cor1 Gene: A Suitable Marker for Identification of Opium Poppy (Papaver somniferum L.)
Abstract
1. Introduction
2. Materials and Methods
2.1. Samples
2.2. Model Samples
2.3. DNA Isolation
2.4. In Silico Analysis of Actin and cor Genes
2.5. Primers and Probes
| Marker | Oligonucleotide † | Sequence (5′-3′) | Size [bp] | Reference |
|---|---|---|---|---|
| COR1 | COR1_F | CCTTGTATAAATATCCCCGGA | 207 | This work |
| COR1_R | TCTGATTATGCCCTTATTCAAC | |||
| COR1_P | FAM-AGTTGTTTCCATTTTTGGAGT CAAGTTGAGACA-BHQ-1 | |||
| Actin | Act-L_F | CAAGCAGCATGAAGATCAAGGT | ~103 | [29,30] |
| Act-L_R | CACATCTGTTGGAAAGTGCTGAG | |||
| Act-L_P | HEX-CCTCCAATCCAGACACTGTA CTTYCTCTC-BHQ-1 | |||
| Actin-Z_F | CCCTGGAATTGCTGATAGGATGA | 150 ‡ | This work | |
| Actin-Z_P | HEX-ATCACAGCTCTTGCACCAAGCAG CATGAAG-BHQ-1 | |||
| Myostatin | MY_F | TTGTGCAAATCCTGAGACTCAT | 97 | [31] |
| MY_R | ATACCAGTGCCTGGGTTCAT |
2.6. End-Point PCR
2.7. Quantitative Real-Time PCR (qPCR)
2.8. Droplet Digital PCR (ddPCR)
2.9. Multiplex PCR
2.10. Validation of Designed PCR Assays
2.10.1. Specificity
2.10.2. Sensitivity
3. Results
3.1. Actin Gene as a Reference Marker and Control of DNA Amplification
3.2. cor Gene as a Marker for P. somniferum Discrimination
3.3. Comparison of Three PCR Types
3.4. Multiplexing of the PCR Assays
3.5. Analysis of Heat-Treated Seeds and Real Food Samples
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Labanca, F.; Ovesna, J.; Milella, L. Papaver somniferum L. taxonomy, uses and new insight in poppy alkaloid pathways. Phytochem. Rev. 2018, 17, 853–871. [Google Scholar] [CrossRef] [Scilit]
- Emir, D.D.; Aydeniz, B.; Yilmaz, E. Effects of roasting and enzyme pretreatments on yield and quality of cold-pressed poppy seed oils. Turk. J. Agric. For. 2015, 39, 260–271. [Google Scholar] [CrossRef] [Scilit]
- Azcan, N.; Kalender, B.O.; Kara, M. Investigation of Turkish poppy seeds and seed oils. Chem. Nat. Compd. 2004, 40, 370–372. [Google Scholar] [CrossRef] [Scilit]
- Nergiz, C.; Ötles, S. The proximate composition and some minor constituents of poppy seeds. J. Sci. Food Agric. 1994, 66, 117–120. [Google Scholar] [CrossRef] [Scilit]
- Lančaričová, A.; Havrlentová, M.; Muchová, D.; Bednárová, A. Oil content and fatty acids composition of poppy seeds cultivated in two localities of Slovakia. Agric. Pol’nohospodárstvo 2016, 62, 19–27. [Google Scholar] [CrossRef] [Scilit]
- Luthra, R.; Singh, N. Changes in fatty acid composition accompanying the deposition of triacylglycerols in developing seeds of opium poppy (Papaver somniferum L.). Plant Sci. 1989, 60, 55–60. [Google Scholar] [CrossRef] [Scilit]
- Bozan, B.; Temelli, F. Chemical composition and oxidative stability of flax, safflower and poppy seed and seed oils. Bioresour. Technol. 2008, 99, 6354–6359. [Google Scholar] [CrossRef] [Scilit]
- FAO. Food and Agriculture Data. 2019. Available online: https://www.fao.org/faostat/en/#data (accessed on 21 October 2022).
- EFSA Panel on Contaminants in the Food Chain (CONTAM); Knutsen, H.K.; Alexander, J.; Barregård, L.; Bignami, M.; Brüschweiler, B.; Ceccatelli, S.; Cottrill, B.; Dinovi, M.; Edler, L. Update of the scientific opinion on opium alkaloids in poppy seeds. EFSA J. 2018, 16, e05243. [Google Scholar]
- López-Calleja, I.M.; de la Cruz, S.; González, I.; García, T.; Martín, R. Duplex real-time PCR using TaqMan® for the detection of sunflower (Helianthus annuus) and poppy (Papaver rhoeas) in commercial food products. LWT-Food Sci. Technol. 2016, 65, 999–1007. [Google Scholar] [CrossRef] [Scilit]
- Gevenkiriş, A. Determination of Morphine and Total Phenolic Content in Poppy Seed of Turkish Origin. Master’s Thesis, Middle East Technical University, Ankara, Turkey, 2011. [Google Scholar]
- European Union. Recommendation (2014/662/UE) of 10 September 2014 on Good Practices to Prevent and to Reduce the Presence of Opium Alkaloids in Poppy Seeds and Poppy Seed Products; OJ L 271 of 12 September 2014; Official Journal of the European Union: Brussels, Belgium, 2014; pp. 96–100. [Google Scholar]
- Sasikumar, B.; Swetha, V.; Parvathy, V.; Sheeja, T. Advances in adulteration and authenticity testing of herbs and spices. In Advances in Food Authenticity Testing; Elsevier: Amsterdam, The Netherlands, 2016; pp. 585–624. [Google Scholar]
- Krist, S.; Stuebiger, G.; Bail, S.; Unterweger, H. Detection of adulteration of poppy seed oil with sunflower oil based on volatiles and triacylglycerol composition. J. Agric. Food Chem. 2006, 54, 6385–6389. [Google Scholar] [CrossRef] [Scilit]
- Avula, B.; Katragunta, K.; Adams, S.J.; Wang, Y.-H.; Chittiboyina, A.G.; Khan, I.A. Applicability of LC-QToF and Microscopical Tools in Combating the Sophisticated, Economically Motivated Adulteration of Poppy Seeds. Foods 2023, 12, 1510. [Google Scholar] [CrossRef] [Scilit]
- Singhal, R.S.; Kulkarni, P. Detection of Adultration of the Spice Poppy Seeds (Papaver somniferum) With Amaranthus paniculatas (Rajgeera) Seeds. J. Food Qual. 1990, 13, 375–381. [Google Scholar] [CrossRef] [Scilit]
- Celik, I.; Gultekin, V.; Allmer, J.; Doganlar, S.; Frary, A. Development of genomic simple sequence repeat markers in opium poppy by next-generation sequencing. Mol. Breed. 2014, 34, 323–334. [Google Scholar] [CrossRef] [Scilit]
- Celik, I.; Camci, H.; Kose, A.; Kosar, F.C.; Doganlar, S.; Frary, A. Molecular genetic diversity and association mapping of morphine content and agronomic traits in Turkish opium poppy (Papaver somniferum) germplasm. Mol. Breed. 2016, 36, 46. [Google Scholar] [CrossRef] [Scilit]
- Hosokawa, K.; Shibata, T.; Nakamura, I.; Hishida, A. Discrimination among species of Papaver based on the plastid rpl16 gene and the rpl16-rpl14 spacer sequence. Forensic Sci. Int. 2004, 139, 195–199. [Google Scholar] [CrossRef] [Scilit]
- Masárová, V.; Mihálik, D.; Kraic, J. In silico retrieving of opium poppy (Papaver somniferum L.) microsatellites. Agric. Pol’nohospodárstvo 2015, 61, 149–156. [Google Scholar] [CrossRef] [Scilit]
- Saunders, J.A.; Pedroni, M.J.; Penrose, L.D.; Fist, A.J. AFLP analysis of opium poppy. Crop Sci. 2001, 41, 1596–1601. [Google Scholar] [CrossRef] [Scilit]
- Unterlinner, B.; Lenz, R.; Kutchan, T.M. Molecular cloning and functional expression of codeinone reductase: The penultimate enzyme in morphine biosynthesis in the opium poppy Papaver somniferum. Plant J. 1999, 18, 465–475. [Google Scholar] [CrossRef] [Scilit]
- Hosseini, B.; Shahriari-Ahmadi, F.; Hashemi, H.; Marashi, M.-H.; Mohseniazar, M.; Farokhzad, A.; Sabokbari, M. Transient Expression of cor Gene in Papaver somniferum. BioImpacts BI 2011, 1, 229. [Google Scholar]
- Guo, L.; Winzer, T.; Yang, X.; Li, Y.; Ning, Z.; He, Z.; Teodor, R.; Lu, Y.; Bowser, T.A.; Graham, I.A. The opium poppy genome and morphinan production. Science 2018, 362, 343–347. [Google Scholar] [CrossRef] [Scilit]
- Li, Q.; Ramasamy, S.; Singh, P.; Hagel, J.M.; Dunemann, S.M.; Chen, X.; Chen, R.; Yu, L.; Tucker, J.E.; Facchini, P.J. Gene clustering and copy number variation in alkaloid metabolic pathways of opium poppy. Nat. Commun. 2020, 11, 1190. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- ISO 21570:2005; Foodstuffs—Methods of Analysis for the Detection of Genetically Modified Organisms and Derived Products—Quantitative Nucleic Acid Based Methods. International Organization for Standardization: Geneva, Switzerland, 2005.
- Hougs, L.; Gatto, F.; Goerlich, O.; Grohmann, L.; Lieske, K.; Mazzara, M.; Narendja, F.; Ovesna, J.; Papazova, N.; Scholtens, I. Verification of analytical methods for GMO testing when implementing interlaboratory validated methods. In Testing and Analysis of GMO-containing Foods and Feed; CRC Press: Boca Raton, FL, UAS, 2017; pp. 245–266. [Google Scholar] [CrossRef]
- Tamura, K.; Stecher, G.; Kumar, S. MEGA11: Molecular evolutionary genetics analysis version 11. Mol. Biol. Evol. 2021, 38, 3022–3027. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laube, I.; Hird, H.; Brodmann, P.; Ullmann, S.; Schöne-Michling, M.; Chisholm, J.; Broll, H. Development of primer and probe sets for the detection of plant species in honey. Food Chem. 2010, 118, 979–986. [Google Scholar] [CrossRef] [Scilit]
- Taberlet, P.; Gielly, L.; Pautou, G.; Bouvet, J. Universal primers for amplification of three non-coding regions of chloroplast DNA. Plant Mol. Biol. 1991, 17, 1105–1109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Laube, I.; Spiegelberg, A.; Butschke, A.; Zagon, J.; Schauzu, M.; Kroh, L.; Broll, H. Methods for the detection of beef and pork in foods using real-time polymerase chain reaction. Int. J. Food Sci. Technol. 2003, 38, 111–118. [Google Scholar] [CrossRef] [Scilit]
- FAO. Guidelines on Performance Criteria and Validation of Methods for Detection, Identification and Quantification of Specific DNA Sequences and Specific Proteins in Foods. CAC/GL 74-2010. 2010. p. 22. Available online: https://www.fao.org/fileadmin/user_upload/gmfp/resources/CXG_074e.pdf (accessed on 21 October 2022).
- Jacchia, S.; Kagkli, D.-M.; Lievens, A.; Angers-Loustau, A.; Savini, C.; Emons, H.; Mazzara, M. Identification of single target taxon-specific reference assays for the most commonly genetically transformed crops using digital droplet PCR. Food Control 2018, 93, 191–200. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Z.; Schwartz, S.; Wagner, L.; Miller, W. A greedy algorithm for aligning DNA sequences. J. Comput. Biol. 2000, 7, 203–214. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Dingle, T.C.; Sedlak, R.H.; Cook, L.; Jerome, K.R. Tolerance of Droplet-Digital PCR vs Real-Time Quantitative PCR to Inhibitory Substances. Clin. Chem. 2013, 59, 1670–1672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jones, M.; Williams, J.; Gärtner, K.; Phillips, R.; Hurst, J.; Frater, J. Low copy target detection by Droplet Digital PCR through application of a novel open access bioinformatic pipeline, ‘definetherain’. J. Virol. Methods 2014, 202, 46–53. [Google Scholar] [CrossRef] [Scilit]
- Bernardo, G.D.; Gaudio, S.D.; Galderisi, U.; Cascino, A.; Cipollaro, M. Comparative evaluation of different DNA extraction procedures from food samples. Biotechnol. Prog. 2007, 23, 297–301. [Google Scholar] [CrossRef] [Scilit]
- Kaňuková, Š.; Mrkvová, M.; Mihálik, D.; Kraic, J. Procedures for DNA extraction from opium poppy (Papaver somniferum L.) and poppy seed-containing products. Foods 2020, 9, 1429. [Google Scholar] [CrossRef] [Scilit]
- Čermáková, E.; Zdeňková, K.; Demnerová, K.; Ovesná, J. Comparison of methods to extract PCR-amplifiable DNA from fruit, herbal and black teas. Czech J. Food Sci. 2021, 39, 410–417. [Google Scholar] [CrossRef] [Scilit]
- Debode, F.; Zdeòková, K.; Janssen, E.; Tizolova, A.; du Jardin, P.; Berben, G.; Demnerova, K. Development of real-time PCR assays for the detection of the pin II terminator (tpinII) used in GM constructs and its donor organism, potato (Solanum tuberosum). Food Anal. Methods 2018, 11, 2172–2180. [Google Scholar] [CrossRef] [Scilit]
- Pietsch, K.; Waiblinger, H.; Brodmann, P.; Wurz, A. Screeningverfahren zur identifizierung gentechnisch veränderter pflanzlicher lebensmittel. Dtsch. Lebensm.-Rundsch. 1997, 93, 35–38. [Google Scholar]
- Sovová, T.; Křížová, B.; Ovesná, J. Determining the optimal method for DNA isolation from fruit jams. Czech J. Food Sci. 2018, 36, 126–132. [Google Scholar] [CrossRef] [Scilit]
- Ghitarrini, S.; Pierboni, E.; Rondini, C.; Tedeschini, E.; Tovo, G.R.; Frenguelli, G.; Albertini, E. New biomolecular tools for aerobiological monitoring: Identification of major allergenic Poaceae species through fast real-time PCR. Ecol. Evol. 2018, 8, 3996–4010. [Google Scholar] [CrossRef] [Scilit]
- Waiblinger, H.-U.; Ohmenhaeuser, M.; Meissner, S.; Schillinger, M.; Pietsch, K.; Goerlich, O.; Mankertz, J.; Lieske, K.; Broll, H. In-house and interlaboratory validation of a method for the extraction of DNA from pollen in honey. J. Verbraucherschutz Und Leb. 2012, 7, 243–254. [Google Scholar] [CrossRef] [Scilit]
- Lee, E.J.; Hwang, I.K.; Kim, N.Y.; Lee, K.L.; Han, M.S.; Lee, Y.H.; Kim, M.Y.; Yang, M.S. An assessment of the utility of universal and specific genetic markers for opium poppy identification. J. Forensic Sci. 2010, 55, 1202–1208. [Google Scholar] [CrossRef] [Scilit]
- Choe, S.; Lee, E.; Jin, G.-n.; Lee, Y.H.; Kim, S.Y.; Choi, H.; Chung, H.; Hwang, B.Y.; Kim, S. Genetic and chemical components analysis of Papaver setigerum naturalized in Korea. Forensic Sci. Int. 2012, 222, 387–393. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vašek, J.; Čílová, D.; Melounová, M.; Svoboda, P.; Zdeňková, K.; Čermáková, E.; Ovesná, J. OpiumPlex is a novel microsatellite system for profiling opium poppy (Papaver somniferum L.). Sci. Rep. 2021, 11, 12799. [Google Scholar] [CrossRef] [Scilit]
- Vašek, J.; Čílová, D.; Melounová, M.; Svoboda, P.; Vejl, P.; Štikarová, R.; Vostrý, L.; Kuchtová, P.; Ovesná, J. New EST-SSR markers for individual genotyping of opium poppy cultivars (Papaver somniferum L.). Plants 2019, 9, 10. [Google Scholar] [CrossRef] [Scilit]
- Svoboda, P.; Vašek, J.; Vejl, P.; Ovesná, J. Genetic features of Czech blue poppy (Papaver somniferum L.) revealed by DNA polymorphism. Czech J. Food Sci. 2020, 38, 198–202. [Google Scholar] [CrossRef] [Scilit]
- Ren, J.; Deng, T.; Huang, W.; Chen, Y.; Ge, Y. A digital PCR method for identifying and quantifying adulteration of meat species in raw and processed food. PLoS ONE 2017, 12, e0173567. [Google Scholar] [CrossRef] [Scilit]
- Cottenet, G.; Blancpain, C.; Chuah, P.F. Performance assessment of digital PCR for the quantification of GM-maize and GM-soya events. Anal. Bioanal. Chem. 2019, 411, 2461–2469. [Google Scholar] [CrossRef] [Scilit]
- Cai, Y.; He, Y.; Lv, R.; Chen, H.; Wang, Q.; Pan, L. Detection and quantification of beef and pork materials in meat products by duplex droplet digital PCR. PLoS ONE 2017, 12, e0181949. [Google Scholar] [CrossRef] [Scilit]
- Bucher, T.B.; Köppel, R. Duplex digital droplet PCR for the determination of non-Basmati rice in Basmati rice (Oryza sativa) on the base of a deletion in the fragrant gene. Eur. Food Res. Technol. 2016, 242, 927–934. [Google Scholar] [CrossRef] [Scilit]



| Family | Genus | Species | Common Name | Source |
|---|---|---|---|---|
| Papaveraceae | Argemone | A. mexicana | Mexican poppy | Seeds, leaves |
| Papaver | P. bracteatum | Iranian poppy, Persian poppy | Leaves | |
| P. commutatum | Caucasian scarlet poppy | Leaves | ||
| P. glaucum | Tulip poppy | Seeds, leaves | ||
| P. nudicaule | Iceland poppy | Seeds, leaves | ||
| P. orientale | Oriental poppy | Seeds, leaves | ||
| P. rhoeas | Common poppy | Seeds, leaves | ||
| P. somniferum | Opium poppy | Seeds, leaves, stems, poppyheads | ||
| Amaranthaceae | Amaranthus | (not specified) | Amaranth | Seeds |
| Asteraceae | Helianthus | H. annuus | Sunflower | Seeds |
| Brassicaceae | Brassica | B. napus | Rape | Leaves |
| Sinapsis | S. alba | White mustard | Leaves | |
| Fabaceae | Glycine | G. max | Soya-bean | Leaves |
| Medicago | M. sativa | Alfalfa | Seeds, leaves | |
| Linaceae | Linum | L. usitatissimum | Common flax | Seeds |
| Poaceae | Avena | A. sativa | Common oat | Grain, leaves |
| Hordeum | H. vulgare | Six-rowed barley | Grain, leaves | |
| Oryza | O. sativa | Burgundy rice | Leaves | |
| Secale | S. cereale | Cereal rye | Grain, leaves | |
| Sorghum | S. bicolor | Great Millet, Sorghum | Seeds, leaves | |
| Triticum | T. aestivum | Bread wheat | Grain, leaves | |
| Zea | Z. mays | Maize | Grain, leaves | |
| Solanaceae | Capsicum | C. annuum | Sweet Pepper | Leaves, pod |
| Solanum | S. tuberosum | Potato | Tissue | |
| S. lycopersicum | Tomato | Leaves | ||
| Bovidae | Bos | B. taurus | Cattle | Tissue |
| Equidae | Equus | E. caballus | Horse | Tissue |
| Phasianidae | Gallus | G. gallus | Chicken | Tissue |
| Suidae | Sus | S. scrofa | Pig | Tissue |
| Treatment Conditions | Type of Treatment | Poppy Seeds | |
|---|---|---|---|
| 80 °C, 30 min | Baking | Whole | |
| Ground | |||
| 100 °C, 2 min | Cooking | in water | Ground |
| in milk with the addition of sugar | |||
| 180 °C, 30 min | Baking | Seeds after cooking in water | |
| Seeds after cooking in milk | |||
| Ground (without previous cooking) | |||
| Whole (without previous cooking) | |||
| Dried at room temperature; without heat treatment | Ground | ||
| Group | Sample | DNA Amplification Control † | Amplification of cor Gene ‡ | |||
|---|---|---|---|---|---|---|
| PCR (All Tested Platforms) | PCR | qPCR (EvaGreen/Probe) | ddPCR (Probe) | |||
| Papaveraceae | Opium poppy | Aplaus | + | + | + | + |
| Bergamon | + | + | + | + | ||
| Buddha | + | + | + | + | ||
| Major | + | + | + | + | ||
| Maraton | + | + | + | + | ||
| Opal | + | + | + | + | ||
| Opex | + | + | + | + | ||
| Peony | + | + | + | + | ||
| Postomi | + | + | + | + | ||
| Caucasian scarlet poppy | + | − | − | − | ||
| Common poppy | + | − | − | − | ||
| Iceland poppy | + | − | − | − | ||
| Iranian or Persian Poppy | + | − | − | − | ||
| Mexican Poppy | + | − | − | − | ||
| Oriental Poppy | + | − | − | − | ||
| Tulip poppy | + | − | − | − | ||
| Other plant species | Alfalfa | + | − | − | − | |
| Amaranth | + | − | − | − | ||
| Barley | + | − | − | −/+ | ||
| Flax | + | − | − | − | ||
| Maize | + | − | − | − | ||
| Mustard | + | − | +/− | −/+ | ||
| Oat | + | − | − | − | ||
| Oilseed rape | + | − | − | − | ||
| Pepper | + | − | +/− | − | ||
| Potato | + | − | +/− | − | ||
| Rice | + | − | − | − | ||
| Rye | + | − | − | − | ||
| Sorghum | + | − | − | − | ||
| Soya | + | − | − | |||
| Sunflower | + | − | − | − | ||
| Tomato | + | − | − | − | ||
| Wheat | + | − | +/− | − | ||
| Animal species | Cattle | + | − | − | − | |
| Horse | + | − | N | − | ||
| Chicken | + | − | − | − | ||
| Pig | + | − | − | − | ||
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Čermáková, E.; Svoboda, P.; Ovesná, J.; Vašek, J.; Demnerová, K.; Zdeňková, K. cor1 Gene: A Suitable Marker for Identification of Opium Poppy (Papaver somniferum L.). Foods 2024, 13, 1432. https://doi.org/10.3390/foods13101432
Čermáková E, Svoboda P, Ovesná J, Vašek J, Demnerová K, Zdeňková K. cor1 Gene: A Suitable Marker for Identification of Opium Poppy (Papaver somniferum L.). Foods. 2024; 13(10):1432. https://doi.org/10.3390/foods13101432
Chicago/Turabian StyleČermáková, Eliška, Pavel Svoboda, Jaroslava Ovesná, Jakub Vašek, Kateřina Demnerová, and Kamila Zdeňková. 2024. "cor1 Gene: A Suitable Marker for Identification of Opium Poppy (Papaver somniferum L.)" Foods 13, no. 10: 1432. https://doi.org/10.3390/foods13101432
APA StyleČermáková, E., Svoboda, P., Ovesná, J., Vašek, J., Demnerová, K., & Zdeňková, K. (2024). cor1 Gene: A Suitable Marker for Identification of Opium Poppy (Papaver somniferum L.). Foods, 13(10), 1432. https://doi.org/10.3390/foods13101432

