Next Article in Journal
Effect of Silicon on Oat Salinity Tolerance: Analysis of the Epigenetic and Physiological Response of Plants
Next Article in Special Issue
Case Report of Avena sterilis subsp. sterilis ACCase Herbicide Resistance in Southern Spain
Previous Article in Journal
Impact of Climate Change on Cassava Yield in Nigeria: An Autoregressive Distributed Lag Bound Approach
Previous Article in Special Issue
Autumn Application of Synthetic Auxin Herbicide for Weed Control in Cereals in Poland and Germany
 
 
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Occurrence and Mechanism of Papaver rhoeas ALS Inhibitors Resistance in Poland

by
Marta Stankiewicz-Kosyl
1,*,
Małgorzata Haliniarz
2,*,
Mariola Wrochna
1,
Aleksandra Obrępalska-Stęplowska
3,
Piotr Kuc
4,
Justyna Łukasz
2,
Marzena Wińska-Krysiak
1,
Barbara Wrzesińska-Krupa
3,
Joanna Puła
5,
Cezary Podsiadło
6,
Krzysztof Domaradzki
7,
Mariusz Piekarczyk
8,
Marcin Bednarczyk
9 and
Katarzyna Marcinkowska
10
1
Department of Plant Protection, Institute of Horticultural Sciences, Warsaw University of Life Sciences—SGGW, Nowoursynowska 159, 02-776 Warsaw, Poland
2
Department of Herbology and Plant Cultivation Techniques, University of Life Sciences in Lublin, Akademicka 13, 20-950 Lublin, Poland
3
Department of Molecular Biology and Biotechnology, Institute of Plant Protection—National Research Institute, Władysława Węgorka 20, 60-318 Poznań, Poland
4
Institute of Agroecology and Plant Production, Wrocław University of Environmental and Life Sciences, pl. Grunwaldzki 24A, 50-363 Wrocław, Poland
5
Department of Agroecology and Crop Production, University of Agriculture, Al. Mickiewicza 21, 31-120 Kraków, Poland
6
Department of Agroengineering, Faculty of Environmental Management and Agriculture, West Pomeranian University of Technology in Szczecin, Papieża Pawła VI 3, 71-459 Szczecin, Poland
7
Department of Weed Science and Soil Tillage Systems, Institute of Soil Sciences and Plant Cultivation—State Research Institute, Orzechowa 61, 50-540 Wrocław, Poland
8
Department of Agronomy, Faculty of Agriculture and Biotechnology, Bydgoszcz University of Science and Technology, Prof. S. Kaliskiego 7, 85-796 Bydgoszcz, Poland
9
Syngenta Polska Sp. z o.o., Szamocka 8, 01-748 Warsaw, Poland
10
Department of Weed Science and Plant Protection Techniques, Institute of Plant Protection—National Research Institute, Władysława Węgorka 20, 60-318 Poznań, Poland
*
Authors to whom correspondence should be addressed.
Agriculture 2023, 13(1), 82; https://doi.org/10.3390/agriculture13010082
Submission received: 16 November 2022 / Revised: 9 December 2022 / Accepted: 26 December 2022 / Published: 28 December 2022
(This article belongs to the Special Issue Management of Weeds and Herbicide Resistance)

Abstract

Herbicide resistance in weeds, including corn poppy (Papaver rhoeas L.), is an increasing problem compromising global crop production. The aims of this study were to evaluate the susceptibility of P. rhoeas populations in Poland to acetolactate synthase (ALS) inhibitors and elucidate their mechanisms of resistance. Between 2017 and 2020, 157 seed samples were collected nationwide and a dose-response study with various ALS-inhibiting herbicides was performed in glasshouses. This revealed 14 resistant populations with R/S ranges of 2.3–1450.2, 9.5–398.5 and 2–2.5 for tribenuron, iodosulfuron and florasulam, respectively. Eight of them were cross-resistant to both tribenuron and iodosulfuron, three and one populations were singly resistant to tribenuron and iodosulfuron, respectively, and one population had reduced susceptibility to florasulam only. In one population, cross-resistance to tribenuron, iodosulfuron and florasulam was identified. The ED50 of many populations susceptible to ALS inhibitors was close to half the recommended dose of the herbicides tested. In seven out of eight resistant P. rhoeas populations analysed, target-site resistance was identified. Six amino acid replacements were found (Ala197, Arg197, His197, Leu197, Ser197 and Thr197). In one population resistant to ALS inhibitors, no mutations in the ALS gene were detected. An efficient anti-resistance strategy is needed to reduce the development of herbicide resistance in P. rhoeas in Poland.

1. Introduction

The problem of weed resistance to herbicides is becoming increasingly common. Worldwide, resistant biotypes have been identified in over 266 weed species in 71 countries [1]. In winter crops in Europe, this problem mainly concerns species such as silky bentgrass, blackgrass and corn poppy. This phenomenon is based on their ability to survive and keep growing despite the application of a dose of herbicide that is considered lethal [2], and is mainly caused by simplified crop rotations and excessive use of the same active substances or herbicides with the same mechanism of action. As a result of selection pressure, the number of resistant individuals is growing, which in turn leads to higher crop production costs [1,3,4,5].
Corn poppy (Papaver rhoeas L.) is one of the most common winter crop weeds in Europe [6,7]. P. rhoeas dominates in winter wheat where it causes the greatest yield losses. In some countries, it is also a serious weed in winter barley, rye and winter oilseed rape [8,9,10,11]. It is a species that has adapted very well to commonly used, simplified agricultural systems, including direct sowing [7,12,13]. Seeds remain viable for a long time. According to Cirujeda et al. [14,15], 53% of seeds germinated after remaining at a depth of 20 cm for more than six years. P. rhoeas is a very fertile species, and if there is a lack of competition it can produce up to 800 thousand seeds per plant [16], while in the crop canopy one plant can produce 10,000–20,000 seeds. The ability of P. rhoeas to spread and persist in farmland can be attributed to the formation of a seed bank that is viable for many years, an extended germination period, and high seed production [16]. In countries with a temperate climate, both spring and autumn-emerging plants are able to produce seeds, increasing the harmfulness of this weed species [6], but plants emerging in autumn produce more seeds and are more vigorous and competitive [9].
For over 60 years, the synthetic auxin herbicide 2,4-D has been the most frequently used active ingredient to control P. rhoeas. Acetolactate synthase (ALS) inhibitors are another group commonly used in the control of this species. The first reports concerning resistance to these compounds appeared in Spain in the early 1990s, before being confirmed in Greece, Italy, France and the UK [17,18,19]. So far, P. rhoeas biotypes resistant to synthetic auxin herbicides, ALS inhibitors, or both, have been identified in ten European countries [1]. Resistance to these herbicides can be due to target-site resistance (TSR) or non-target-site resistance (NTSR) mechanisms. The TSR mechanism largely involves mutation(s) in a herbicide’s target site of action, resulting in the protein’s complete or partial insensitivity to the active ingredient, while the NTSR mechanisms usually result from enhanced metabolism of the herbicide [20,21]. In the case of 2,4 D resistance in P. rhoeas, the NTSR mechanism is proposed [18,22,23]. In one of populations of this species two independent NTSR mechanisms are reduced transport and enhanced metabolism [24]. The situation is more complex in P. rhoeas biotypes resistant to ALS inhibitors. In such populations, TSR only [19,25,26,27], NTSR only [28] or both mechanisms of resistance, can be observed and, in some cases, even in the same plant [29,30]. In populations from Greece, France, Italy, Spain and the UK, an ALS gene mutation in codon Pro197 (resulting in substitutions Leu, His, Arg, Ser, Thr) and Trp574 (substitution by Leu) has been observed to confer resistance to tribenuron, but no or moderate resistance to florasulam [25,26,27,29]. Determining whether the TSR or the NTSR mechanism is involved is essential for the correct selection of weed control method. In recent years in Europe, five active substances (cyanazine, simazine, prometryne, oxadiargyl, isoproturon) used in the control of P. rhoeas have been withdrawn; currently, only herbicides from groups 2 (ALS inhibitors), 5 (photosystem II inhibitors) and 4 (synthetic auxins) [2] are frequently used, with weeds developing resistance to the first two groups relatively easily [31]. The use of herbicide mixtures is an easy element of the anti-resistance strategy to implement [32,33]. Nevertheless, herbicide rotation or mixing might not be effective if applied at insufficient time intervals [4]. Moreover, it is recommended that residual herbicides are used more often, along with integrated weed management (IWM). More effective weed control can also be achieved by improving the formulation or breeding of more competitive crop varieties [34,35].
The objective of this study was to evaluate the susceptibility of P. rhoeas populations in Poland to ALS inhibitors, and to identify mutations in the ALS gene of analysed populations with the aim of elucidating their mechanism of resistance.

2. Materials and Methods

2.1. Collection of P. rhoeas Seeds

P. rhoeas seeds for the study, potentially resistant to herbicides, were collected between 2017 and 2020 from 157 farms in regions in Poland where there is frequent infestation by this species. Seeds were collected on farms where farmers had reported difficulty controlling P. rhoeas. Where the weed was distributed uniformly across the whole field, a 100 × 50 m plot was designated. Ripe P. rhoeas poppies were harvested from a few spots and combined into one sample in a paper bag [36,37]. At least 100 fully developed infructescences were harvested in one field. On each occasion, the geographic coordinates of the collection place were noted. The collected samples were stored in a ventilated, dry room until they were air-dried. The samples were then cleaned and stored in paper bags until use. In order to break dormancy, the seeds were kept in a cool room at 4 °C for 7 days [37].

2.2. Biological Tests in Glasshouses

Biological tests were carried out in the period 2018–2020 in ventilated glasshouses with a 14/10 h photoperiod during early spring and autumn, and in natural sunlight from June to July. The temperature in the glasshouses ranged from 16 to 25 °C. Multipots, with individual pots 5.5 cm in diameter, were filled with a mixture of commercial vegetable substrate Kronen® (Lasland sp. z o.o. Grądy, Poland) mixed with sand at a proportion of 2:1. A few P. rhoeas seeds were sown in a single pot, and after emergence the number of plants was regulated to three per pot. The experimental layout was a completely randomised design with three replicates per dose. The resistance/susceptibility of P. rhoeas was tested against three post-emergent herbicides (Table 1).
Distilled water solutions of the herbicides (100 mL) were prepared using the dilution method, where the highest dose of herbicide (32 times the field dose) was a stock solution. The herbicides were applied using two precision bench sprayers (FHU KAMA, Skarżysko-Kamienna, Poland and APORO Sp. z o.o., Poznań, Poland), each with a boom equipped with one flat-fan hydraulic Teejet XR 11002 VP nozzle, and calibrated to the same parameters, i.e., delivering 200 L ha−1 of spray at a pressure of 200 bars.

2.2.1. Discriminate Dose Experiments

To verify whether the collected P. rhoeas populations were herbicide-resistant, plants in the 2-leaf stage, BBCH 12 [37], were sprayed with a field dose (1N) of each herbicide (Table 1) and with distilled water (control treatment).
The reduction in visually estimated biomass (VEB) on a scale of 0–100% was assessed three weeks after spraying [37]. Plants were assessed as susceptible at VEB = 51–100%. Plants at VEB ≤ 50% were classified as potentially resistant and qualified for whole-plant dose-response bioassays.

2.2.2. Whole-Plant Dose-Response Bioassays

At the 2-leaf growth stage BBCH 12 [37], potentially resistant P. rhoeas plants were sprayed with seven doses of the herbicide: 1/2N, 1N, 2N, 4N, 8N, 16N or 32N (with N referring to the field dose). On each occasion, a susceptible population representative of the Polish region was taken for comparison and also sprayed with the following herbicide doses: 1/16N, 1/8N, 1/4N, 1/2N, 1N, 2N and 4N. Control plants were sprayed with distilled water only (0N).
Three weeks after herbicide application, the aboveground plant biomass was cut and immediately weighed (fresh biomass) using a laboratory balance (Radwag, Radom, Poland) with an accuracy of three decimal places.
The aim of the whole-plant dose-response bioassay was to establish the ED50 dose, i.e., the dose causing a 50% reduction in the biomass of a herbicide-treated plant. ED50 was calculated using the ‘drc’ package [38] in R ver. 4.0.1 [39]. The resistance index (RI) classification was based on the modified scale of Beckie and Tardif [40] for ALS inhibitors. The RI [41], defined as the ratio of ED50 values of the R and S populations, was S—susceptibility (<2); r—reduced susceptibility (2–2.9); R—low resistance (3–4.9); RR—moderate resistance (5.0–9.9); RRR—high resistance (10.0–68.1); RRRR—very high resistance (>68.2). ED50 for the susceptible biotype (9547) was 7.04 g ha−1 for tribenuron, 2.34 g ha−1 for florasulam and 4.67 for iodosulfuron. Dose-response curves were plotted using a logarithmic scale for herbicide dose (X-axis).

2.3. Molecular Analysis of the ALS Gene

Molecular analysis was undertaken to check the presence of the TSR mechanism of resistance to ALS inhibitors in the populations of P. rhoeas analysed. The second aim was to assess the variability of ALS gene sequences in the populations studied. In total, eight populations resistant to ALS inhibitors, and seven susceptible to them, were analysed. DNA was extracted from three plants originating from the RI test with tribenuron-methyl. For analysis of populations classified as susceptible, leaves were taken from plants not treated with herbicide (0N). For analysis of populations classified as being resistant to tribenuron-methyl, leaves were taken from survivors of dose 4N. If fewer than three plants survived dose 4N, plants from 2N or 1N were also taken (which was the case for population 8727). Three populations resistant to ALS inhibitors (10,303, 8727, 8961) and one susceptible population (9329) were studied in more detail. Population 10,303 with a mutation in codon 197 of the ALS gene was analysed after treatment with tribenuron-methyl and iodosulfuron (additional 12 survivors). In population 8727, only one individual (out of three) with a mutation in the ALS gene was identified; therefore, an additional five survivors after tribenuron-methyl and iodosulfuron were analysed. In population 8961, different genotypes in codon 197 of the ALS gene were identified; therefore, a further three survivors were studied.
DNA was extracted using the CTAB (cetyltrimethylammonium bromide) method [42]. The concentration of each DNA sample was measured, diluted to a final concentration of 100 ng µL−1, and used immediately for the polymerase chain reaction (PCR) test or stored at −20 °C until use. Primer sequences for amplification of domains A and B of the ALS gene were as described by Marshall et al. [27]. Primers used for the amplification of the intradomain area were designed in the present study based on the P. rhoeas GeneBank sequence (AJ577316) using Primer3web ver. 4.1.0 (Whitehead Institute for Biomedical Research, Cambridge, MA, USA) software accessed online. The sequences were as follows: M376F 5′-agtgaagaattgagacggtt-3′ and M376R 5′-cccttctgttaattcgtcca-3′.
Amplifications were done in 30 µL with 100 ng of genomic DNA template, 0.5 µM of each primer, 0.2 mM of each dNTP, 1× Phusion HF Buffer and 0.02 u µL−1 of Phusion HF DNA Polymerase (Thermo Fisher Scientific, Waltham, MA, USA). Cycling conditions for primers designed by Marshall et al. [27] (2010) were modified, and a two-step protocol was applied as follows: 98 °C 30 s followed by 35 cycles of 98 °C 10 s, 72 °C 30 s and a final extension of 10 min at 72 °C. Cycling conditions for the amplifications of the intradomain area were: 98 °C 30 s followed by 35 cycles of 98 °C 10 s, 58 °C 30 s, 72 °C 30 s and a final extension of 10 min at 72 °C. Cycling reactions were performed using SimplyAmp™ Thermal Cycler (Thermo Fisher Scientific, Waltham, USA).
Genomed S.A. (Warsaw, Poland) was commissioned to undertake purification of the PCR product and sequencing. Chromatograms were analysed using FinchTV software (Geospiza, Washington, DC, USA). The obtained sequences were compared using ClustalW software (GenomeNet, Kyoto, Japan) accessed online. The amino acid numbering refers to the Arabidopsis thaliana ALS sequence (GenBank: X51514).

3. Results

3.1. Reaction of P. rhoeas Populations to ALS Inhibitors

The reaction of P. rhoeas populations in the whole-plant dose-response bioassays to ALS inhibitors varied (Table 2). A total of 14 out of 157 populations showed resistance, or at least reduced susceptibility, to the active ingredients tested. Populations were most often (12 out of 14) resistant to tribenuron-methyl. The R/S ratio ranged from 2.3 (10,374) to 1450.2 (10,186). As many as eight out of 12 populations demonstrated a high (RRR) and very high (RRRR) level of resistance to this active ingredient. These populations originated from the provinces of Warmia-Mazuria, Lower Silesia, West Pomerania and Lublin (Figure 1). A total of 10 out of 14 populations were found to be resistant to iodosulfuron-methyl, with ED50 values ranging from 9.5 to 398.5. Two of these populations (10,410, 10,612) showed reduced susceptibility to this active ingredient (R/S < 2.9) and four of them were found to be resistant to iodosulfuron at a high or very high level (R/S > 10.1). During the whole-plant dose-response bioassays to florasulam, only two populations (8833, 10,416) with reduced susceptibility to this active ingredient were found, with ED50 values of 4.7 and 6.0, respectively. These populations were found in the provinces of Świętokrzyskie and Lublin (Figure 1). Population 10,416 from the province of Lublin was diagnosed as being cross-resistant to tribenuron-methyl, iodosulfuron-methyl and florasulam. Its level of resistance was different for each of the active ingredients tested: high for tribenuron-methyl, moderate for iodosulfuron-methyl and reduced susceptibility to florasulam. Eight populations were found to be resistant to tribenuron-methyl and iodosulfuron-methyl, with a high or very high level of resistance to both active ingredients in four of these populations. Three populations were resistant to tribenuron-methyl only, while one population was diagnosed as resistant to iodosulfuron-methyl only, and one to florasulam only.
The field dose of tribenuron-methyl reduced the fresh biomass of resistant populations to a lesser extent than that of the susceptible populations. The reduction ranged from 40.7% in cases of very high resistance (RRRR) to 67.7% in cases of low resistance (R) compared with the susceptible population (Figure 2). The highest tested dose of tribenuron-methyl (32N) caused a reduction of just 33.5% in the population with a very high level of resistance (10,186). Populations diagnosed as R and RR reacted similarly to the tribenuron-methyl dose at the level of double field dose or higher.
Iodosulfuron-resistant populations responded to the recommended dose with a smaller reduction in fresh weight of 70% or more compared with the susceptible population (Figure 3). Populations with a high or very high level of iodosulfuron-methyl resistance responded similarly to the application of this active ingredient. The highest tested dose of iodosulfuron-methyl (32N) caused fresh weight reductions of 63.8% and 45.9%, respectively.
The ED50 values of P. rhoeas populations susceptible to tribenuron-methyl ranged from 0.01 to 8.07 (Figure 4a). It should be noted that there was a large group of populations with an ED50 close to or above 0.5 N (7.5 g ha−1). The ED50 values of two tribenuron-methyl susceptible populations (9486 and 10,607) were more than half of the recommended field dose of this active ingredient. ED50 values of 11 populations were slightly below the level of 0.5 N and ranged from 6.59 to 7.4. The ED50 values of P. rhoeas populations susceptible to iodosulfuron-methyl ranged from 0.01 to 7.13 (Figure 4b). The ED50 values of two iodosulfuron-methyl susceptible populations were more than half the recommended field dose of this active ingredient (5 g ha−1), while the value for population 10,407 was as high as 7.13. The ED50 values of 18 populations were slightly lower than 0.5N and ranged from 4.51 to 4.86. The ED50 values of populations susceptible to florasulam ranged from 0.01 to 3.70 (Figure 4c). Three populations were characterised by ED50 values above 0.5 N (2.56–3.70). The ED50 values of 13 populations were slightly less than half the recommended dose of florasulam (2.5 g ha−1) and ranged from 2.22 to 2.41.

3.2. Molecular Analysis of the ALS Gene

DNA was isolated from 69 individuals belonging to 15 populations: eight resistant to ALS inhibitors, and seven susceptible to them (Table 3). Populations were qualified as resistant or susceptible according to the RI test. No substitution at codon Pro197 was found in plants from susceptible populations. However, six amino-acid replacements were identified at this position (Ala, Arg, His, Leu, Ser, Thr) in populations resistant to ALS inhibitors. In populations 8961, 9068, 9069, 10,303, 10,410 and 10,612, all analysed individuals had a substitution in codon Pro197. In the majority of populations with a mutation in codon 197, more heterozygous mutants were identified than homozygous mutants. Population 9069 was the only exception, with all three survivors analysed being homozygous mutants. Population 8961 was the most diversified in codon Pro197, where three different substitutions (Ala197, His197, Ser197) were found. In the remaining resistant populations, all plants within the population had the same type of substitution. In resistant population 8727, the substitution Leu197 was identified in one plant only, and in population 8491 no substitutions were present in codon Pro197. In the majority of individuals without mutations in codon 197 (20 out of 34), the sequence of the ALS gene was identical to the wild type of the gene in P. rhoeas (GenBank: AJ577316) (Table 3).
In three populations resistant to ALS inhibitors, more than three individuals were analysed: 15, 8 and 6 individuals from populations 10303, 8727 and 8961, respectively. Despite analysing 15 individuals from population 10303, only one type of substitution was found: nine heterozygotes (CST) and six homozygotes (CGT) resulting in the substitution Arg197. Population 8961 was diversified in codon 197. Three individuals had one substitution—KCT and SCT in one and two individuals, respectively—however in three plants a double substitution was identified (SMT), resulting in the replacement Ala/His197. In population 8727, in one plant out of eight, the substitution Leu197 was identified. This was a heterozygous mutant. The remaining survivors in this population had no mutation in codon 197 (Table 3).
Of all the individuals analysed, other than in Pro197, no non-synonymous substitutions in other codons of the ALS gene were identified as being responsible for ALS inhibitor resistance in P. rhoeas or other weed species (Ala122, Ala205, Asp376, Arg377, Trp574, Ser653, Gly654). In 43 out of 69 individuals, at least one substitution was identified apart from codon 197; however, these substitutions were present in populations resistant and susceptible to ALS inhibitors. The mutations concerned codons Ile136, Glu144, Ile211, Ile411, Gly417, Gly438, Met445 and Leu453. Replacement Met445Lys was the most frequent—identified in 10 out of 69 individuals (five individuals with a mutation in codon 197 and five individuals without a change in this codon). Non-synonymous mutations were identified in five codons: Glu144Lys, Ile411Val, Gly417Met, Gly438Ala and Met445Lys. These substitutions were present in individuals from populations resistant to ALS inhibitors, but also in at least one individual from a population rated as susceptible on the basis of the biological test.
In two individuals from population 8491 rated as resistant to tribenuron methyl, non-synonymous substitutions were identified. In this population, no mutation in codon 197 was found. However, these substitutions (Ile411Val, Gly417Met, Gly438Ala and Met445Lys) were not responsible for resistance to ALS inhibitors because they were also identified in susceptible populations.

4. Discussion

P. rhoeas is widespread throughout Europe and mainly infests winter cereals [11]. In Poland, a rising number of cases have also been noted in winter rape [43]. The genetic diversity of P. rhoeas indicates its high adaptation potential to changing environmental conditions and its ability to colonise new habitats [44,45]. Studies from Poland during the second half of the last century indicate that this species is most abundant in fertile soils that are rich in humus and calcium carbonate [46,47,48,49]. However, studies conducted in recent years indicate that P. rhoeas is increasingly colonising soils that are rich in nutrients, but that are also slightly acidic or neutral [43]. In regions where resistant P. rhoeas populations were identified in this study, the soils are rich in calcium carbonate, and this species has been infesting crops there for a long time [46,50,51,52]. For several years, farmers have had problems with effective control of this species.
Since the end of the last century Europe has been struggling with the problem of P. rhoeas resistance to chemical control. This problem is particularly serious in cereal crops in the Mediterranean region [11]. In Poland, this species’ resistance to ALS inhibitors was first reported by Adamczewski et al. [53] in a study concerning P. rhoeas resistant to tribenuron-methyl. The research described in the present paper shows that the issue of resistance of P. rhoeas to herbicides is worsening in Poland. Out of 157 seed samples tested, resistance was found in 14 cases, and was often cross-resistance to different chemistries of ALS inhibitors. This phenomenon is in line with the general trend of the decreasing effectiveness of post-emergence herbicide treatments in the control of common cereal weeds. Describing the development of resistance of Alopecurus myosuroides and Apera spica-venti in Germany over a period of 15 years, Petersen and Raffel [54] also found a significant rise in the percentage of resistant populations, including multiple-resistant populations. The problem worsened after 2017, which the authors attribute to the selective pressure of ALS inhibitors. Among the P. rhoeas samples analysed in the present study, a significant percentage of populations required about half of the field herbicide dose for effective elimination. These populations can be described as being “in the waiting room” for acquisition of resistance to ALS inhibitors, and the fact that they have been selected for research indicates that farmers have already identified issues with the control of this species in their fields.
In seven out of eight resistant P. rhoeas populations analysed, TSR due to mutations was identified. This was due to mutations in codon 197 of the ALS gene. Six amino acid replacements were found (Ala197, Arg197, His197, Leu197, Ser197 and Thr197). This is the first molecular analysis of Polish P. rhoeas populations resistant to ALS inhibitors. These genotyping results are consistent with earlier studies of other European populations, with the same mutations identified in codon 197 of the ALS gene [1]. Délye et al. [29] and Kati et al. [19] also describe mutations in codon 574 of the ALS gene in P. rhoeas. In the present study, no replacement was found in this codon. As the research conducted in Europe shows, the mutation in codon 574 is much rarer. This mutation has previously been observed in a single plant from one population in Italy [29] and in two populations in Greece [19], while in Spain, after sequencing more than 1000 plants, it was never found [13,30]. In the present study, no mutation was found in the other codons known to be responsible for ALS inhibitor resistance: 122, 205, 376, 377, 653 and 654 [1]. Similarly, these six codon replacements were not found either by other teams studying the molecular basis of P. rhoeas resistance to ALS inhibitors.
Only one of seven populations with TSR analysed at the molecular level in this study showed high diversity in codon 197 of the ALS gene. In population 8961, four out of six individuals were found to be trans-heterozygotes (i.e., they contained two different types of mutant ALS alleles). Similar variability has been observed for some Greek, Italian and Spanish P. rhoeas populations resistant to ALS inhibitors [26,29,30].
The presence of the mutated codon 197 in all analysed survivors within the population provided high resistance to tribenuron-methyl. The Pro197 amino-acid residue is directly involved in anchoring the aromatic ring of sulfonylureas. Any substitution in this position will affect sulfonylureas binding, resulting in a high level of resistance to this active ingredient [55]. In contrast, the presence of the mutated ALS allele in codon 197 did not confer resistance to florasulam. Reduced susceptibility was only observed in population 10,416. This population’s low level of susceptibility to florasulam could be due to the presence of individuals with Ser197 replacement. As proposed by Délye et al. [29], Ser197 does not confer resistance of P. rhoeas to this herbicide, although it can reduce the sensitivity of the plants carrying it. An NTSR component of population 10,416’s resistance to ALS inhibitors cannot be excluded.
The populations of P. rhoeas analysed in this study were found to be variable not just in codon 197 of the ALS gene. Analysis of this gene sequence of survivors revealed five codons with non-synonymous mutations (Glu144Lys, Ile411Val, Gly417Met, Gly438Ala and Met445Lys), other than those known from the literature, to contribute to ALS resistance. As these substitutions were not just identified in ALS resistant populations but in susceptible populations too, and it was assumed that these new mutations were not involved in the resistance response. Variation unconnected to resistance in other codons of this gene (Gly281, Gly427 and Leu648) was detected in earlier studies of P. rhoeas [25,30]; however, in the Polish populations these codons were identical to the wild type (GenBank: AJ577316).
Populations 9068 and 9069 originated from the same village, but from different fields; therefore, it is possible that these two cases of resistance are not independent, but rather are due to the spread of seeds or pollen of the resistant biotype. The sequence of the ALS gene in individuals from these two populations is identical. The only difference is the sequence of codon 197. Homozygote mutants (ACT) or heterozygotes (MCT) were found in survivors after the RI test; however, these codons resulted in the same substitution Thr197. Other cases of resistance seem to be independent appearances, even in populations 10,410 and 10,416. Individuals from these populations had the same replacement Ser197; however, they originated from villages around 90 km apart and the sequence of the ALS gene of these plants was not identical due to some non-synonymous mutations unconnected to resistance. Populations 10,410 and 10,416 also differed in their susceptibility to florasulam. The results of this study confirm the thesis formulated by Délye et al. [29] for Italian populations of P. rhoeas resistant to ALS inhibitors, that mutant ALS alleles evolve by multiple, independent appearances.
In population 8491, none of the plants that survived the 4N dose of tribenuron had mutations in codons of the ALS gene known to be responsible for ALS resistance. In the case of population 8727, seven out of eight survivors analysed had no such mutation either. Therefore, ALS resistance in population 8491 is probably due to NTSR, with TSR and NTSR coexisting in population 8727. Other TSR mechanisms of ALS resistance have been already diagnosed in European populations of P. rhoeas [24,28,29,30]. In one of the populations analysed by Rey-Caballero et al. [30], only one of 51 plants presented a substitution in codon 197. The results obtained for the Polish population 8727 are similar to the situation described for Mediterranean populations, where both target site and non-target site mechanisms conferring resistance to ALS inhibitors can coexist in the same weed population in P. rhoeas.
Compared with western Europe, the situation with P. rhoeas in Poland is in its infancy. However, the increasing area of winter oilseed rape each year, and its consistently very high share in the structure of winter cereals [56], mean that P. rhoeas is proliferating in arable fields [52], significantly increasing the likelihood of exacerbating herbicide resistance in this species. To prevent this, the desired action would be to implement methods of integrated protection and resistance management, the effectiveness of which has been reported in numerous studies [7,54,57,58]. As described by [17], ALS and 2,4-D resistance in some populations of this species coexist. According to [30], selection pressure with ALS non-SU inhibitors carries the risk of promoting the evolution of NTSR mechanisms in P. rhoeas. It is necessary to change weed harmfulness thresholds and strive to reduce the seed bank as much as possible. The reality for most growers today is that weed seed banks in their fields are probably resistant to one or more herbicide site(s) of action. A zero-tolerance policy (‘take no prisoners’) is now being advocated [59,60].

5. Conclusions

In the evaluation of the reaction of P. rhoeas to ALS inhibitors, resistance was found in 14 populations from the provinces of Lublin, Świętokrzyskie, Warmia-Mazuria, Lower Silesia and West Pomerania. Most of them showed resistance to tribenuron, 10 were resistant to iodosulfuron and two to florasulam. Worryingly, eight populations had cross-resistance to tribenuron and iodosulfuron, and half of them showed high (RRR) or very high (RRRR) resistance to both active substances. In one population, cross-resistance to tribenuron, iodosulfuron and florasulam was identified. ED50 values for tribenuron, iodosulfuron and florasulam of many susceptible P. rhoeas populations fluctuated at around half of the recommended dose (0.5 N), which could be a concern, indicating that resistance to these active substances is developing.
In six out of eight analysed resistant P. rhoeas populations, TSR was identified in all plants from the population. This was due to mutations in codon 197 of the ALS gene. In one out of eight populations resistant to ALS inhibitors, the presence of the NTSR mechanism is proposed as the main mechanism of resistance due to the lack of mutations in the ALS gene of studied survivors from the biological test. In one P. rhoeas population, TSR and NTSR to ALS inhibitors probably coexist. In some codons of the ALS gene, diversity was detected, but it was not related to herbicide resistance to ALS inhibitors as these mutations were observed in populations rated as being resistant or susceptible to ALS inhibitors. Populations with the NTSR mechanism are very prone to developing resistance to different mechanisms of action. Therefore, an intensive P. rhoeas anti-resistance strategy should be implemented in agricultural practice, aimed at preventing the build-up of resistance to ALS inhibitors and multiple resistance.

Author Contributions

Conceptualization, M.S.-K., M.H. and M.W.; methodology, K.M., M.S.-K., K.D. and A.O.-S.; investigation, M.S.-K., M.H., M.W., A.O.-S., P.K., J.Ł., M.W.-K., B.W.-K., J.P., C.P., K.D., M.P., M.B. and K.M.; resources, M.S.-K., M.H., M.W., A.O.-S., P.K., J.Ł., M.W.-K., B.W.-K., J.P., C.P., K.D., M.P., M.B. and K.M.; data curation, M.S.-K., M.H., M.W., M.W.-K. and J.Ł.; writing—original draft preparation, M.S.-K., M.H., M.W. and P.K.; writing—review and editing, M.S.-K., M.H., M.W., A.O.-S., P.K., J.Ł., M.W.-K., B.W.-K., J.P., C.P., K.D., M.P., M.B. and K.M.; visualization, M.S-K., M.H. and M.W.; funding acquisition, K.M. All authors have read and agreed to the published version of the manuscript.

Funding

This research was funded by The National Centre for Research and Development, contract number: BIOSTRATEG3/347445/1/NCBR/2017.

Institutional Review Board Statement

Not applicable.

Informed Consent Statement

Not applicable.

Data Availability Statement

The data presented in this study are available on request from the corresponding author.

Conflicts of Interest

The authors declare no conflict of interest.

References

  1. Heap, I. International Herbicide-Resistant Weed Database. Available online: www.weedscience.org (accessed on 20 March 2022).
  2. HRAC: Herbicide Resistance Action Committee. Available online: www.hracglobal.com (accessed on 20 March 2022).
  3. Gressel, J. Evolving understanding of the evolution of herbicide resistance. Pest Manag. Sci. 2009, 65, 1164–1173. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  4. Vidotto, F.; Valle, N.D.; Fogliatto, S.; Milan, M.; De Palo, F.; Tabacchi, M.; Ferrero, A. Rapid increase of herbicide resistance in Echinochloa spp. consequent to repeated applications of the same herbicides over time. Arch. Agron Soil Sci. 2021, 67, 620–632. [Google Scholar] [CrossRef] [Scilit]
  5. Heap, I. Global perspective of herbicide-resistant weeds. Pest Manag. Sci. 2014, 70, 1306–1315. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  6. Hanf, M. Farbatlas Feldflora. Wildkräuter und Unkräuter; Verlag Eugen Ulmer: Stuttgart, Germany, 1990; p. 226. (In German) [Google Scholar]
  7. Torra, J.; Royo-Esnal, A.; Recasens, J. Management of herbicide-resistant Papaver rhoeas in dry land cereal fields. Agron. Sustain. Dev. 2011, 31, 483–490. [Google Scholar] [CrossRef] [Scilit]
  8. Mitich, L.W. Corn Poppy (Papaver rhoeas L.). Weed Technol. 2000, 14, 826–829. [Google Scholar] [CrossRef] [Scilit]
  9. Torra, J.; Recasens, J. Demography of corn poppy (Papaver rhoeas) in relation to emergence time and crop competition. Weed Sci. 2008, 56, 826–833. [Google Scholar] [CrossRef] [Scilit]
  10. Torra, J.; Gonzalez-Andujar, L.; Recasens, J. Modelling the population dynamics of Papaver rhoeas under various weed management systems in a Mediterranean climate. Weed Res. 2008, 48, 136–146. [Google Scholar] [CrossRef] [Scilit]
  11. Stankiewicz-Kosyl, M.; Synowiec, A.; Haliniarz, M.; Wenda-Piesik, A.; Domaradzki, K.; Parylak, D.; Wrochna, M.; Pytlarz, E.; Gala-Czekaj, D.; Marczewska-Kolasa, K.; et al. Herbicide Resistance and Management Options of Papaver rhoeas L. and Centaurea cyanus L. in Europe: A Review. Agronomy 2020, 10, 874. [Google Scholar] [CrossRef] [Scilit]
  12. Cirujeda, A.; Recasens, J.; Taberner, A. Dormancy cycle and viability of buried seeds of Papaver rhoeas. Weed Res. 2006, 46, 327–334. [Google Scholar] [CrossRef] [Scilit]
  13. Torra, J.; Royo-Esnal, A.; Rey-Caballero, J.; Recasens, J.; Salas, M. Management of herbicide-resistant corn poppy (Papaver rhoeas) under different tillage systems does not change the frequency of resistant plants. Weed Sci. 2018, 66, 764–772. [Google Scholar] [CrossRef] [Scilit]
  14. Scherner, A.; Melander, B.; Kudsk, P. Vertical distribution and composition of weed seeds within the plough layer after eleven years of contrasting crop rotation and tillage schemes. Soil Tillage Res. 2016, 161, 135–142. [Google Scholar] [CrossRef] [Scilit]
  15. Cirujeda, A.; Recasens, J.; Torra, J.; Taberner, A. A germination study of herbicide-resistant field poppies in Spain. Agron. Sustain. Dev. 2008, 28, 207–220. [Google Scholar] [CrossRef] [Scilit]
  16. Holm, L.; Doll, J.; Holm, E.; Pancho, J.; Herberger, J. World Weeds: Natural Histories and Distribution; John Wiley: New York, NY, USA, 1997; p. 129. [Google Scholar]
  17. Calha, I.; Rocha, F.; Ruiz-Santaella, J.P.; Cruz-Hipolito, H. Two decades of herbicide resistance in the Iberian Peninsula. J. Plant Dis. Protect. 2008, 21, 79–84. [Google Scholar]
  18. Rey-Caballero, J.; Menéndez, J.; Giné-Bordonaba, J.; Salas, M.; Alcántara, R.; Torra, J. Unravelling the resistance mechanisms to 2,4-D (2,4-dichlorophenoxyacetic acid) in corn poppy (Papaver rhoeas). Pestic. Biochem. Phys. 2016, 133, 67–72. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  19. Kati, V.; Scarabel, L.; Thiery-Lanfranchi, D.; Kioleoglou, V.; Liberopoulou, S.; Délye, C. Multiple resistance of Papaver rhoeas L. to 2,4-D and acetolactate synthase inhibitors in four European countries. Weed Res. 2019, 59, 367–376. [Google Scholar] [CrossRef] [Scilit]
  20. Powles, S.B.; Yu, Q. Evolution in action: Plants resistant to herbicides. Ann. Rev. Plant Biol. 2010, 61, 317–347. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  21. Torra, J.; Rojano-Delgado, A.M.; Menéndez, J.; Salas, M.; De Prado, R. Cytochrome P450 metabolism-based herbicide resistance to imazamox and 2, 4-D in Papaver rhoeas. Plant Physiol. Biochem. 2021, 160, 51–61. [Google Scholar] [CrossRef] [Scilit]
  22. Torra, J.; Cirujeda, A.; Taberner, A.; Recasens, J. Evaluation of herbicides to manage herbicide-resistant corn poppy (Papaver rhoeas) in winter cereals. Crop Prot. 2010, 29, 731–736. [Google Scholar] [CrossRef] [Scilit]
  23. Torra, J.; Rojano-Delgado, A.M.; Rey-Caballero, J.; Royo-Esnal, A.; Salas, M.L.; De Prado, R. Enhanced 2,4-D metabolism in two resistant Papaver rhoeas populations from Spain. Front. Plant Sci. 2017, 13, 1584. [Google Scholar] [CrossRef] [Scilit]
  24. Palma-Bautista, C.; Portugal, J.; Vázquez-García, J.G.; Osuna, M.D.; Torra, J.; Lozano-Juste, J.; Gherekhloo, J.; De Prado, R. Tribenuron-methyl metabolism and the rare Pro197Phe double mutation together with 2,4-D metabolism and reduced absorption can evolve in Papaver rhoeas with multiple and cross herbicide resistance to ALS inhibitors and auxin mimics. Pestic. Biochem. Phys. 2022, 188, 105226. [Google Scholar] [CrossRef] [Scilit]
  25. Duran-Prado, M.; Osuna, M.D.; De Prado, R.; Franco, A.R. Molecular basis of resistance to sulfonylureas in Papaver rhoeas. Pestic. Biochem. Phys. 2004, 79, 10–17. [Google Scholar] [CrossRef] [Scilit]
  26. Kaloumenos, N.S.; Dordas, C.A.; Diamantidis, G.C.; Eleftherohorinos, I.G. Multiple Pro197 substitutions in the acetolactate synthase of corn poppy (Papaver rhoeas) confer resistance to tribenuron. Weed Sci. 2009, 57, 262–268. [Google Scholar] [CrossRef] [Scilit]
  27. Marshall, R.; Hull, R.; Moss, S.R. Target site resistance to ALS inhibiting herbicides in Papaver rhoeas and Stellaria media biotypes from the UK. Weed Res. 2010, 50, 621–630. [Google Scholar] [CrossRef] [Scilit]
  28. Scarabel, L.; Pernin, F.; Déyle, C. Occurrence, genetic control and evolution of non-target-site based resistance to herbicides inhibiting acetolactate synthase (ALS) in the dicot weed Papaver rhoeas. Plant Sci. 2015, 238, 158–169. [Google Scholar] [CrossRef] [Scilit]
  29. Délye, C.; Pernin, F.; Scarabel, L. Evolution and diversity of the mechanisms endowing resistance to herbicides inhibiting acetolactate-synthase (ALS) in corn poppy (Papaver rhoeas L.). Plant Sci. 2011, 180, 333–342. [Google Scholar] [CrossRef] [Scilit]
  30. Rey-Caballero, J.; Menéndez, J.; Osuna, M.D.; Salas, M.; Torra, J. Target-site and non-target-site resistance mechanisms to ALS inhibiting herbicides in Papaver rhoeas. Pestic. Biochem. Phys. 2017, 138, 57–65. [Google Scholar] [CrossRef] [Scilit]
  31. Moss, S.; Ulber, L.; den Hoed, I. A herbicide resistance risk matrix. Crop Prot. 2019, 115, 13–19. [Google Scholar] [CrossRef] [Scilit]
  32. Diggle, A.J.; Neve, P.B.; Smith, F.P. Herbicides used in combination can reduce the probability of herbicide resistance in finite weed populations. Weed Res. 2003, 43, 371–382. [Google Scholar] [CrossRef] [Scilit]
  33. Busi, R.; Powles, S.B.; Beckie, H.J.; Renton, M. Rotations and mixtures of soil-applied herbicides delay resistance. Pest Manag. Sci. 2020, 76, 487–496. [Google Scholar] [CrossRef] [Scilit]
  34. Beckie, H.J.; Harker, K.N. Our top 10 herbicide-resistant weed management practices. Pest Manag. Sci. 2017, 73, 1045–1052. [Google Scholar] [CrossRef] [Scilit]
  35. Beckie, H.J.; Busi, R.; Lopez-Ruiz, F.J.; Umina, P.A. Herbicide resistance management strategies: How do they compare with those for insecticides, fungicides and antibiotics? Pest Manag. Sci. 2021, 77, 3049–3056. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  36. Burgos, N.R.; Tranel, P.J.; Streibig, J.C.; Davis, V.M.; Shaner, D.; Norsworthy, J.K.; Ritz, C. Review: Confirmation of resistance to herbicides and evaluation of resistance levels. Weed Sci. 2013, 61, 4–20. [Google Scholar] [CrossRef] [Scilit]
  37. Panozzo, S.; Scarabel, L.; Collavo, A.; Sattin, M. Protocols for robust herbicide resistance testing in different weed species. J. Vis. Exp. 2015, 101, 1–10. [Google Scholar] [CrossRef] [Scilit] [PubMed]
  38. Knezevic, S.Z.; Streibig, J.C.; Ritz, C. Utilizing R software package for dose-response studies: The concept and data analysis. Weed Technol. 2007, 21, 840–848. [Google Scholar] [CrossRef] [Scilit]
  39. R Core Team, R. A Language and Environment for Statistical Computing; R Foundation for Statistical Computing: Vienna, Austria, 2020; Available online: https://www.R-project.org/ (accessed on 8 January 2022).
  40. Beckie, H.J.; Tardif, F.J. Herbicide cross resistance in weeds. Crop Prot. 2012, 35, 15–28. [Google Scholar] [CrossRef] [Scilit]
  41. Burgos, N.R. Whole-plant and seed bioassays for resistance confirmation. Weed Sci. 2015, 63, 152–165. [Google Scholar] [CrossRef] [Scilit]
  42. Doyle, J.J.; Doyle, J.L. A rapid DNA isolation procedure for small quantities of fresh leaf tissue. Phytochemistry 1987, 19, 11–15. [Google Scholar]
  43. Trąba, C.; Ziemińska-Smyk, M. The occurrence of Papaver rhoeas L. in agrocenoses of the buffer zone of the Roztocze National Park compared to other regions of Poland. Acta Agrobot. 2009, 62, 213–230. [Google Scholar] [CrossRef] [Scilit]
  44. Godefroid, S.; Rivie‘re, S.; Waldren, S.; Boretos, N.; Eastwood, R.; Vanderborght, T. To what extent are threatened European plant species conserved in seed banks? Biol. Conserv. 2011, 144, 1494–1498. [Google Scholar] [CrossRef] [Scilit]
  45. March-Salas, M.; Fitze, P.S. A multi-year experiment shows that lower precipitation predictability encourages plants’ early life stages and enhances population viability. PeerJ 2019, 7, 6443. [Google Scholar] [CrossRef] [Scilit]
  46. Dąbkowska, T.; Łabza, T.; Krańska, A. Zmiany we florze chwastów segetalnych w latach 1993-2005 zagrożonych na rędzinie brunatnej Wyżyny Miechowskiej. Fragm. Agron. 2007, 3, 55–61. (In Polish) [Google Scholar]
  47. Fijałkowski, D. Synantropy Roślinne Lubelszczyzny; PWN: Warszawa-Łódź, Poland, 1978. (In Polish) [Google Scholar]
  48. Wnuk, Z. Zespół Lamio-Veronicetum politae Kornaś 1950 w Polsce. Zesz Nauk AR w Krakowie 1987, 216, 95–133. (In Polish) [Google Scholar]
  49. Skrzyczyńska, J. Studia nad Florą i Zbiorowiskami Segetalnymi Wysoczyzny Siedleckiej; Rozprawy Naukowe WSR-P w Siedlcach: Siedlce, Poland, 1994. (In Polish) [Google Scholar]
  50. Kutyna, I.; Młynkowiak, E.; Leśnik, T. Struktura fitosocjologiczna fitocenoz zbóż ozimych na tle warunków glebowych południowo-zachodniej części Niziny Szczecińskiej i terenów do niej przyległych. Fragm. Agron. 2010, 27, 86–102. (In Polish) [Google Scholar]
  51. Sekutowski, T.R.; Włodek, S.; Biskupski, S.; Sienkiewicz-Cholewa, U. Porównanie odłogu i sąsiadującego pola uprawnego pod względem zasobności w nasiona i rośliny nawłoci (Solidago sp.). Zesz. Nauk. UP Wroc. Rol. C 2012, 584, 99–112. (In Polish) [Google Scholar]
  52. Staniak, M.; Haliniarz, M.; Kwiecińska-Poppe, E.; Harasim, E.; Wesołowski, M. Diversity of agrocoenoses in the Lublin region, Poland. Acta Agrobot. 2017, 70, 1722. [Google Scholar] [CrossRef] [Scilit]
  53. Adamczewski, K.; Kierzek, R.; Matysiak, K. Biotypes of scentless chamomile Matricaria maritima (L.) ssp. inodora (L.) Dostal and common poppy Papaver rhoeas (L.) resistant to tribenuron methyl, in Poland. J. Plant Prot. Res. 2014, 54, 401–406. [Google Scholar] [CrossRef] [Scilit]
  54. Petersen, J.; Raffen, H. Evolution der Herbizidresistenz in Alopecurus myosuroides und Apera spica-venti im deutschen Getreideanbau der letzten 15 Jahre. Julius-Kühn-Archiv 2020, 464, 326–332. (In German) [Google Scholar]
  55. Duggleby, R.G.; McCourt, J.A.; Guddat, L.W. Structure and mechanism of inhibition of plant acetohydroxyacid synthase. Plant Physiol. Biochem. 2008, 46, 309–324. [Google Scholar] [CrossRef] [Scilit]
  56. Statistical Yearbook of The Republic of Poland; Statistics Poland: Warsaw, Poland, 2021. Available online: https://stat.gov.pl/obszary-tematyczne/roczniki-statystyczne/roczniki-statystyczne/rocznik-statystyczny-rzeczypospolitej-polskiej-2021,2,21.html (accessed on 21 March 2022).
  57. Rey-Caballero, J.; Royo-Esnal, A.; Recasens, J.; González, I.; Torra, J. Management options for multiple herbicide–resistant corn poppy (Papaver rhoeas) in Spain. Weed Sci. 2017, 65, 295–304. [Google Scholar] [CrossRef] [Scilit]
  58. Perotti, W.E.; Larran, A.S.; Palmieri, W.E.; Martinatto, A.K.; Permingeat, H.R. Herbicide resistant weeds: A call to integrate conventional agricultural practices, molecular biology knowledge and new technologies. Plant Sci. 2020, 290, 110255. [Google Scholar] [CrossRef] [Scilit]
  59. Barber, L.T.; Smith, K.L.; Scott, R.C.; Norsworthy, J.K.; Vangilder, A.M. Zero Tolerance: A Community-Based Program for Glyphosate-Resistant Palmer Amaranth Management; University of Arkansas, Division of Agriculture and Natural Research and Extension FSA2177: Little Rock, AR, USA, 2015; Available online: www.uaex.uada.edu/publications/pdf/FSA2177.pdf (accessed on 4 April 2022).
  60. Beckie, H.J.; Ashworth, M.B.; Flower, K.C. Herbicide resistance management: Recent developments and trends. Plants 2019, 8, 161. [Google Scholar] [CrossRef] [Scilit] [PubMed]
Figure 1. Locations in Poland where herbicide-resistant populations of P. rhoeas L. were found. Abbreviations: GP—Greater Poland, KP—Kuyavia-Pomerania, LP—Lesser Poland, LS—Lower Silesia, Lb—Lublin, Ms—Masovia, Pd—Podlasie, Pm—Pomerania, Sb—Subcarpathia, Św—Świętokrzyskie, WM—Warmia-Masuria, WP—West Pomerania, Op—Opole, SI—Silesian, Lo—Łódź, Lu—Lubusz.
Figure 1. Locations in Poland where herbicide-resistant populations of P. rhoeas L. were found. Abbreviations: GP—Greater Poland, KP—Kuyavia-Pomerania, LP—Lesser Poland, LS—Lower Silesia, Lb—Lublin, Ms—Masovia, Pd—Podlasie, Pm—Pomerania, Sb—Subcarpathia, Św—Świętokrzyskie, WM—Warmia-Masuria, WP—West Pomerania, Op—Opole, SI—Silesian, Lo—Łódź, Lu—Lubusz.
Agriculture 13 00082 g001
Figure 2. Dose-response curves of P. rhoeas populations resistant (R, RR, RRR, RRRR) and susceptible (S) to tribenuron-methyl.
Figure 2. Dose-response curves of P. rhoeas populations resistant (R, RR, RRR, RRRR) and susceptible (S) to tribenuron-methyl.
Agriculture 13 00082 g002
Figure 3. Dose-response curves of P. rhoeas populations resistant (R, RR, RRR, RRRR) and susceptible (S) to iodosulfuron-methyl-Na.
Figure 3. Dose-response curves of P. rhoeas populations resistant (R, RR, RRR, RRRR) and susceptible (S) to iodosulfuron-methyl-Na.
Agriculture 13 00082 g003
Figure 4. Populations of P. rhoeas susceptible to tribenuron-methyl (a), iodosulfuron-methyl-Na (b) and florasulam (c) characterised by ED50 (effective dose causing 50% shoot fresh weight reduction in the treated plants). * Half of the recommended field dose of tribenuron-methyl, iodosulfuron-methyl-Na and florasulam.
Figure 4. Populations of P. rhoeas susceptible to tribenuron-methyl (a), iodosulfuron-methyl-Na (b) and florasulam (c) characterised by ED50 (effective dose causing 50% shoot fresh weight reduction in the treated plants). * Half of the recommended field dose of tribenuron-methyl, iodosulfuron-methyl-Na and florasulam.
Agriculture 13 00082 g004
Table 1. Description of herbicides used in the biological tests.
Table 1. Description of herbicides used in the biological tests.
Active
Substance
Commercial
Product
ProducerContent of Active Substancein Commercial ProductsRecommended Dose of Commercial ProductField Dose (1N) of Active Substance
Tribenuron methylLumer 50 WGADAMA, PL500 g kg−1 (50%)30 g ha−115 g ha−1
FlorasulamSaracen 050 SCCheminova, PL50 g L−1 (4.81%)0.1 L ha−15 g ha−1
IodosulfuronAutumn 10 WGBayer, PL100 g kg−1 (10%)100 g ha−110 g ha−1
Table 2. Populations of P. rhoeas resistant to acetolactate synthase inhibitors characterised by ED50 (effective dose causing 50% shoot fresh weight reduction in the treated plants) and resistance index (RI).
Table 2. Populations of P. rhoeas resistant to acetolactate synthase inhibitors characterised by ED50 (effective dose causing 50% shoot fresh weight reduction in the treated plants) and resistance index (RI).
PopulationProvinceTribenuron-MethylIodosulfuron-Methyl-NaFlorasulam
RIED50
(g ha−1)
R/SRIED50
(g ha−1)
R/SRIED50
(g ha−1)
R/S
8491 *LbRR47.9 ± 14.4 **6.8SXXSXX
8727 *LbRR50.6 ± 10.27.2SXXSXX
8833ŚwSXXSXXr4.7 ± 1.62.0
8935LSSXXR16.7 ± 1.073.6SXX
8961 *WMRRRR 545.6 ± 109.177.5RR23.2 ± 5.85.0SXX
9068 *LSRRR 201.1 ± 20.128.6RRRR398.5 ± 14.285.4SXX
9069 *LSRRRR 4089 ± 531.6580.7RRR283.7 ± 37.460.8SXX
9440ŚwRR35.7 ± 5.35.1SXXSXX
10,186LSRRRR 10,212 ± 2246.61450.2RRR101.0 ± 16.221.6SXX
10,303 *WPRRR63.9 ± 11.53.2RRR136.3 ± 30.029.2SXX
10,374LbR16.3 ± 2.32.3R 23.0 ± 4.44.9SXX
10,410 *LbRRR 164.1 ± 34.523.3r10.7 ± 2.02.3SXX
10,416 *LbRRR180.6 ± 11.725.7RR 24.3 ± 4.65.2r6.0 ± 1.82.5
10,612LSRRRR>480>68.2r9.5 ± 1.222.0SXX
RI (resistance index) on the basis of R/S value: S—susceptibility (<2); r—reduced susceptibility (2–2.9); R—low resistance (3–4.9); RR—moderate resistance (5.0–9.9); RRR—high resistance (10.0–68.1); RRRR—very high resistance (>68.2) (the modified scale of Beckie and Tardif [40]); X—not calculated; * populations subjected to molecular analysis; ** standard error.
Table 3. Genetic variability in the acetolactate synthase of P. rhoeas populations. Only positions related to ALS resistance (Ala122, Pro197, Ala205, Asp376, Trp574, Ala653 and Gly654) and others where mutations were found are represented. All sequences were compared with the wild type P. rhoeas ALS gene (GenBank: AJ577316). IUPAC code was used for the nucleotide nomenclature. Dots indicate codons identical to those of the wild type ALS gene. ALS-resistant populations are underlined.
Table 3. Genetic variability in the acetolactate synthase of P. rhoeas populations. Only positions related to ALS resistance (Ala122, Pro197, Ala205, Asp376, Trp574, Ala653 and Gly654) and others where mutations were found are represented. All sequences were compared with the wild type P. rhoeas ALS gene (GenBank: AJ577316). IUPAC code was used for the nucleotide nomenclature. Dots indicate codons identical to those of the wild type ALS gene. ALS-resistant populations are underlined.
Ala
122
GCA
Ile
136
ATT
Glu
144
GAA
Pro
197
CCT
Ala
205
GCA
Ile
211
ATT
Asp
376
GAT
Arg
377
CGT
Ile
411
ATC
Gly
417
GTG
Glu
427
GAA
Gly
438
GTG
Met
445
ATG
Leu
453
TTG
Trp
574
TGG
Leu
648
TTG
Ala
653
GCT
Gly
654
GGT
No. of
occ.*
Population

Wild Type ALS
GCAATTGAACCTGCAATTGATCGTATCGTGGAAGTGATGTTGTGGTTGGCTGGT208816 8727 8491 8483 9329 10,188 10,310 10,314 10,331
. . .. . .. . .CST **. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .610,303
. . .. . .. . .CST. . .. . .. . .. . .. . .. . .. . .. . .. . .YTG. . .. . .. . .. . .110,303
. . .. . .. . .CGT. . .. . .. . .. . .. . .. . .. . .. . .. . .CTG. . .. . .. . .. . .410,303
. . .. . .. . .CGT. . .. . .. . .. . .. . .. . .. . .. . .AWGCTG. . .. . .. . .. . .110,303
. . .. . .. . .CGT. . .. . .. . .. . .. . .RTG. . .. . .AWGYTG. . .. . .. . .. . .110,303
. . .. . .. . .CST. . .. . .. . .. . .RTC. . .. . .GYGAWG. . .. . .. . .. . .. . .110,303
. . .. . .. . .CST. . .. . .. . .. . .. . .RTG. . .. . .AWG. . .. . .. . .. . .. . .110,303
. . .. . .. . .CYT. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .18727
. . .. . .. . .TCT. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .110,410
. . .. . .. . .YCT. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .410,410 10,416
. . .. . .. . .ACT. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .49068 9069
. . .. . .. . .MCT. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .29068
. . .. . .. . .KCT. . .ATY. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .18961
. . .. . .. . .SCT. . .ATY. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .28961
. . .. . .. . .SMT. . .ATY. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .38961
. . .. . .. . .YCT. . .. . .. . .. . .RTCRTG. . .. . .AWG. . .. . .. . .. . .. . .110,416
. . .. . .. . .. . .. . .. . .. . .. . .RTCRTG. . .GYGAWG. . .. . .. . .. . .. . .38491 8483
. . .ATW. . .. . .. . .. . .. . .. . .RTCRTG. . .GYGAWG. . .. . .. . .. . .. . .110,314
. . .. . .. . .. . .. . .ATY. . .. . .. . .. . .. . .. . .AWG. . .. . .. . .. . .. . .110,310
. . .. . .. . .. . .. . .ATY. . .. . .RTCRTG. . .GYGAWG. . .. . .. . .. . .. . .18816
. . .. . .. . .. . .. . .ATY. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .38816 8727 10314
. . .. . .. . .. . .. . .. . .. . .. . .RTC. . .. . .. . .AWG. . .. . .. . .. . .. . .210,188 10,331
. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .YTG. . .. . .. . .. . .19329
. . .ATWRAA. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .19329
. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .. . .CTG. . .. . .. . .. . .19329
* Number of occurrences, ** S = C/G, Y = C/T, W = A/T, R = A/G, M = A/C, K = G/T.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Stankiewicz-Kosyl, M.; Haliniarz, M.; Wrochna, M.; Obrępalska-Stęplowska, A.; Kuc, P.; Łukasz, J.; Wińska-Krysiak, M.; Wrzesińska-Krupa, B.; Puła, J.; Podsiadło, C.; et al. Occurrence and Mechanism of Papaver rhoeas ALS Inhibitors Resistance in Poland. Agriculture 2023, 13, 82. https://doi.org/10.3390/agriculture13010082

AMA Style

Stankiewicz-Kosyl M, Haliniarz M, Wrochna M, Obrępalska-Stęplowska A, Kuc P, Łukasz J, Wińska-Krysiak M, Wrzesińska-Krupa B, Puła J, Podsiadło C, et al. Occurrence and Mechanism of Papaver rhoeas ALS Inhibitors Resistance in Poland. Agriculture. 2023; 13(1):82. https://doi.org/10.3390/agriculture13010082

Chicago/Turabian Style

Stankiewicz-Kosyl, Marta, Małgorzata Haliniarz, Mariola Wrochna, Aleksandra Obrępalska-Stęplowska, Piotr Kuc, Justyna Łukasz, Marzena Wińska-Krysiak, Barbara Wrzesińska-Krupa, Joanna Puła, Cezary Podsiadło, and et al. 2023. "Occurrence and Mechanism of Papaver rhoeas ALS Inhibitors Resistance in Poland" Agriculture 13, no. 1: 82. https://doi.org/10.3390/agriculture13010082

APA Style

Stankiewicz-Kosyl, M., Haliniarz, M., Wrochna, M., Obrępalska-Stęplowska, A., Kuc, P., Łukasz, J., Wińska-Krysiak, M., Wrzesińska-Krupa, B., Puła, J., Podsiadło, C., Domaradzki, K., Piekarczyk, M., Bednarczyk, M., & Marcinkowska, K. (2023). Occurrence and Mechanism of Papaver rhoeas ALS Inhibitors Resistance in Poland. Agriculture, 13(1), 82. https://doi.org/10.3390/agriculture13010082

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop