Microbiological Assessment of Dairy Products Produced by Small-Scale Dairy Producers in Serbia
Abstract
1. Introduction
2. Materials and Methods
2.1. Sample Collection
2.2. Microbiological Analysis
2.3. Serotyping of L. monocytogenes Isolates
| Target | Primer Sequence | Product Size (bp) | Serogroups |
|---|---|---|---|
| prs | F: GCTGAAGAGATTGCGAAAGAAG | 370 | Listeria spp. |
| R: CAAAGAAACCTTGGATTTGCGG | |||
| lmo0737 | F: AGG GCT TCA AGG ACT TAC CC | 691 | L. monocytogenes 1/2a, 1/2c, 3a, and 3c |
| R: ACG ATT TCT GCT TGC CAT TC | |||
| lmo1118 | F: AGG GGT CTT AAA TCC TGG AA | 906 | L. monocytogenes 1/2c and 3c |
| R: CGG CTT GTT CGG CAT ACT TA | |||
| orf2819 | F: AGC AAA ATG CCA AAA CTC GT | 471 | L. monocytogenes 1/2b, 3b, 4b, 4d, and 4e |
| R: CAT CAC TAA AGC CTC CCA TTG | |||
| orf2110 | F: AGT GGA CAA TTG ATT GGT GAA | 597 | L. monocytogenes 4b, 4d, and 4e |
| R: CAT CCA TCC CTT ACT TTG GAC |
2.4. Antimicrobial Resistance Screening of L. monocytogenes Isolates
2.5. Data Analysis
3. Results and Discussion
3.1. The Presence of Pathogens in Dairy Products
3.2. Serogroups of L. monocytogenes Isolates
3.3. Antimicrobial Resistance of L. monocytogenes Isolates
3.4. Hygiene and Spoilage Indicator Assessment in Dairy Products
3.4.1. Coagulase-Positive Staphylococci (CPS) in Dairy Products
3.4.2. E. coli in Dairy Products
3.4.3. Yeasts and Moulds in Dairy Products
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Terzić-Vidojević, A.; Veljović, K.; Tolinački, M.; Živković, M.; Lukić, J.; Lozo, J.; Fira, Đ.; Jovčić, B.; Strahinić, I.; Begović, J.; et al. Diversity of non-starter lactic acid bacteria in autochthonous dairy products from western balkan countries—Technological and probiotic properties. Food Res. Int. 2020, 136, 109494. [Google Scholar] [CrossRef] [Scilit]
- Savić-Radovanović, R.; Zdravković, N.; Velebit, B. Occurrence and characterization of enterotoxigenic staphylococci isolated from soft cheeses in Serbia. Acta Vet. Brno 2020, 70, 238–254. [Google Scholar] [CrossRef] [Scilit]
- Aleksic, B.; Djekic, I.; Miocinovic, J.; Miloradovic, Z.; Savic, R.; Zdravkovic, N.; Smigic, N. The Hygienic assessment of dairy products ’ selling places at open markets. Food Control 2023, 148, 109628. [Google Scholar] [CrossRef] [Scilit]
- Vlahovic, B.; Mugosa, I.; Puskraic, A.; Uzar, D. Improvemnt of Cheese Production and Distribution; Faculty of Agriculutre: Novi Sad, Serbia, 2018. (In Serbian) [Google Scholar]
- Radulović, Z.; Miočinović, J.; Pudja, P.; Barać, M.; Miloradović, Z.; Paunović, D.; Obradović, D. The application of autochthonous lactic acid bacteria in white brined cheese production. Mljekarstvo 2011, 61, 15–25. [Google Scholar]
- Popović Vranješ, A.; Krstović, S.; Kasalica, A.; Jurakić, Ž.; Štrbac, L.; Strugar, K.; Šaran, M. Quality of milk for cheese production on registered agricultural holdings in Vojvodina. Contemp. Agric. 2017, 66, 32–37. [Google Scholar] [CrossRef] [Scilit]
- Šuranská, H.; Raspor, P.; Uroić, K.; Golić, N.; Kos, B.; Mihajlović, S.; Begović, J.; Šušković, J.; Topisirović, L.; Čadež, N. Characterisation of the yeast and mould biota in traditional white pickled cheeses by culture-dependent and independent molecular techniques. Folia Microbiol. 2016, 61, 455–463. [Google Scholar] [CrossRef] [Scilit]
- Mladenović, K.; Muruzović, M.; Žugić Petrović, T.; Čomić, L. Escherichia coli identification and isolation from traditional cheese produced in southeastern Serbia. J. Food Saf. 2018, 38, e12477. [Google Scholar] [CrossRef] [Scilit]
- Bulajic, S.; Ledina, T.; Djordjevic, J.; Boskovic, M.; Matovic, V.; Markovic, R.; Baltic, M.Z. Biopreservation of traditional raw milk cheeses with an emphasis on Serbian artisanal cheeses and their historical production. Meat Technol. 2017, 58, 52–61. [Google Scholar]
- Pudja, P.; Djerovski, J.; Radovanović, M. An autochthonous Serbian product—Kajmak characteristics and production procedures. Dairy Sci. Technol. 2008, 88, 163–172. [Google Scholar] [CrossRef] [Scilit]
- Mikulec, D.P.; Tambur, Z.; Radaković, S.; Mileusnić, I.; Jevremović, D. Rate of potentially pathogenic bacteria in fresh soft. Int. J. Res. Rev. Appl. Sci. 2012, 12, 247–251. [Google Scholar]
- Radin, D.; Djerovski, J.; Radulovic, Z.; Radovanovic, M.; Pudja, P. Maturation of Kajmak Under Controlled Conditions; FAO: Rome, Italy, 2006; pp. 60–65. [Google Scholar]
- Schirmer, B.C.T.; Heir, E.; Møretrø, T.; Skaar, I.; Langsrud, S. Microbial background flora in small-scale cheese production facilities does not inhibit growth and surface attachment of Listeria monocytogenes. J. Dairy Sci. 2013, 96, 6161–6171. [Google Scholar] [CrossRef] [Scilit]
- Bintsis, T.; Papademas, P. Microbiological quality of white-brined cheeses: A review. Int. J. Dairy Technol 2002, 55, 113–120. [Google Scholar] [CrossRef] [Scilit]
- Grace, D.; Wu, F.; Havelaar, A.H. MILK Symposium review: Foodborne diseases from milk and milk products in developing countries—Review of causes and health and economic implications. J. Dairy Sci. 2020, 103, 9715–9729. [Google Scholar] [CrossRef] [Scilit]
- Ledenbach, L.H.; Marshall, R.T. Compendium of the microbiological spoilage of foods and beverages. In Compendium of the Microbiological Spoilage of Foods and Beverages; Springer Science and Business Media LLC: Dordrecht, The Netherlands, 2009. [Google Scholar] [CrossRef] [Scilit]
- Cakmakci, S.; Hayaloglu, A.A. Evaluation of the chemical, microbiological and volatile aroma characteristics of ispir kaymak, a traditional Turkish dairy product. Int. J. Dairy Technol. 2011, 64, 444–450. [Google Scholar] [CrossRef] [Scilit]
- Fonseca, G.F.; Helena, A.A.S.; Oliveira, J.T.M.; Martins, J.S.A.; Mangiavacchi, B.M.; Norverg, R.B.M.N.; Norber, A.N. Occurrence of Escherichia coli and Staphylococcus aureus in artisanal minas fresh cheeses produced in the rural area of the Baixada Fluminense region, province of Rio de Janeiro, Brazil. World J. Phamarcy Pharm. Sci. 2020, 9, 492–503. [Google Scholar] [CrossRef]
- Fox, P.F.; Guinee, T.P.; Cogan, T.M.; McSweeney, P.L.H. Fundamentals of Cheese Science, 2nd ed.; Springer: Berlin/Heidelberg, Germany, 2016; pp. 1–799. [Google Scholar] [CrossRef] [Scilit]
- Gould, L.H.; Mungai, E.; Barton Behravesh, C. Outbreaks attributed to cheese: Differences between outbreaks caused by unpasteurized and pasteurized dairy products, United States, 1998–2011. Foodborne Pathog. Dis. 2014, 11, 545–551. [Google Scholar] [CrossRef] [Scilit]
- Cummings, P.L.; Sorvillo, F.; Kuo, T. The Burden of Salmonellosis in the United States; Intechopen: London, UK, 2012. [Google Scholar]
- Choi, K.H.; Lee, H.; Lee, S.; Kim, S.; Yoon, Y. Cheese microbial risk assessments—A review. Asian-Australas J. Anim. Sci. 2016, 29, 307–314. [Google Scholar] [CrossRef] [Scilit]
- Costanzo, N.; Ceniti, C.; Santoro, A.; Clausi, M.T.; Casalinuovo, F. Foodborne pathogen assessment in raw milk cheeses. Int. J. Food Sci. 2020, 2020, 3616713. [Google Scholar] [CrossRef] [Scilit]
- Ribeiro, A.C.; Almeida, F.A.; De Medeiros, M.M.; Miranda, B.R.; Pinto, U.M. Listeria monocytogenes: An inconvenient hurdle for the dairy industry. Dairy 2023, 4, 316–344. [Google Scholar] [CrossRef] [Scilit]
- Buchanan, R.L.; Schaffner, D. FSMA: Testing as a tool for verifying preventive controls. Food Prot. Trends 2015, 35, 228–237. [Google Scholar]
- Arslan, S.; Özdemir, F. Prevalence and antimicrobial resistance of Listeria spp. in homemade white cheese. Food Control 2008, 19, 360–363. [Google Scholar] [CrossRef] [Scilit]
- Sauders, B.D.; Sanchez, M.D.; Rice, D.H.; Corby, J.; Stich, S.; Fortes, E.D.; Roof, S.E.; Wiedmann, M. Prevalence and molecular diversity of Listeria monocytogenes in retail establishments. J. Food Prot. 2009, 72, 2337–2349. [Google Scholar] [CrossRef] [Scilit]
- Gaulin, C.; Ramsay, D.; Bekal, S. Widespread listeriosis outbreak attributable to pasteurized cheese, which led to extensive cross-contamination affecting cheese retailers, Quebec, Canada, 2008. J. Food Prot. 2012, 75, 71–78. [Google Scholar] [CrossRef] [Scilit]
- Ibarra-Sánchez, L.A.; Van Tassell, M.L.; Miller, M.J. Invited review: Hispanic-style cheeses and their association with Listeria monocytogenes. J. Dairy Sci. 2017, 100, 2421–2432. [Google Scholar] [CrossRef] [Scilit]
- Palacios, A.; Otto, M.; Flaherty, E.; Boyle, M.M.; Malec, L.; Holloman, K.; Low, M.; Wellman, A.; Newhart, C.; Gollarza, L.; et al. Multistate outbreak of Listeria monocytogenes infections linked to fresh, soft hispanic-style cheese—United States, 2021. MMWR Morb. Mortal. Wkly. Rep. 2022, 71, 709–712. [Google Scholar] [CrossRef] [Scilit]
- Morvan, A.; Moubareck, C.; Leclercq, A.; Hervé-Bazin, M.; Bremont, S.; Lecuit, M.; Courvalin, P.; Le Monnier, A. Antimicrobial resistance of Listeria monocytogenes strains isolated from humans in France. Antimicrob. Agents Chemother. 2010, 54, 2728–2731. [Google Scholar] [CrossRef] [Scilit]
- Troxler, R.; von Graevenitz, A.; Funke, G.; Wiedemann, B.; Stock, I. Natural antibiotic susceptibility of Listeria species: L. grayi, L. innocua, L. ivanovii, L. monocytogenes, L. seeligeri and L. welshimeri strains. Clin. Microbiol. Infect. 2000, 6, 525–535. [Google Scholar] [CrossRef] [Scilit]
- Kovacevic, J.; Sagert, J.; Wozniak, A.; Gilmour, M.W.; Allen, K.J. Antimicrobial resistance and co-selection phenomenon in Listeria spp. recovered from food and food production environments. Food Microbiol. 2013, 34, 319–327. [Google Scholar] [CrossRef] [Scilit]
- Charpentier, E.; Courvalin, P. Antibiotic resistance in Listeria spp. Antimicrob. Agents Chemother. 1999, 43, 2103–2108. [Google Scholar] [CrossRef] [Scilit]
- Authority, European Food Safety European Centre for Disease Prevention and Control. EU The European Union One health 2021 Zoonoses report. EFSA J. 2022, 20, e07666. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Van Duynhoven, Y.T.H.P.; Isken, L.D.; Borgen, K.; Besselse, M.; Soethoudt, K.; Haitsma, O.; Mulder, B.; Notermans, D.W.; De Jonge, R.; Kock, P.; et al. A prolonged outbreak of Salmonella typhimurium infection related to an uncommon vehicle: Hard cheese made from raw milk. Epidemiol. Infect. 2009, 137, 1548–1557. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Oliver, S.P.; Jayarao, B.M.; Almeida, R.A. Foodborne pathogens, mastitis, milk quality, and dairy food safety. Foodborne Pathog. Dis. 2005, 2, 115–129. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CDC. Outbreak of Salmonella enterica serotype newport with consumption of unpasteurized mexican-style aged cheese—Illinois, March 2006-April 2007. MMWR Morb Mortal Wkly Rep. 2008, 57, 432–435. [Google Scholar]
- Dominguez, M.; Jourdan-Da Silva, N.; Vaillant, V.; Pihier, N.; Kermin, C.; Weill, F.X.; Delmas, G.; Kerouanton, A.; Brisabois, A.; de Valk, H. Outbreak of Salmonella enterica serotype Montevideo infections in France linked to consumption of cheese made from raw milk. Foodborne Pathog. Dis. 2009, 6, 121–128. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- van Cauteren, D.; Jourdan-da Silva, N.; Weill, F.X.; King, L.; Brisabois, A.; Delmas, G.; Vaillant, V.; de Valk, H. Outbreak of Salmonella enterica serotype Muenster infections associated with goat’s cheese, France, March 2008. Eurosurveill 2009, 14, 14–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Jørgensen, H.J.; Mørk, T.; Rørvik, L.M. The Occurrence of Staphylococcus aureus on a farm with small-scale production of raw milk cheese. J. Dairy Sci. 2005, 88, 3810–3817. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Baran, A.; Erdoğan, A.; Adigüzel, C. A Review on the presence of Staphylococcus aureus in cheese. J. Nat. Sci. 2017, 6, 100–105. [Google Scholar]
- Fetsch, A.; Contzen, M.; Hartelt, K.; Kleiser, A.; Maassen, S.; Rau, J.; Kraushaar, B.; Layer, F.; Strommenger, B. Staphylococcus aureus food-poisoning outbreak associated with the consumption of ice-cream. Int. J. Food Microbiol. 2014, 187, 1–6. [Google Scholar] [CrossRef] [Scilit]
- Kousta, M.; Mataragas, M.; Skandamis, P.; Drosinos, E.H. Prevalence and sources of cheese contamination with pathogens at farm and processing levels. Food Control 2010, 21, 805–815. [Google Scholar] [CrossRef] [Scilit]
- D’Amico, D.J.; Donnelly, C.W. Microbiological quality of raw milk used for small-scale artisan cheese production in Vermont: Effect of farm characteristics and practices. J. Dairy Sci. 2010, 93, 134–147. [Google Scholar] [CrossRef] [Scilit]
- Johler, S.; Macori, G.; Bellio, A.; Acutis, P.L.; Gallina, S.; Decastelli, L. Short communication: Characterization of Staphylococcus aureus isolated along the raw milk cheese production process in artisan dairies in Italy. J. Dairy Sci. 2018, 101, 2915–2920. [Google Scholar] [CrossRef] [Scilit]
- Johler, S.; Zurfluh, K.; Stephan, R. Tracing and inhibiting growth of Staphylococcus aureus in barbecue cheese production after product recall. J. Dairy Sci. 2016, 99, 3345–3350. [Google Scholar] [CrossRef] [Scilit]
- Kümmel, J.; Stessl, B.; Gonano, M.; Walcher, G.; Bereuter, O.; Fricker, M.; Grunert, T.; Wagner, M.; Ehling-Schulz, M. Staphylococcus aureus entrance into the dairy chain: Tracking S. aureus from dairy cow to cheese. Front. Microbiol. 2016, 7, 1603. [Google Scholar] [CrossRef] [Scilit]
- N’guessan, É.; Godrie, T.; De Laubier, J.; Di Tanna, S.; Ringuet, M.; Sindic, M. A survey of bacteria found in belgian dairy farm products. Biotechnol. Agron. Soc. Environ. 2015, 19, 346–354. [Google Scholar]
- Ombarak, R.A.; Hinenoya, A.; Awasthi, S.P.; Iguchi, A.; Shima, A.; Elbagory, A.R.M.; Yamasaki, S. Prevalence and pathogenic potential of Escherichia coli isolates from raw milk and raw milk cheese in Egypt. Int. J. Food Microbiol. 2016, 221, 69–76. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Willis, C.; McLauchlin, J.; Aird, H.; Jørgensen, F.; Lai, S.; Sadler-Reeves, L. Assessment of the microbiological quality and safety of unpasteurized milk cheese for sale in England between 2019 and 2020. J. Food Prot. 2022, 85, 278–286. [Google Scholar] [CrossRef] [Scilit]
- Baylis, C.L. Raw milk and raw milk cheeses as vehicles for infection by verocytotoxin-producing Escherichia coli. Int. J. Dairy Technol. 2009, 62, 293–307. [Google Scholar] [CrossRef] [Scilit]
- Corbo, M.R.; Lanciotti, R.; Albenzio, M.; Sinigaglia, M. Occurrence and characterization of yeasts isolated from milks and dairy products of Apulia region. Int. J. Food Microbiol. 2001, 69, 147–152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fleet, G.H. Yeasts in dairy products. J. Appl. Bacteriol. 1990, 68, 209–237. [Google Scholar] [CrossRef] [Scilit]
- Rogga, K.J.; Samelis, J.; Kakouri, A.; Katsiari, M.C.; Savvaidis, I.N.; Kontominas, M.G. Survival of Listeria monocytogenes in Galotyri, a traditional Greek soft acid-curd cheese, stored aerobically at 4 °C and 12 °C. Int. Dairy J. 2005, 15, 59–67. [Google Scholar] [CrossRef] [Scilit]
- Hayaloglu, A.A.; Brechany, E.Y.; Deegan, K.C.; McSweeney, P.L.H. Characterization of the chemistry, biochemistry and volatile profile of kuflu cheese, a mould-ripened variety. Lwt 2008, 41, 1323–1334. [Google Scholar] [CrossRef] [Scilit]
- Kure, C.F.; Skaar, I. The fungal problem in cheese industry. Curr. Opin. Food Sci. 2019, 29, 14–19. [Google Scholar] [CrossRef] [Scilit]
- Mladenović, K.G.; Muruzović, M.; Žugić Petrović, T.; Stefanović, O.D.; Čomić, L.R. Isolation and identification of Enterobacteriaceae from traditional Serbian cheese and their physiological characteristics. J. Food Saf. 2018, 38, 12387. [Google Scholar] [CrossRef] [Scilit]
- Joković, N.; Rajković, J.; Veljović, K.; Tolina, M. Screening of lactic acid bacteria isolated from Serbian kajmak for use in starter cultures. Biol. Nyssana 2014, 5, 37–46. [Google Scholar]
- Nikolic, M.; Terzic-Vidojevic, A.; Jovcic, B.; Begovic, J.; Golic, N.; Topisirovic, L. Characterization of lactic acid bacteria isolated from Bukuljac, a homemade goat’s milk cheese. Int. J. Food Microbiol. 2008, 122, 162–170. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Terzic-Vidojevic, A.; Vukasinovic, M.; Veljovic, K.; Ostojic, M.; Topisirovic, L. Characterization of microflora in homemade semi-hard white Zlatar cheese. Int. J. Food Microbiol. 2007, 114, 36–42. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Serbia Ordinance on Small Quantities of Primary Products Intended for Supply to Consumers, the Area in Which These Activities Are to Be Carried out and Derogations Concerning Small Enterprises in the Animal Food Production. Official Gazette of the Republic of Serbia No 111/17. 2017. Available online: https://pravno-informacioni-sistem.rs/SlGlasnikPortal/eli/rep/sgrs/ministarstva/pravilnik/2017/111/2 (accessed on 15 April 2024).
- ISO/IEC 17025:2017; General Requirements for the Competence of Testing and Calibration Laboratories III. Institute for Standardization of Serbia: Belgrade, Serbia, 2018.
- ISO 6579-1:2017; Microbiology of the Food Chain—Horizontal Method for the Detection, Enumeration and Serotyping of Salmonella—Part 1: Detection of Salmonella spp. International Organization for Standardization: Geneva, Switzerland, 2017; pp. 1–14.
- ISO 11290-1:2017; Microbiology of the Food Chain—Horizontal Method for the Detection and Enumeration of Listeria monocytogenes and of Listeria spp.—Part 1: Detection Method. International Organization for Standardization: Geneva, Switzerland, 2017; Volume 5, pp. 1–8.
- ISO 6888-1:1999; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumaration of Coagulase—Positive Staphylococci (Staphylococcus aureus and Other Species)—Part 1: Technique Using Baird—Parker Agar Medium. International Organization for Standardization: Geneva, Switzerland, 2009; Volume 2, p. 255.
- ISO 16649-2:2008; Microbiology of Food and Animal Feeding Stuffs—Horizontal Method for the Enumeration of Beta-Glucuronidase-Positive Escherichia coli—Part 2: Colony-Count Technique at 44 Degrees C Using 5-bromo-4-chloro-3-indolyl beta-d-glucuronide. International Organization for Standardization: Geneva, Switzerland, 2001; Volume 76, pp. 61–64.
- ISO 6611:2004; ISO Milk and Milk Products. Enumeration of Colony-Forming Units of Yeasts and/or Moulds. Colony-Count Technique at 25 °C. ISO: Geneva, Switzerland, 2004; Volume 94, p. 2004.
- Taskila, S.; Tuomola, M.; Ojamo, H. Enrichment cultivation in detection of food-borne Salmonella. Food Control 2012, 26, 369–377. [Google Scholar] [CrossRef] [Scilit]
- ISO 7218:2007; Microbiology of Food and Animal Feeding Stuffs—General Requirements and Guidance for Microbiological Examinations. International Organization for Standardization: Geneva, Switzerland, 2007; p. 66.
- ISO 6887-5:2020; Microbiology of the Food Chain—Preparation of Test Samples, Initial Suspension and Decimal Dilutions for Microbiological Examination—Part 5: Specific Rules for the Preparation of Milk and Milk Products. International Organization for Standardization: Geneva, Switzerland, 2020; Volume 7, pp. 33–48.
- Doumith, M.; Buchrieser, C.; Glaser, P.; Jacquet, C.; Martin, P. Differentiation of the major Listeria monocytogenes serovars by multiplex PCR. J. Clin. Microbiol. 2004, 42, 3819–3822. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- CLSI M100-S22; Performance Standards for Antimicrobial Susceptibility Testing; Twenty Second Informational Supplement. CLSI Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2012; Volume 32.
- CLSI M100-Ed34; Performance Standards for Antimicrobial Susceptibility Testing, 26st Informational Supplement. Clinical and Laboratory Standards Institute: Wayne, PA, USA, 2014.
- Tahoun, A.B.M.B.; Abou Elez, R.M.M.; Abdelfatah, E.N.; Elsohaby, I.; El-Gedawy, A.A.; Elmoslemany, A.M. Listeria monocytogenes in raw milk, milking equipment and dairy workers: Molecular characterization and antimicrobial resistance patterns. J. Glob. Antimicrob. Resist. 2017, 10, 264–270. [Google Scholar] [CrossRef] [Scilit]
- Harakeh, S.; Saleh, I.; Zouhairi, O.; Baydoun, E.; Barbour, E.; Alwan, N. Antimicrobial resistance of Listeria monocytogenes isolated from dairy-based food products. Sci. Total Environ. 2009, 407, 4022–4027. [Google Scholar] [CrossRef] [Scilit]
- EUCAST European Committee on Antimicrobial Susceptibility Testing (EUCAST): Break Point Tables for Interpretation of MIC and Zone Diameter. Available online: https://www.eucast.org/clinical_breakpoints/ (accessed on 15 April 2024).
- Serbia Ordinance on General and Special Conditions of Food Hygiene at Any Stage of Production, Processing and Trade (In Serbian). Official Gazette of The Republic of Serbia No. 72/10, 62/18 and 5/24. 2010. Available online: https://pravno-informacioni-sistem.rs/SlGlasnikPortal/eli/rep/sgrs/ministarstva/pravilnik/2010/72/3 (accessed on 15 April 2024).
- Serbia Ordinance on Determining the Program for Monitoring the Safety of Food of Animal Origin for the Year 2023 (In Serbian). Official Gazette of the Republic of Serbia No 54/23. 2023. Available online: https://pravno-informacioni-sistem.rs/SlGlasnikPortal/eli/rep/sgrs/ministarstva/pravilnik/2023/87/2/reg (accessed on 15 April 2024).
- Serbia Guide to the application of microbiological criteria for food (In Serbian). Ministry of Agriculture, Forestry and Water Management, Veterinary Directorate. 2011. Available online: https://www.vet.minpolj.gov.rs/veterinarsko_javno_zdravstvo/instrukcije_i_vodici/Vodic%20za%20mikrobioloske%20kriterijume%20za%20hranu.pdf (accessed on 15 April 2024).
- HPA. Guidelines for Assessing the Microbiological Safety of Ready-to-Eat Foods Placed on the Market; HPA: London, UK, 2009.
- Carrascosa, C.; Millán, R.; Saavedra, P.; Jaber, J.R.; Raposo, A.; Sanjuán, E. Identification of the risk factors associated with cheese production to implement the Hazard Analysis and Critical Control Points (HACCP) system on cheese farms. J. Dairy Sci. 2016, 99, 2606–2616. [Google Scholar] [CrossRef] [Scilit]
- Nyamakwere, F.; Esposito, G.; Dzama, K.; Muller, M.; Moelich, E.I.; Raffrenato, E. A Survey of cheese from small-scale artisanal producers in western Cape, South Africa. J. Food Qual. 2021, 2021, 3708786. [Google Scholar] [CrossRef] [Scilit]
- Andretta, M.; Almeida, T.T.; Ferreira, L.R.; Carvalho, A.F.; Yamatogi, R.S.; Nero, L.A. Microbial safety status of serro artisanal cheese produced in Brazil. J. Dairy Sci. 2019, 102, 10790–10798. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stefanou, C.R.; Bartodziejska, B.; Gajewska, M.; Szosland-Fałtyn, A. Microbiological quality and safety of traditional raw milk cheeses manufactured on a small scale by Polish dairy farms. Foods 2022, 11, 3910. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ganz, K.; Yamamoto, E.; Hardie, K.; Hum, C.; Hussein, H.; Locas, A.; Steele, M. Microbial safety of cheese in Canada. Int. J. Food Microbiol. 2020, 321, 108521. [Google Scholar] [CrossRef] [Scilit]
- Laslo, É.; György, É. Evaluation of the microbiological quality of some dairy products. Acta Univ. Sapientiae Aliment. 2018, 11, 27–44. [Google Scholar] [CrossRef] [Scilit]
- Silva, F.V.M.; Gibbs, P.A. Thermal pasteurization requirements for the inactivation of Salmonella in foods. Food Res. Int. 2012, 45, 695–699. [Google Scholar] [CrossRef] [Scilit]
- Olsen, S.J.; Ying, M.; Davis, M.F.; Deasy, M.; Holland, B.; Iampletro, L.; Baysinger, C.M.; Sassano, F.; Polk, L.D.; Gormley, B.; et al. Multidrug-resistant Salmonella Typhimurium Infection from milk contaminated after pasteurization. Emerg. Infect. Dis. 2004, 10, 932–935. [Google Scholar] [CrossRef] [Scilit]
- Torkar, K.G.; Teger, S.G. The Presence of Some pathogenic microorganisms, yeasts and moulds in cheese samples produced in small dairy-processing plants. Acta Agric. Slov. 2006, 88, 37–51. [Google Scholar]
- Unal Turhan, E. The presence of pathogenic bacteria in traditional cheese sold in local market in Hatay Province, Turkey. Appl. Ecol. Environ. Res. 2019, 17, 7135–7145. [Google Scholar] [CrossRef] [Scilit]
- Oliver, S.P.; Jayarao, B.M.; Almeida, R.A. Foodborne pathogens, mastitis, milk quality and dairy food safety. In NMC Annual Meeting Proceedings; NMC Publications: London, UK, 2010; pp. 3–27. [Google Scholar]
- Kara, R.; Aslan, S. Investigation of Listeria monocytogenes in workers, equipment and environments at kaymak processing plants. Food Sci. Technol. 2021, 41, 449–452. [Google Scholar] [CrossRef] [Scilit]
- Brown, S.R.B.; Bland, R.; McIntyre, L.; Shyng, S.; Weisberg, A.J.; Riutta, E.R.; Chang, J.H.; Kovacevic, J. Genomic characterization of Listeria monocytogenes recovered from dairy facilities in British Columbia, Canada from 2007 to 2017. Front. Microbiol. 2024, 15, 1304734. [Google Scholar] [CrossRef] [Scilit]
- Akrami-Mohajeri, F.; Derakhshan, Z.; Ferrante, M.; Hamidiyan, N.; Soleymani, M.; Conti, G.O.; Tafti, R.D. The prevalence and antimicrobial resistance of Listeria spp. in raw milk and traditional dairy products delivered in Yazd, Central Iran (2016). Food Chem. Toxicol. 2018, 114, 141–144. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pintado, C.M.B.S.; Oliveira, A.; Pampulha, M.E.; Ferreira, M.A.S.S. Prevalence and characterization of Listeria monocytogenes isolated from soft cheese. Food Microbiol. 2005, 22, 79–85. [Google Scholar] [CrossRef] [Scilit]
- Fusco, V.; Chieffi, D.; Fanelli, F.; Logrieco, A.F.; Cho, G.S.; Kabisch, J.; Böhnlein, C.; Franz, C.M.A.P. Microbial quality and safety of milk and milk products in the 21st century. Compr. Rev. Food Sci. Food Saf. 2020, 19, 2013–2049. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Moura, A.; Disson, O.; Lavina, M.; Thouvenot, P.; Huang, L.; Leclercq, A.; Fredriksson-Ahomaa, M.; Eshwar, A.K.; Stephan, R.; Lecuit, M. Atypical hemolytic Listeria innocua isolates are virulent, albeit less than Listeria monocytogenes. Infect. Immun. 2019, 87, e00758-18. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Miloradovic, Z.; Kovacevic, J.; Miocionovic, J.; Djekic, I.; Kljajevic, N.; Smigic, N. E-commerce readiness and training needs of small-scale dairy processors in Serbia: Understanding barriers and knowledge gaps. Heliyon 2024, 10, 2405–8440. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maury, M.M.; Bracq-Dieye, H.; Huang, L.; Vales, G.; Lavina, M.; Thouvenot, P.; Disson, O.; Leclercq, A.; Brisse, S.; Lecuit, M. Hypervirulent Listeria monocytogenes clones’ adaption to mammalian gut accounts for their association with dairy products. Nat. Commun. 2019, 10, 1–13. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Makino, S.I.; Kawamoto, K.; Takeshi, K.; Okada, Y.; Yamasaki, M.; Yamamoto, S.; Igimi, S. An outbreak of food-borne listeriosis due to cheese in Japan, during 2001. Int. J. Food Microbiol. 2005, 104, 189–196. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kevenk, T.O.; Terzi Gulel, G. Prevalence, antimicrobial resistance and serotype distribution of Listeria monocytogenes isolated from raw milk and dairy products. J. Food Saf. 2016, 36, 11–18. [Google Scholar] [CrossRef] [Scilit]
- Luque-Sastre, L.; Arroyo, C.; Fox, E.M.; McMahon, B.J.; Bai, L.; Li, F.; Fanning, S. Antimicrobial resistance in Listeria species. Microbiol. Spectr. 2018, 1-23, 1–23. [Google Scholar] [CrossRef] [Scilit]
- Olaimat, A.N.; Al-Holy, M.A.; Shahbaz, H.M.; Al-Nabulsi, A.A.; Abu Ghoush, M.H.; Osaili, T.M.; Ayyash, M.M.; Holley, R.A. Emergence of antibiotic resistance in Listeria monocytogenes isolated from food products: A comprehensive review. Compr. Rev. Food Sci. Food Saf. 2018, 17, 1277–1292. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahimi, E.; Ameri, M.; Momtaz, H. Prevalence and antimicrobial resistance of Listeria species isolated from milk and dairy products in Iran. Food Control 2010, 21, 1448–1452. [Google Scholar] [CrossRef] [Scilit]
- Aksoy, A.; Sezer, Ç.; Vatansever, L.; Gülbaz, G. Presence and antibiotic resistance of Listeria monocytogenes in raw milk and dairy products. Kafkas Univ. Vet. Fak. Derg. 2018, 24, 415–421. [Google Scholar] [CrossRef] [Scilit]
- Yücel, N.; Çitak, S.; Önder, M. Prevalence and antibiotic resistance of Listeria species in meat products in Ankara, Turkey. Food Microbiol. 2005, 22, 241–245. [Google Scholar] [CrossRef] [Scilit]
- Haubert, L.; Mendonça, M.; Lopes, G.V.; de Itapema Cardoso, M.R.; da Silva, W.P. Listeria monocytogenes isolates from food and food environment harbouring TetM and ErmB resistance genes. Lett. Appl. Microbiol. 2016, 62, 23–29. [Google Scholar] [CrossRef] [Scilit]
- Jorgensen, J.; Bland, R.; Waite-Cusic, J.; Kovacevic, J. Diversity and antimicrobial resistance of Listeria spp. and L. monocytogenes clones from produce handling and processing facilities in the Pacific Northwest. Food Control 2021, 123, 107665. [Google Scholar] [CrossRef] [Scilit]
- Hof, H.; Nichterlein, T.; Kretschmar, M. Management of listeriosis. Clin. Microbiol. Rev. 1997, 10, 345–357. [Google Scholar] [CrossRef]
- Filiousis, G.; Johansson, A.; Frey, J.; Perreten, V. Prevalence, genetic diversity and antimicrobial susceptibility of Listeria monocytogenes isolated from open-air food markets in Greece. Food Control 2009, 20, 314–317. [Google Scholar] [CrossRef] [Scilit]
- Wilson, A.; Gray, J.; Scott Chandry, P.; Fox, E.M. Phenotypic and genotypic analysis of antimicrobial resistance among Listeria monocytogenes isolated from Australian food production chains. Genes 2018, 9, 80. [Google Scholar] [CrossRef] [Scilit]
- Rosengren, Å.; Fabricius, A.; Guss, B.; Sylvén, S.; Lindqvist, R. Occurrence of foodborne pathogens and characterization of Staphylococcus aureus in cheese produced on farm-dairies. Int. J. Food Microbiol. 2010, 144, 263–269. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- EC Regulation (EC) No 2073/2005 on Microbiological Criteria for Foodstuffs. Official Journal of the European Union L 338/1 2005. pp. 1–6. Available online: https://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:02005R2073-20140601&from=DA (accessed on 15 April 2024).
- O’Brien, M.; Hunt, K.; McSweeney, S.; Jordan, K. Occurrence of foodborne pathogens in Irish farmhouse cheese. Food Microbiol. 2009, 26, 910–914. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Little, C.L.; Rhoades, J.R.; Sagoo, S.K.; Harris, J.; Greenwood, M.; Mithani, V.; Grant, K.; McLauchlin, J. Microbiological quality of retail cheeses made from raw, thermized or pasteurized milk in the UK. Food Microbiol. 2008, 25, 304–312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mirecki, S.; Tomić, D.; Vučinić, S.; Marković, M.; Marković, B. Technology and quality of skorup—Traditional Montenegrin dairy product. Mljekarstvo 2017, 67, 197–207. [Google Scholar] [CrossRef] [Scilit]
- Geronikou, A.; Srimahaeak, T.; Rantsiou, K.; Triantafillidis, G.; Larsen, N.; Jespersen, L. Occurrence of yeasts in white-brined cheeses: Methodologies for identification, spoilage potential and good manufacturing practices. Front. Microbiol. 2020, 11, 582778. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Viljoen, B.C. The interaction between yeasts and bacteria in dairy environments. Int. J. Food Microbiol. 2001, 69, 37–44. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fernández, M.; Hudson, J.A.; Korpela, R.; De Los Reyes-Gavilán, C.G. Impact on human health of microorganisms present in fermented dairy products: An overview. Biomed Res. Int. 2015, 2015, 412714. [Google Scholar] [CrossRef] [Scilit]
- Garnier, L.; Valence, F.; Mounier, J. Diversity and control of spoilage fungi in dairy products: An update. Microorganisms 2017, 5, 42. [Google Scholar] [CrossRef] [Scilit]
| Dairy Product | Microorganism | Microbiological Quality 1 | Legal Act/Guide/Literature 2 | ||
|---|---|---|---|---|---|
| Satisfactory | Acceptable | Unsatisfactory | |||
| Raw milk cheese | L. monocytogenes | Absent in 25 g | N/A 3 | present in 25 g | [80] |
| Salmonella spp. | Absent in 25 g | N/A | present in 25 g | [79,80] | |
| CPS 4 | ≤4 | 4–5 | >5 | [79,80] | |
| E. coli 5 | ≤1.30 | 1.30–2 | >2 | [52,82] | |
| Yeasts and moulds | ≤6 | N/A | >6 | [55] | |
| Pasteurized milk cheese | L. monocytogenes | Absent in 25 g | N/A | present in 25 g | [79,80] |
| Salmonella spp. | Absent in 25 g | N/A | present in 25 g | / | |
| CPS | ≤1 | N/A | >1 | [80] | |
| E. coli | ≤2 | N/A | >2 | [80] | |
| Yeasts and moulds | ≤6 | N/A | >6 | [55] | |
| Kajmak | L. monocytogenes | Absent in 25 g | N/A | present in 25 g | [79] |
| Salmonella spp. | Absent in 25 g | N/A | present in 25 g | / | |
| CPS | ≤1 | N/A | >1 | [80] | |
| E. coli | ≤3 | 3–4 | >4 | [81] | |
| Yeasts and moulds | ≤6 | N/A | >6 | [55] | |
| Type of Product and Sample ID | Listeria spp. (Detection) | L. monocytogenes Serogroups | E. coli log CFU/g | CPS 1 log CFU/g | Yeast and Moulds log CFU/g |
|---|---|---|---|---|---|
| Kajmak, K1 | L. monocytogenes | Group 3 (1/2b, 3b, 7) | 4.08 | <1 | 4.79 |
| Kajmak, K2 | L. monocytogenes | Group 3 (1/2b, 3b, 7) | <1 | <1 | 2.43 |
| L. innocua | N/A | ||||
| Kajmak, K3 | L. monocytogenes | Group 1 (1/2a, 3a) | 3.00 | <1 | 3.08 |
| L. ivanovii | N/A | ||||
| Kajmak, K4 | L. monocytogenes | Group 3 (1/2b, 3b, 7) | <1 | <1 | 3.85 |
| Kajmak, K5 | L. monocytogenes | Group 3 (1/2b, 3b, 7) | 2.81 | <1 | 4.88 |
| Kajmak, K6 | L. innocua | N/A | 4.23 | <1 | 5.00 |
| Kajmak, K7 | L. innocua | N/A | 4.23 | <1 | 4.47 |
| Kajmak, K8 | L. innocua | N/A | 2.60 | <1 | 5.51 |
| Raw milk cheese, C1 | L. monocytogenes | Group 1 (1/2a, 3a) | 4.62 | <1 | N/A 2 |
| Pasteurized milk cheese, C2 | L. innocua | N/A | 4.75 | <1 | 5.48 |
| Antibiotic | Abbreviation (μg/disc 1) | No. of Isolates (%) | ||
|---|---|---|---|---|
| Resistant | Intermediate | Susceptible | ||
| Cefotaxime 2 | CTA (5 µg) | 2 (33) | 1 (17) | 3 (50) |
| Clindamycin 2 | CLI (2 µg) | 2 (33) | 3 (50) | 1 (17) |
| Gentamicin 2 | GEN (10 µg) | 1 (17) | 0 | 5 (83) |
| Oxacillin 2 | OXA (1 µg) | 6 (100) | 0 | 0 |
| Penicillin G 3 | PEN (10 IU) | 0 | 2 (33) | 4 (67) |
| Tetracycline 2 | TET (30 µg) | 0 | 0 | 6 (100) |
| Trimethoprim + Sulfamethoxazole 3 | TRS (25 µg) | 1 (17) | 0 | 5 (83) |
| Vancomycin 4 | VAN (5 µg) | 0 | 0 | 6 (100) |
| Indicators | Raw Milk Cheese | Pasteurized Milk Cheese | Kajmak | ||||||
|---|---|---|---|---|---|---|---|---|---|
| log CFU/g | <1 log CFU/g | log CFU/g | <1 log CFU/g | log CFU/g | <1 log CFU/g | ||||
| n (%) | Mean ± SD | n (%) | n(%) | Mean ± SD | n (%) | n (%) | Mean ± SD | n (%) | |
| CPS 1 | 19 (24) a | 4.02 ± 1.49 | 60 (76) | 2 (2) b | 3.46 ± 1.49 | 109 (98) | 3 (3) | 2.43 ± 0.85 | 109 (97) |
| E. coli | 67 (85) | 4.41 ± 1.34 | 12 (15) | 80 (72) | 4.12 ± 1.61 | 31 (28) | 60 (54) | 3.31 ± 1.41 | 52 (46) |
| Yeasts and moulds | 77 (98) a | 4.99 ± 1.30 | 2 (2) | 111 (100) b | 5.29 ± 1.42 | 0 | 111 (99) | 4.23 ± 1.22 | 1 (1) |
| Raw Milk Cheese, n (%) | Pasteurized Milk Cheese, n (%) | Kajmak, n (%) | |||||||
|---|---|---|---|---|---|---|---|---|---|
| CPS 1 | E. coli | Yeast and Moulds | CPS | E. coli | Yeast and Moulds | CPS | E. coli | Yeast and Moulds | |
| Satisfactory | 68 (86) | 12 (15) | 61 (77) | 108 (98) | 38 (34) | 68 (62) | 109 (97) | 80 (71) | 101 (90) |
| Acceptable | 4 (5) | 4 (5) | N/A 2 | N/A | N/A | N/A | N/A | 10 (9) | N/A |
| Unsatisfactory | 7 (9) | 63 (80) | 18 (23) | 2 (2) | 73 (66) | 42 (38) | 3 (3) | 22 (20) | 11 (10) |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Aleksic, B.; Udovicki, B.; Kovacevic, J.; Miloradovic, Z.; Djekic, I.; Miocinovic, J.; Tomic, N.; Smigic, N. Microbiological Assessment of Dairy Products Produced by Small-Scale Dairy Producers in Serbia. Foods 2024, 13, 1456. https://doi.org/10.3390/foods13101456
Aleksic B, Udovicki B, Kovacevic J, Miloradovic Z, Djekic I, Miocinovic J, Tomic N, Smigic N. Microbiological Assessment of Dairy Products Produced by Small-Scale Dairy Producers in Serbia. Foods. 2024; 13(10):1456. https://doi.org/10.3390/foods13101456
Chicago/Turabian StyleAleksic, Biljana, Bozidar Udovicki, Jovana Kovacevic, Zorana Miloradovic, Ilija Djekic, Jelena Miocinovic, Nikola Tomic, and Nada Smigic. 2024. "Microbiological Assessment of Dairy Products Produced by Small-Scale Dairy Producers in Serbia" Foods 13, no. 10: 1456. https://doi.org/10.3390/foods13101456
APA StyleAleksic, B., Udovicki, B., Kovacevic, J., Miloradovic, Z., Djekic, I., Miocinovic, J., Tomic, N., & Smigic, N. (2024). Microbiological Assessment of Dairy Products Produced by Small-Scale Dairy Producers in Serbia. Foods, 13(10), 1456. https://doi.org/10.3390/foods13101456

