The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma
Abstract
:1. Introduction
2. Materials and Methods
2.1. Patient and Samples
2.2. Expression Analysis of miRNAs and the MDM2 Gene
2.2.1. RNA and miRNA Extraction and Quantification
2.2.2. Complementary DNA (cDNA) Synthesis
2.2.3. Analysis of miRNA and MDM2 Gene Expression
2.3. HPV 16 Detection
2.4. Statistical Analyses
3. Results
3.1. miRNA Expression and Correlations between the Expression of miRNAs and Socio-Demographic and Clinicopathological Features
3.2. MDM2 Gene Expression and Correlations between MDM2 Gene Expression and Socio-Demographic and Clinicopathological Features
3.3. Correlation of the miR-3613-3p Expression and MDM2 Gene Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Sung, H.; Ferlay, J.; Siegel, R.L.; Laversanne, M.; Soerjomataram, I.; Jemal, A.; Bray, F. Global Cancer Statistics 2020: GLOBOCAN Estimates of Incidence and Mortality Worldwide for 36 Cancers in 185 Countries. CA Cancer J. Clin. 2021, 71, 209–249. [Google Scholar] [CrossRef]
- Golusinski, P.; Di Maio, P.; Pehlivan, B.; Colley, S.; Nankivell, P.; Kong, A.; Hartley, A.; Mehanna, H. Evidence for the approach to the diagnostic evaluation of squamous cell carcinoma occult primary tumors of the head and neck. Oral Oncol. 2019, 88, 145–152. [Google Scholar] [CrossRef]
- Aghiorghiesei, O.; Zanoaga, O.; Raduly, L.; Aghiorghiesei, A.I.; Chiroi, P.; Trif, A.; Buiga, R.; Budisan, L.; Lucaciu, O.; Pop, L.A.; et al. Dysregulation of miR-21-5p, miR-93-5p, miR-200c-3p and miR-205-5p in Oral Squamous Cell Carcinoma: A Potential Biomarkers Panel? Curr. Issues Mol. Biol. 2022, 44, 1754–1767. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2016. CA Cancer J. Clin. 2016, 66, 7–30. [Google Scholar] [CrossRef]
- Dioguardi, M.; Caloro, G.A.; Laino, L.; Alovisi, M.; Sovereto, D.; Crincoli, V.; Aiuto, R.; Coccia, E.; Troiano, G.; Lo Muzio, L. Circulating miR-21 as a Potential Biomarker for the Diagnosis of Oral Cancer: A Systematic Review with Meta-Analysis. Cancers 2020, 12, 936. [Google Scholar] [CrossRef] [PubMed]
- Esquivel-Chirino, C.; Bolaños-Carrillo, M.A.; Carmona-Ruiz, D.; Lopéz-Macay, A.; Hernández-Sánchez, F.; Montés-Sánchez, D.; Escuadra-Landeros, M.; Gaitán-Cepeda, L.A.; Maldonado-Frías, S.; Yáñez-Ocampo, B.R.; et al. The Protective Role of Cranberries and Blueberries in Oral Cancer. Plants 2023, 12, 2330. [Google Scholar] [CrossRef] [PubMed]
- Kaur, V.; Rooney, A.; Horton, B.J. Prognostic significance of extra-nodal extension and positive surgical margins in HPV positive oropharyngeal squamous cell carcinoma. Am. J. Otolaryngol. 2023, 44, 103877. [Google Scholar] [CrossRef]
- Yang, Z.; Sun, P.; Dahlstrom, K.R.; Gross, N.; Li, G. Joint effect of human papillomavirus exposure, smoking and alcohol on risk of oral squamous cell carcinoma. BMC Cancer 2023, 23, 457. [Google Scholar] [CrossRef] [PubMed]
- Kabzinski, J.; Maczynska, M.; Majsterek, I. MicroRNA as a Novel Biomarker in the Diagnosis of Head and Neck Cancer. Biomolecules 2021, 11, 844. [Google Scholar] [CrossRef]
- Thomaidou, A.C.; Batsaki, P.; Adamaki, M.; Goulielmaki, M.; Baxevanis, C.N.; Zoumpourlis, V.; Fortis, S.P. Promising Biomarkers in Head and Neck Cancer: The Most Clinically Important miRNAs. Int. J. Mol. Sci. 2022, 23, 8257. [Google Scholar] [CrossRef] [PubMed]
- Di Leva, G.; Garofalo, M.; Croce, C.M. MicroRNAs in cancer. Annu. Rev. Pathol. 2014, 9, 287–314. [Google Scholar] [CrossRef]
- Ali Syeda, Z.; Langden, S.S.S.; Munkhzul, C.; Lee, M.; Song, S.J. Regulatory Mechanism of MicroRNA Expression in Cancer. Int. J. Mol. Sci. 2020, 21, 1723. [Google Scholar] [CrossRef] [PubMed]
- Vannini, I.; Fanini, F.; Fabbri, M. Emerging roles of microRNAs in cancer. Curr. Opin. Genet. Dev. 2018, 48, 128–133. [Google Scholar] [CrossRef]
- Vos, P.D.; Leedman, P.J.; Filipovska, A.; Rackham, O. Modulation of miRNA function by natural and synthetic RNA-binding proteins in cancer. Cell Mol. Life Sci. 2019, 76, 3745–3752. [Google Scholar] [CrossRef] [PubMed]
- Cai, Y.; Hao, Y.; Ren, H.; Dang, Z.; Xu, H.; Xue, X.; Gao, Y. miR-1305 Inhibits The Progression Of Non-Small Cell Lung Cancer By Regulating MDM2. Cancer Manag. Res. 2019, 11, 9529–9540. [Google Scholar] [CrossRef] [PubMed]
- Hou, H.; Sun, D.; Zhang, X. The role of MDM2 amplification and overexpression in therapeutic resistance of malignant tumors. Cancer Cell Int. 2019, 19, 216. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, D.; Liao, W.; Zeng, S.X.; Lu, H. Reviving the guardian of the genome: Small molecule activators of p53. Pharmacol. Ther. 2017, 178, 92–108. [Google Scholar] [CrossRef]
- Sheng, W.; Dong, M.; Chen, C.; Wang, Z.; Li, Y.; Wang, K.; Li, Y.; Zhou, J. Cooperation of Musashi-2, Numb, MDM2, and P53 in drug resistance and malignant biology of pancreatic cancer. FASEB J. 2017, 31, 2429–2438. [Google Scholar] [CrossRef]
- Tong, H.; Zhao, K.; Zhang, J.; Zhu, J.; Xiao, J. YB-1 modulates the drug resistance of glioma cells by activation of MDM2/p53 pathway. Drug Des. Devel. Ther. 2019, 13, 317–326. [Google Scholar] [CrossRef]
- Ahmad, S.M.; Nayak, D.; Mir, K.B.; Faheem, M.M.; Nawaz, S.; Yadav, G.; Goswami, A. Par-4 activation restrains EMT-induced chemoresistance in PDAC by attenuating MDM-2. Pancreatology 2020, 20, 1698–1710. [Google Scholar] [CrossRef]
- Wang, Q.S.; Zhou, J.; Li, X. LncRNA UCA1 protects cardiomyocytes against hypoxia/reoxygenation induced apoptosis through inhibiting miR-143/MDM2/p53 axis. Genomics 2020, 112, 574–580. [Google Scholar] [CrossRef] [PubMed]
- Ma, W.; Zhao, P.; Zang, L.; Zhang, K.; Liao, H.; Hu, Z. CircTP53 promotes the proliferation of thyroid cancer via targeting miR-1233-3p/MDM2 axis. J. Endocrinol. Investig. 2021, 44, 353–362. [Google Scholar] [CrossRef] [PubMed]
- Gołąbek, K.; Hudy, D.; Świętek, A.; Gaździcka, J.; Dąbrowska, N.; Miśkiewicz-Orczyk, K.; Zięba, N.; Misiołek, M.; Strzelczyk, J.K. miR-125b-5p, miR-155-3p, and miR-214-5p and Target E2F2 Gene in Oral Squamous Cell Carcinoma. Int. J. Mol. Sci. 2023, 24, 6320. [Google Scholar] [CrossRef] [PubMed]
- Brunner, M.; Ng, B.C.; Veness, M.J.; Clark, J.R. Comparison of the AJCC N staging system in mucosal and cutaneous squamous head and neck cancer. Laryngoscope 2014, 124, 1598–1602. [Google Scholar] [CrossRef]
- Rodrigues, P.C.; Miguel, M.C.; Bagordakis, E.; Fonseca, F.P.; de Aquino, S.N.; Santos-Silva, A.R.; Lopes, M.A.; Graner, E.; Salo, T.; Kowalski, L.P.; et al. Clinicopathological prognostic factors of oral tongue squamous cell carcinoma: A retrospective study of 202 cases. Int. J. Oral Maxillofac. Surg. 2014, 43, 795–801. [Google Scholar] [CrossRef]
- El-Naggar, A.K.; Chan, J.K.C.; Grandis, J.R.; Takata, T.; Slootweg, P.J. WHO Classification of Head and Neck Tumours International Agency for Research on Cancer (IARC), 4th ed.; IARC Publications: Lyon, France, 2017. [Google Scholar]
- Gołąbek, K.; Rączka, G.; Gaździcka, J.; Miśkiewicz-Orczyk, K.; Zięba, N.; Krakowczyk, Ł.; Misiołek, M.; Strzelczyk, J.K. Expression Profiles of CDKN2A, MDM2, E2F2 and LTF Genes in Oral Squamous Cell Carcinoma. Biomedicines 2022, 10, 3011. [Google Scholar] [CrossRef]
- miRCode. Available online: http://www.mircode.org (accessed on 14 September 2022).
- miRDB. Available online: http://mirdb.org (accessed on 14 September 2022).
- TargetScan. Available online: http://www.targetscan.org/vert_72/ (accessed on 14 September 2022).
- Doukas, S.G.; Vagelim, D.P.; Lazopoulos, G.; Spandidos, D.A.; Sasaki, C.T.; Tsatsakis, A. The Effect of NNK, A Tobacco Smoke Carcinogen, on the miRNA and Mismatch DNA Repair Expression Profiles in Lung and Head and Neck Squamous Cancer Cells. Cells 2020, 9, 1031. [Google Scholar] [CrossRef]
- Chen, C.; Pan, Y.; Bai, L.; Chen, H.; Duan, Z.; Si, Q.; Zhu, R.; Chuang, T.H.; Luo, Y. MicroRNA-3613-3p functions as a tumor suppressor and represents a novel therapeutic target in breast cancer. Breast Cancer Res. 2021, 23, 12. [Google Scholar] [CrossRef]
- Zhang, D.; Liu, E.; Kang, J.; Yang, X.; Liu, H. MiR-3613-3p affects cell proliferation and cell cycle in hepatocellular carcinoma. Oncotarget 2017, 8, 93014–93028. [Google Scholar] [CrossRef]
- Yan, W.; Yang, W.; Liu, Z.; Wu, G. Characterization of microRNA expression in primary human colon adenocarcinoma cells (SW480) and their lymph node metastatic derivatives (SW620). Onco Targets Ther. 2018, 11, 4701–4709. [Google Scholar] [CrossRef]
- Pu, Q.; Huang, Y.; Lu, Y.; Peng, Y.; Zhang, J.; Feng, G.; Wang, C.; Liu, L.; Dai, Y. Tissue-specific and plasma microRNA profiles could be promising biomarkers of histological classification and TNM stage in non-small cell lung cancer. Thorac. Cancer 2016, 7, 348–354. [Google Scholar] [CrossRef]
- Song, J.; Wang, W.; Wang, Y.; Qin, Y.; Wang, Y.; Zhou, J.; Wang, X.; Zhang, Y.; Wang, Q. Epithelial-mesenchymal transition markers screened in a cell-based model and validated in lung adenocarcinoma. BMC Cancer 2019, 19, 680. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Zhang, X.; Peng, J.; Chen, Y.; Zhao, W.; Jiang, X.; Su, L.; Xie, M.; Lin, B. miR-371b-5p promotes cell proliferation, migration and invasion in non-small cell lung cancer via SCAI. Biosci. Rep. 2020, 40, BSR20200163. [Google Scholar] [CrossRef]
- Liu, R.Y.; Diao, C.F.; Zhang, Y.; Wu, N.; Wan, H.Y.; Nong, X.Y.; Liu, M.; Tang, H. miR-371-5p down-regulates pre mRNA processing factor 4 homolog B (PRPF4B) and facilitates the G1/S transition in human hepatocellular carcinoma cells. Cancer Lett. 2013, 335, 351–360. [Google Scholar] [CrossRef] [PubMed]
- Li, W.; Li, Y.; Ma, W.; Zhou, J.; Sun, Z.; Yan, X. Long noncoding RNA AC114812.8 promotes the progression of bladder cancer through miR-371b-5p/FUT4 axis. Biomed. Pharmacother. 2020, 121, 109605. [Google Scholar] [CrossRef] [PubMed]
- Li, Y.; Lv, Z.; He, G.; Wang, J.; Zhang, X.; Lu, G.; Ren, X.; Wang, F.; Zhu, X.; Ding, Y.; et al. The SOX17/miR-371-5p/SOX2 axis inhibits EMT, stem cell properties and metastasis in colorectal cancer. Oncotarget 2015, 6, 9099–9112. [Google Scholar] [CrossRef]
- Ullmann, P.; Rodriguez, F.; Schmitz, M.; Meurer, S.K.; Qureshi-Baig, K.; Felten, P.; Ginolhac, A.; Antunes, L.; Frasquilho, S.; Zügel, N.; et al. The miR-371~373 Cluster Represses Colon Cancer Initiation and Metastatic Colonization by Inhibiting the TGFBR2/ID1 Signaling Axis. Cancer Res. 2018, 78, 3793–3808. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.J.; Wang, H.F.; Liang, M.; Zou, R.C.; Tang, Z.R.; Wang, J.S. Upregulation of miR-3658 in bladder cancer and tumor progression. Genet. Mol. Res. 2016, 15, gmr15049048. [Google Scholar] [CrossRef]
- Goh, J.N.; Loo, S.Y.; Datta, A.; Siveen, K.S.; Yap, W.N.; Cai, W.; Shin, E.M.; Wang, C.; Kim, J.E.; Chan, M.; et al. microRNAs in breast cancer: Regulatory roles governing the hallmarks of cancer. Biol. Rev. Camb. Philos. Soc. 2016, 91, 409–428. [Google Scholar] [CrossRef]
- Jeczen, R.; Skomra, D.; Cybulski, M.; Schneider-Stock, R.; Szewczuk, W.; Roessner, A.; Rechberger, T.; Semczuk, A. P53/MDM2 overexpression in metastatic endometrial cancer: Correlation with clinicopathological features and patient outcome. Clin. Exp. Metastasis 2007, 24, 503–511. [Google Scholar] [CrossRef]
- Meng, X.; Franklin, D.A.; Dong, J.; Zhang, Y. MDM2-p53 pathway in hepatocellular carcinoma. Cancer Res. 2014, 74, 7161–7167. [Google Scholar] [CrossRef] [PubMed]
- Roszak, A.; Misztal, M.; Sowińska, A.; Jagodziński, P.P. Murine Double-Minute 2 Homolog Single Nucleotide Polymorphisms 285 and 309 in Cervical Carcinogenesis. Mol. Diagn. Ther. 2015, 19, 235–244. [Google Scholar] [CrossRef] [PubMed]
- Lu, X.; Yan, C.; Huang, Y.; Shi, D.; Fu, Z.; Qiu, J.; Yin, Y. Mouse double minute 2 (MDM2) upregulates Snail expression and induces epithelial-to-mesenchymal transition in breast cancer cells in vitro and in vivo. Oncotarget 2016, 7, 37177–37191. [Google Scholar] [CrossRef]
- Chen, Y.; Wang, D.D.; Wu, Y.P.; Su, D.; Zhou, T.Y.; Gai, R.H.; Fu, Y.Y.; Zheng, L.; He, Q.J.; Zhu, H.; et al. MDM2 promotes epithelial-mesenchymal transition and metastasis of ovarian cancer SKOV3 cells. Br. J. Cancer 2017, 117, 1192–1201. [Google Scholar] [CrossRef] [PubMed]
- Qiu, W.; Xia, X.; Qiu, Z.; Guo, M.; Yang, Z. RasGRP3 controls cell proliferation and migration in papillary thyroid cancer by regulating the Akt-MDM2 pathway. Gene 2017, 633, 35–41. [Google Scholar] [CrossRef]
- Liu, L.; Yang, L.; Chang, H.; Chen, Y.N.; Zhang, F.; Feng, S.; Peng, J.; Ren, C.C.; Zhang, X.A. CP-31398 attenuates endometrial cancer cell invasion, metastasis and resistance to apoptosis by downregulating MDM2 expression. Int. J. Oncol. 2019, 54, 942–954. [Google Scholar] [CrossRef]
- Carroll, P.E.; Okuda, M.; Horn, H.F.; Biddinger, P.; Stambrook, P.J.; Gleich, L.L.; Li, Y.Q.; Tarapore, P.; Fukasawa, K. Centrosome hyperamplification in human cancer: Chromosome instability induced by p53 mutation and/or Mdm2 overexpression. Oncogene 1999, 18, 1935–1944. [Google Scholar] [CrossRef]
- Friesland, S.; Kanter-Lewensohn, L.; Tell, R.; Munck-Wikland, E.; Lewensohn, R.; Nilsson, A. Expression of Ku86 confers favorable outcome of tonsillar carcinoma treated with radiotherapy. Head Neck 2003, 25, 313–321. [Google Scholar] [CrossRef]
- Valentin-Vega, Y.A.; Barboza, J.A.; Chau, G.P.; El-Naggar, A.K.; Lozano, G. High levels of the p53 inhibitor MDM4 in head and neck squamous carcinomas. Hum. Pathol. 2007, 38, 1553–1562. [Google Scholar] [CrossRef]
- Mastronikolis, N.; Ragos, V.; Fotiades, P.; Papanikolaou, V.; Kyrodimos, E.; Chrysovergis, A.; Mastronikolis, S.; Tsiambas, E. mdm2 oncogene in laryngeal squamous cell carcinoma. J. BUON 2020, 25, 594–596. [Google Scholar]
- Pichiorri, F.; Suh, S.S.; Rocci, A.; De Luca, L.; Taccioli, C.; Santhanam, R.; Zhou, W.; Benson, D.M., Jr.; Hofmainster, C.; Alder, H.; et al. Downregulation of p53-inducible microRNAs 192, 194, and 215 impairs the p53/MDM2 autoregulatory loop in multiple myeloma development. Cancer Cell 2010, 18, 367–381. [Google Scholar] [CrossRef] [PubMed]
- Giovannini, C.; Minguzzi, M.; Baglioni, M.; Fornari, F.; Giannone, F.; Ravaioli, M.; Cescon, M.; Chieco, P.; Bolondi, L.; Gramantieri, L. Suppression of p53 by Notch3 is mediated by Cyclin G1 and sustained by MDM2 and miR-221 axis in hepatocellular carcinoma. Oncotarget 2014, 5, 10607–10620. [Google Scholar] [CrossRef] [PubMed]
- Li, X.; Li, Y.; Wan, L.; Chen, R.; Chen, F. miR-509-5p inhibits cellular proliferation and migration via targeting MDM2 in pancreatic cancer cells. Oncol. Targets Ther. 2017, 10, 4455–4464. [Google Scholar] [CrossRef]
- Kim, Y.J.; Lee, J.H.; Jin, S.; Kim, J.H.; Kim, S.H. Primate-specific miR-944 activates p53-dependent tumor suppression in human colorectal cancers. Cancer Lett. 2019, 440–441, 168–179. [Google Scholar] [CrossRef] [PubMed]
- Chen, W.; Hong, L.; Hou, C.; Wang, Y.; Wang, F.; Zhang, J. MicroRNA-585 inhibits human glioma cell proliferation by directly targeting MDM2. Cancer Cell Int. 2020, 20, 469. [Google Scholar] [CrossRef]
- Sha, M.X.; Huang, X.W.; Yin, Q. MiR-548b-3p inhibits proliferation and migration of breast cancer cells by targeting MDM2. Eur. Rev. Med. Pharmacol. Sci. 2020, 24, 3105–3112. [Google Scholar]
- Wang, Y.; Zhao, J.; Zhang, C.; Wang, P.; Huang, C.; Peng, H. MiR-219a-2-3p suppresses cell proliferation and promotes apoptosis by targeting MDM2/p53 in pituitary adenomas cells. Biosci. Biotechnol. Biochem. 2020, 84, 911–918. [Google Scholar] [CrossRef]
- Weidle, U.H.; Birzele, F.; Auslaender, S.; Brinkmann, U. Down-regulated MicroRNAs in Gastric Carcinoma May Be Targets for Therapeutic Intervention and Replacement Therapy. Anticancer Res. 2021, 41, 4185–4202. [Google Scholar] [CrossRef]
- Asghariazar, V.; Kadkhodayi, M.; Mansoori, B.; Mohammadi, A.; Baradaran, B. Restoration of miR-143 reduces migration and proliferation of bladder cancer cells by regulating signaling pathways involved in EMT. Mol. Cell Probes. 2022, 61, 101794. [Google Scholar] [CrossRef]
- Mulcahy, E.Q.X.; Zhang, Y.; Colόn, R.R.; Cain, S.R.; Gibert, M.K., Jr.; Dube, C.J.; Hafner, M.; Abounader, R. MicroRNA 3928 Suppresses Glioblastoma through Downregulation of Several Oncogenes and Upregulation of p53. Int. J. Mol. Sci. 2022, 23, 3930. [Google Scholar] [CrossRef]
Parameters | Patients, n (%) |
---|---|
Age (median): 62.5 (range: 27–87 years) | |
Gender | |
Men | 38 (76) |
Women | 12 (24) |
Smoking | |
Smokers | 28 (56) |
Non-smokers | 22 (44) |
Alcohol consumption | |
Drinker | 27 (54) |
Non-drinker | 23 (46) |
Both smokers and alcohol users | 17 (34) |
HPV status | |
HPV-positive | 13 (26) |
HPV-negative | 37 (74) |
T classification | |
T1 | 10 (20) |
T2 | 23 (46) |
T3 | 16 (32) |
T4 | 1 (2) |
Nodal status | |
N0 | 24 (48) |
N1 | 2 (4) |
N2 | 20 (40) |
N3 | 4 (8) |
Histological grading | |
G1 | 9 (18) |
G2 | 23 (46) |
G3 | 18 (36) |
Patient status at 3 years | |
Alive | 12 (24) |
Dead | 38 (76) |
miRNA | Mature miRNA Sequence |
---|---|
miR-3613-3p | ACAAAAAAAAAAGCCCAACCCUUC |
miR-371b-5p | ACUCAAAAGAUGGCGGCACUUU |
miR-3658 | UUUAAGAAAACACCAUGGAGAU |
miR-361-5p (Housekeeping control) | UUAUCAGAAUCUCCAGGGGUAC |
Tumour | Margin | |
---|---|---|
Spearman’s rank correlation coefficient | ||
miR-3613-3p | ||
MDM2 gene | 0.68 | 0.49 |
p-value | ||
miR-3613-3p | ||
MDM2 gene | 0.07 | 0.11 |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Gołąbek, K.; Hudy, D.; Gaździcka, J.; Miśkiewicz-Orczyk, K.; Nowak-Chmura, M.; Asman, M.; Komosińska-Vassev, K.; Ścierski, W.; Golusiński, W.; Misiołek, M.; et al. The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma. Biomedicines 2023, 11, 3053. https://doi.org/10.3390/biomedicines11113053
Gołąbek K, Hudy D, Gaździcka J, Miśkiewicz-Orczyk K, Nowak-Chmura M, Asman M, Komosińska-Vassev K, Ścierski W, Golusiński W, Misiołek M, et al. The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma. Biomedicines. 2023; 11(11):3053. https://doi.org/10.3390/biomedicines11113053
Chicago/Turabian StyleGołąbek, Karolina, Dorota Hudy, Jadwiga Gaździcka, Katarzyna Miśkiewicz-Orczyk, Magdalena Nowak-Chmura, Marek Asman, Katarzyna Komosińska-Vassev, Wojciech Ścierski, Wojciech Golusiński, Maciej Misiołek, and et al. 2023. "The Analysis of Selected miRNAs and Target MDM2 Gene Expression in Oral Squamous Cell Carcinoma" Biomedicines 11, no. 11: 3053. https://doi.org/10.3390/biomedicines11113053