|22887938 | SREBF2 | 0.9841 |
3 | 12:89500403|89506932 | PPARG | −0.9899 | 22 | 12:89492189|89525269 | PRDM16 | 0.9841 |
4 | 2:37078234|37133108 | THRSP | −0.9889 | 23 | 22:30718181|30723897 | PRDM16 | 0.9843 |
5 | 12:23235488|23237718 | THRSP | −0.9889 | 24 | 21:69696877|69753491 | PRDM16 | 0.9852 |
6 | 12:2298522|2305539 | PPARG | −0.9859 | 25 | 4:9762677|9766001 | PRDM16 | 0.9854 |
7 | 2:37078234|37133108 | CDK5 | −0.9855 | 26 | 21:42001223|42024196 | PRDM16 | 0.9855 |
8 | 12:23235488|23237718 | CDK5 | −0.9855 | 27 | 10:60619225|60625573 | SFRP4 | 0.9861 |
9 | 15:83640019|83640860 | CDK5 | −0.9827 | 28 | 11:22513792|22530506 | PRDM16 | 0.9865 |
10 | 9:84303407|84311225 | THRSP | −0.9807 | 29 | 16:30873113|30903109 | PRDM16 | 0.9867 |
11 | X:79782632|79786582 | PRDM16 | 0.9805 | 30 | 7:18298331|18317388 | SFRP4 | 0.9903 |
12 | 17:40606888|40608971 | PRDM16 | 0.9805 | 31 | 14:22698555|22703735 | SFRP4 | 0.9906 |
13 | 14:28794206|28825387 | PRDM16 | 0.9810 | 32 | 14:45838481|45839369 | SFRP4 | 0.9928 |
14 | 11:100361051|100374772 | PRDM16 | 0.9814 | 33 | 10:70853226|70859881 | PRDM16 | 0.9933 |
15 | X:79761001|79786582 | PRDM16 | 0.9818 | 34 | 2:72283596|72308351 | THRSP | 0.9944 |
16 | 17:55314422|55316845 | SFRP4 | 0.9828 | 35 | 2:37061458|37078299 | PRDM16 | 0.9944 |
17 | 20:58640529|58642071 | SFRP4 | 0.9828 | 36 | 5:10860435|10879727 | THRSP | 0.9948 |
18 | 9:15487323|15505719 | PRDM16 | 0.9833 | 37 | 2:72283596|72308351 | CDK5 | 0.9955 |
19 | 8:91848002|91864189 | PRDM16 | 0.9834 |
CircRNA 1 | CircRNA Type | Host Gene | mRNA | r-Value by RNA-Seq | r-Value by qRT-PCR | |
---|---|---|---|---|---|---|
Young and Adult (n = 6) | Young and Adult (n = 6) | Variable Months of Age (n = 49) | ||||
19:45387150|45389986 | Exon | NMT1 | PRDM16 | 0.968 | 0.963 | 0.889 |
21:69696877|69753491 | Exon | MARK3 | PRDM16 | 0.985 | 0.893 | 0.893 |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Huang, J.; Zhao, J.; Zheng, Q.; Wang, S.; Wei, X.; Li, F.; Shang, J.; Lei, C.; Ma, Y. Characterization of Circular RNAs in Chinese Buffalo (Bubalus bubalis) Adipose Tissue: A Focus on Circular RNAs Involved in Fat Deposition. Animals 2019, 9, 403. https://doi.org/10.3390/ani9070403
Huang J, Zhao J, Zheng Q, Wang S, Wei X, Li F, Shang J, Lei C, Ma Y. Characterization of Circular RNAs in Chinese Buffalo (Bubalus bubalis) Adipose Tissue: A Focus on Circular RNAs Involved in Fat Deposition. Animals. 2019; 9(7):403. https://doi.org/10.3390/ani9070403
Chicago/Turabian StyleHuang, Jieping, Jinhui Zhao, Qiuzhi Zheng, Shuzhe Wang, Xuefeng Wei, Fen Li, Jianghua Shang, Chuzhao Lei, and Yun Ma. 2019. "Characterization of Circular RNAs in Chinese Buffalo (Bubalus bubalis) Adipose Tissue: A Focus on Circular RNAs Involved in Fat Deposition" Animals 9, no. 7: 403. https://doi.org/10.3390/ani9070403