Effects of Semiconductor Laser Irradiation on Differentiation of Human Dental Pulp Stem Cells in Co-Culture with Dentin
Abstract
1. Introduction
2. Materials and Methods
2.1. Cell Culture
2.2. Laser Irradiation
2.3. Cell Proliferation Assay
2.4. Preparation of Dentin Discs
2.5. Differentiation of hDPSCs into OLCs
2.6. qRT-PCR
2.7. Statistical Analysis
3. Results
3.1. Cell Proliferation of hDPSCs with LS or LM
3.2. Gene Expression of hDPSCs Co-Cultured with Dentin Disc in BM or ODM
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Coleton, S. Lasers in surgical periodontics and oral medicine. Dent. Clin. N. Am. 2004, 48, 937–962. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alharbi, H.; Khalil, W.; Alsofi, L.; Binmadi, N.; Elnahas, A. The effect of low-level laser on the quality of dentin barrier after capping with bioceramic material: A histomorphometric analysis. Aust. Endod. J. 2023, 49, 27–37. [Google Scholar] [CrossRef] [Scilit]
- Ohshiro, T. New classification for single-system light treatment. Laser Ther. 2011, 20, 11–15. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Malthiery, E.; Chouaib, B.; Hernandez-Lopez, A.M.; Martin, M.; Gergely, C.; Torres, J.H.; Cuisinier, F.J.; Collart-Dutilleul, P.Y. Effects of green light photobiomodulation on dental pulp stem cells: Enhanced proliferation and improved wound healing by cytoskeleton reorganization and cell softening. Lasers Med. Sci. 2021, 36, 437–445. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Amid, R.; Kadkhodazadeh, M.; Gilvari Sarshari, M.; Parhizkar, A.; Mojahedi, M. Effects of two protocols of low-level laser therapy on the proliferation and differentiation of human dental pulp stem cells on sandblasted titanium discs: An in vitro study. J. Lasers Med. Sci. 2022, 13, e1. [Google Scholar] [CrossRef] [Scilit]
- Turrioni, A.P.; Basso, F.G.; Montoro, L.A.; Almeida, L.F.D.; de Souza Costa, C.A.; Hebling, J. Transdentinal photobiostimulation of stem cells from human exfoliated primary teeth. Int. Endod. J. 2017, 50, 549–559. [Google Scholar] [CrossRef] [Scilit]
- Turrioni, A.P.; Basso, F.G.; Alonso, J.R.; de Oliveira, C.F.; Hebling, J.; Bagnato, V.S.; de Souza Costa, C.A. Transdentinal cell photobiomodulation using different wavelengths. Oper. Dent. 2015, 40, 102–111. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Theocharidou, A.; Bakopoulou, A.; Kontonasaki, E.; Papachristou, E.; Hadjichristou, C.; Bousnaki, M.; Theodorou, G.; Papadopoulou, L.; Kantiranis, N.; Paraskevopoulos, K.; et al. Odontogenic differentiation and biomineralization potential of dental pulp stem cells inside Mg-based bioceramic scaffolds under low-level laser treatment. Lasers Med. Sci. 2017, 32, 201–210. [Google Scholar] [CrossRef] [Scilit]
- Staffoli, S.; Romeo, U.; Amorim, R.N.S.; Migliau, G.; Palaia, G.; Resende, L.; Polimeni, A. The effects of low level laser irradiation on proliferation of human dental pulp: A narrative review. Clin. Ter. 2017, 168, e320–e326. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Liu, C.; Wu, F. Low-level laser irradiation enhances the proliferation and osteogenic differentiation of PDLSCs via BMP signaling. Lasers Med. Sci. 2022, 37, 941–948. [Google Scholar] [CrossRef] [Scilit]
- Aleksic, V.; Aoki, A.; Iwasaki, K.; Takasaki, A.A.; Wang, C.Y.; Abiko, Y.; Ishikawa, I.; Izumi, Y. Low-level Er:YAG laser irradiation enhances osteoblast proliferation through activation of MAPK/ERK. Lasers Med. Sci. 2010, 25, 559–569. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyata, H.; Genma, T.; Ohshima, M.; Yamaguchi, Y.; Hayashi, M.; Takeichi, O.; Ogiso, B.; Otsuka, K. Mitogen-activated protein kinase/extracellular signal-regulated protein kinase activation of cultured human dental pulp cells by low-power gallium-aluminium-arsenic laser irradiation. Int. Endod. J. 2006, 39, 238–244. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jayawardena, J.A.; Kato, J.; Moriya, K.; Takagi, Y. Pulpal response to exposure with Er:YAG laser. Oral Surg. Oral Med. Oral. Pathol. Oral. Radiol. Endod. 2001, 91, 222–229. [Google Scholar] [CrossRef] [Scilit]
- Pereira, A.N.; Eduardo, P.C.D.E.; Matson, E.; Marques, M.M. Effect of low-power laser irradiation on cell growth and procollagen synthesis of cultured fibroblasts. Lasers Surg. Med. 2002, 31, 263–267. [Google Scholar] [CrossRef] [Scilit]
- Nuti, N.; Corallo, C.; Chan, B.M.; Ferrari, M.; Gerami-Naini, B. Multipotent differentiation of human dental pulp stem cells: A literature review. Stem Cell Rev. Rep. 2016, 12, 511–523. [Google Scholar] [CrossRef] [Scilit]
- Özdal-Kurt, F.; Şen, B.H.; Tuğlu, I.; Vatansever, S.; Türk, B.T.; Deliloğlu-Gürhan, I. Attachment and growth of dental pulp stem cells on dentin in presence of extra calcium. Arch. Oral Biol. 2016, 68, 131–141. [Google Scholar] [CrossRef] [Scilit]
- İslam, A.; Özverel, C.S.; Yilmaz, H.G. Comparative evaluation of low-level laser therapy on proliferation of long-term cryopreserved human dental pulp cells isolated from deciduous and permanent teeth. Lasers Med. Sci. 2021, 36, 421–427. [Google Scholar] [CrossRef] [Scilit]
- Huang, G.T.; Sonoyama, W.; Chen, J.; Park, S.H. In vitro characterization of human dental pulp cells: Various isolation methods and culturing environments. Cell Tissue Res. 2006, 324, 225–236. [Google Scholar] [CrossRef] [Scilit]
- Borzabadi-Farahani, A. Effect of low-level laser irradiation on proliferation of human dental mesenchymal stem cells; a systemic review. J. Photochem. Photobiol. B. 2016, 162, 577–582. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ahmadi, F.; Dalirsani, Z.; Tayarani-Najaran, Z.; Ebrahimzadeh-Bideskan, A.; Shafieian, R. A comparative analysis of photobiomodulation-mediated biological effects of single versus double irradiation on dental pulp stem cells: An in vitro study. Photobiomodul. Photomed. Laser Surg. 2002, 40, 334–342. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miyano, Y.; Mikami, M.; Katsuragi, H.; Shinkai, K. Effects of Sr2+, BO33−, and SiO32− on differentiation of human dental pulp stem cells into odontoblast like cells. Biol. Trace Elem. Res. 2023, 201, 5585–5600. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, M.; Zhao, L.; Hu, J.; Wang, L.; Li, N.; Wu, D.; Shi, X.; Yuan, M.; Hu, W.; Wang, X. Endothelial cells and endothelin-1 promote the odontogenic differentiation of dental pulp stem cells. Mol. Med. Rep. 2018, 18, 893–901. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shamszadeh, S.; Asgary, S.; Torabzadeh, H.; Hosseinzadeh, S.; Nosrat, A. Cytokine co-stimulation effect on odontogenic differentiation of stem cells. Clin. Oral Investig. 2022, 26, 4789–4796. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fujita, S.; Hideshima, K.; Ikeda, T. Nestin expression in odontoblasts and odontogenic ectomesenchymal tissue of odontogenic tumours. J. Clin. Pathol. 2006, 59, 240–245. [Google Scholar] [CrossRef] [Scilit]
- About, I.; Laurent-Maquin, D.; Lendahl, U.; Mitsiadis, T.A. Nestin expression in embryonic and adult human teeth under normal and pathological conditions. Am. J. Pathol. 2000, 157, 287–295. [Google Scholar] [CrossRef] [Scilit]
- Loo, D.T.; Althoen, M.C.; Cotman, C.W. Down regulation of nestin by TGF-β or serum in SFME cells accompanies differentiation into astrocytes. Neuroreport 1994, 5, 1585–1588. [Google Scholar] [CrossRef] [Scilit]
- Yamakawa, S.; Niwa, T.; Karakida, T.; Kobayashi, K.; Yamamoto, R.; Chiba, R.; Yamakoshi, Y.; Hosoya, N. Effects of Er:YAG and diode laser irradiation on dental pulp cells and tissues. Int. J. Mol. Sci. 2018, 19, 2429. [Google Scholar] [CrossRef] [Scilit]
- Li, Y.; Lü, X.; Sun, X.; Bai, S.; Li, S.; Shi, J. Odontoblast-like cell differentiation and dentin formation induced with TGF-β1. Arch. Oral Biol. 2011, 56, 1221–1229. [Google Scholar] [CrossRef] [Scilit]
- Zhou, K.; Liu, Q.; Yu, X.; Zeng, X. Laser therapy versus topical desensitising agents in the management of dentine hypersensitivity: A meta-analysis. Oral Dis. 2021, 27, 422–430. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pion, L.A.; Matos, L.L.M.; Gimenez, T.; Palma-Dibb, R.G.; Faraoni, J.J. Treatment outcome for dentin hypersensitivity with laser therapy: Systematic review and meta-analysis. Dent. Med. Probl. 2023, 60, 153–166. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alencar, C.D.; Ortiz, M.I.; Silva, F.A.; Alves, E.B.; Araújo, J.L.; Silva, C.M. Effect of nanohydroxyapatite associated with photobiomodulation in the control of dentin hypersensitivity: A randomized, double-blind, placebo-controlled clinical trial. Am. J. Dent. 2020, 33, 138–144. [Google Scholar] [PubMed]
- Machado, A.C.; Viana, Í.E.L.; Farias-Neto, A.M.; Braga, M.M.; de Paula Eduardo, C.; de Freitas, P.M.; Aranha, A.C.C. Is photobiomodulation (PBM) effective for the treatment of dentin hypersensitivity? A systematic review. Lasers Med. Sci. 2018, 33, 745–753. [Google Scholar] [CrossRef] [Scilit] [PubMed]








| LS | LM | |||||||
|---|---|---|---|---|---|---|---|---|
| WL | 10 mW | 30 mW | 150 mW | WL | 10 mW | 30 mW | 150 mW | |
| 6 h after seeding | − | + | + | + | − | + | + | + |
| 4 day after seeding | − | − | − | − | − | + | + | + |
| 8 day after seeding | − | − | − | − | − | + | + | + |
| 12 day after seeding | − | − | − | − | − | + | + | + |
| Group | Laser Irradiation | BM | ODM | Dentin Discs |
|---|---|---|---|---|
| D | + | + | − | + |
| O | + | − | + | − |
| OD | + | − | + | + |
| C | + | + | − | − |
| Gene | Nucleotide Sequence | Amplicon Size (bp) |
|---|---|---|
| DSPP | F: GGGCAAAGGCAATGTCAAGA | 160 |
| R: TCCTTGCATGGACTTATCATCAA | ||
| DMP-1 | F: CAAGACAGAGAGCTATGAACACGATAT | 115 |
| R: TGCAACCTTCCAACTCCAATG | ||
| Nestin | F: CAGGGGCAGACATCATTGGT | 77 |
| R: CACTCCCCCATTCACATGCT | ||
| ALP | F: CCGTCTGTGACCCATCTCATG | 110 |
| R: AGGGCAGCCTCTGTCATCTC | ||
| GAPDH | F: GACAGTCAGCCGCATCTTCT | 104 |
| R: GCGCCCAATACGACCAAATC |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Yarita, M.; Kitajima, K.; Morita, T.; Shinkai, K. Effects of Semiconductor Laser Irradiation on Differentiation of Human Dental Pulp Stem Cells in Co-Culture with Dentin. Dent. J. 2024, 12, 67. https://doi.org/10.3390/dj12030067
Yarita M, Kitajima K, Morita T, Shinkai K. Effects of Semiconductor Laser Irradiation on Differentiation of Human Dental Pulp Stem Cells in Co-Culture with Dentin. Dentistry Journal. 2024; 12(3):67. https://doi.org/10.3390/dj12030067
Chicago/Turabian StyleYarita, Masafumi, Kayoko Kitajima, Takao Morita, and Koichi Shinkai. 2024. "Effects of Semiconductor Laser Irradiation on Differentiation of Human Dental Pulp Stem Cells in Co-Culture with Dentin" Dentistry Journal 12, no. 3: 67. https://doi.org/10.3390/dj12030067
APA StyleYarita, M., Kitajima, K., Morita, T., & Shinkai, K. (2024). Effects of Semiconductor Laser Irradiation on Differentiation of Human Dental Pulp Stem Cells in Co-Culture with Dentin. Dentistry Journal, 12(3), 67. https://doi.org/10.3390/dj12030067

