Profiling the Gut Microbiota in Obese Children with Formula Feeding in Early Life and Selecting Strains against Obesity
Abstract
1. Introduction
2. Materials and Methods
2.1. Children’s Information
2.2. Collection of Fresh Fecal Samples and Processing
2.3. High-Throughput 16SrDNA Gene Sequencing and Data Processing
2.4. Isolation and Identification of Bacteria Strains
2.5. Selection of Strains with the Ability of Stimulating CCK Secretion
2.6. Qualitative Screening of Bile Salt Hydrolase (BSH)-Producing Strains
2.7. Animals and Experimental Design
2.8. Measurement and Histological Analysis
2.9. Biochemical Analysis
2.10. Bile Salt Analysis
2.11. Real-Time Quantitative PCR
2.12. Statistical Analysis
3. Results
3.1. Intestinal Microbial Community of Obese Formula-Fed Children
3.2. Screening Strains with Potential Anti-Obesity Function In Vitro
3.3. L. acidophilus H-68 Suppressed Food Intake and Obesity in HFD-Fed Mice
3.4. L. acidophilus H-68 Inhibited Disorder of Related Indicators of Serum Lipid Metabolism, Liver Injury, and Inflammatory Response in HFD-Fed Mice
3.5. L. acidophilus H-68 Regulates Bile Acid Metabolism to Alleviate Liver Fat Deposition in HFD-Fed Mice
4. Discussion
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Fenneman, A.C.; Weidner, M.; Chen, L.A.; Nieuwdorp, M.; Blaser, M.J. Antibiotics in the pathogenesis of diabetes and inflammatory diseases of the gastrointestinal tract. Nat. Rev. Gastroenterol. Hepatol. 2023, 20, 81–100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Solano-Aguilar, G.; Shea-Donohue, T.; Madden, K.B.; Quinones, A.; Beshah, E.; Lakshman, S.; Xie, Y.; Dawson, H.; Urban, J.F. Bifidobacterium animalis subspecies lactis modulates the local immune response and glucose uptake in the small intestine of juvenile pigs infected with the parasitic nematode Ascaris suum. Gut Microbes 2018, 9, 422–436. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Matsumoto, M.; Kitada, Y.; Naito, Y. Endothelial Function is improved by Inducing Microbial Polyamine Production in the Gut: A Randomized Placebo-Controlled Trial. Nutrients 2019, 11, 1188. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saavedra, J.M.; Abi-Hanna, A.; Moore, N.; Yolken, R.H. Long-term consumption of infant formulas containing live probiotic bacteria: Tolerance and safety. Am. J. Clin. Nutr. 2004, 79, 261–267. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Saxelin, M.; Tynkkynen, S.; Mattila-Sandholm, T.; de Vos, W.M. Probiotic and other functional microbes: From markets to mechanisms. Curr. Opin. Biotechnol. 2005, 16, 204–211. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liang, D.; Wu, F.; Zhou, D.; Tan, B.; Chen, T. Commercial probiotic products in public health: Current status and potential limitations. Crit. Rev. Food Sci. Nutr. 2023, 1–22. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Burz, S.D.; Causevic, S.; Dal Co, A.; Dmitrijeva, M.; Engel, P.; Garrido-Sanz, D.; Greub, G.; Hapfelmeier, S.; Hardt, W.-D.; Hatzimanikatis, V.; et al. From microbiome composition to functional engineering, one step at a time. Microbiol. Mol. Biol. Rev. 2023, 87, e00063-23. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cheng, H.L.; Chen, R.B.C.; Milosevic, M.; Rossiter, C.; Arora, A.; Denney-Wilson, E. Interventions Targeting Bottle and Formula Feeding in the Prevention and Treatment of Early Childhood Caries, Overweight and Obesity: An Integrative Review. Int. J. Environ. Res. Public Health 2021, 18, 12304. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shan, S.H.; Qiao, Q.Q.; Yin, R.P.; Zhang, L.Z.; Shi, J.Y.; Zhao, W.J.; Zhou, J.Q.; Li, Z.Y. Identification of a Novel Strain Lactobacillus reuteri and Anti-Obesity Effect through Metabolite Indole-3-Carboxaldehyde in Diet-Induced Obese Mice. J. Agric. Food Chem. 2023, 71, 3239–3249. [Google Scholar] [CrossRef] [Scilit]
- Chen, H.; Zhao, H.; Qi, X.; Sun, Y.; Ma, Y.; Li, Q. Lactobacillus plantarum HF02 alleviates lipid accumulation and intestinal microbiota dysbiosis in high-fat diet-induced obese mice. J. Sci. Food Agric. 2023, 103, 4625–4637. [Google Scholar] [CrossRef] [Scilit]
- Ban, O.H.; Lee, M.; Bang, W.Y.; Nam, E.H.; Jeon, H.J.; Shin, M.; Yang, J.; Jung, Y.H. Bifidobacterium lactis IDCC 4301 Exerts Anti-Obesity Effects in High-Fat Diet-Fed Mice Model by Regulating Lipid Metabolism. Mol. Nutr. Food Res. 2023, 67, 2200385. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, X.; Yue, C.; Tian, R.; Yu, L.; Tian, F.; Zhao, J.; Chen, W.; Zhai, Q. Akkermansia muciniphila-directed polyphenol chlorogenic acid intervention for obesity in mice. Food Sci. Hum. Wellness 2024, 13, 90–100. [Google Scholar] [CrossRef] [Scilit]
- Cryan, J.F.; O’Riordan, K.J.; Cowan, C.S.M.; Sandhu, K.V.; Bastiaanssen, T.F.S.; Boehme, M.; Codagnone, M.G.; Cussotto, S.; Fulling, C.; Golubeva, A.V.; et al. The Microbiota-Gut-Brain Axis. Physiol. Rev. 2019, 99, 1877–2013. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yuan, Y.; Wang, X.Y.; Huang, S.; Wang, H.; Shen, G.M. Low-level inflammation, immunity, and brain-gut axis in IBS: Unraveling the complex relationships. Gut Microbes 2023, 15, 2263209. [Google Scholar] [CrossRef] [Scilit]
- Liu, X.; Liu, Y.; Liu, J.; Zhang, H.; Shan, C.; Guo, Y.; Gong, X.; Cui, M.; Li, X.; Tang, M. Correlation between the gut microbiome and neurodegenerative diseases: A review of metagenomics evidence. Neural Regen. Res. 2024, 19, 833–845. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gao, X.; Jia, R.; Xie, L.; Kuang, L.; Feng, L.; Wan, C. A study of the correlation between obesity and intestinal flora in school-age children. Sci. Rep. 2018, 8, 14511. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kneifel, W.; Toros, A.; Viernstein, H. Differential enumeration of silage inoculants based on utilization of enzymatic activity and antibiotic sensitivity of bacteria. J. Appl. Bacteriol. 1994, 77, 42–48. [Google Scholar] [CrossRef] [Scilit]
- McCoy, S.; Gilliland, S.E. Isolation and characterization of Lactobacillus species having potential for use as probiotic cultures for dogs. J. Food Sci. 2007, 72, M94–M97. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wang, S.-M.; Zhang, L.-W.; Fan, R.-B.; Han, X.; Yi, H.-X.; Zhang, L.-L.; Xue, C.-H.; Li, H.-B.; Zhang, Y.-H.; Shigwedha, N. Induction of HT-29 cells apoptosis by lactobacilli isolated from fermented products. Res. Microbiol. 2014, 165, 202–214. [Google Scholar] [CrossRef] [Scilit]
- Santos-Hernandez, M.; Tome, D.; Gaudichon, C.; Recio, I. Stimulation of CCK and GLP-1 secretion and expression in STC-1 cells by human jejunal contents and in vitro gastrointestinal digests from casein and whey proteins. Food Funct. 2018, 9, 4702–4713. [Google Scholar] [CrossRef] [Scilit]
- Wei, S.-H.; Chen, Y.-P.; Chen, M.-J. Selecting probiotics with the abilities of enhancing GLP-1 to mitigate the progression of type 1 diabetes in vitro and in vivo. J. Funct. Foods 2015, 18, 473–486. [Google Scholar] [CrossRef] [Scilit]
- Dashkevicz, M.P.; Feighner, S.D. Development of a differential medium for bile salt hydrolase-active Lactobacillus spp. Appl. Environ. Microbiol. 1989, 55, 11–16. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Liu, L.; Li, X.; Huang, C.; Bian, Y.; Liu, X.; Cao, J.; Qu, W.; Miao, L. Bile acids, lipid and purine metabolism involved in hepatotoxicity of first-line anti-tuberculosis drugs. Expert Opin. Drug Metab. Toxicol. 2020, 16, 527–537. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Alvarez-Arraño, V.; Martín-Peláez, S. Effects of Probiotics and Synbiotics on Weight Loss in Subjects with Overweight or Obesity: A Systematic Review. Nutrients 2021, 13, 3627. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Wu, C.-H.; Chen, S.-C.; Ou, T.-T.; Chyau, C.-C.; Chang, Y.-C.; Wang, C.-J. Mulberry leaf polyphenol extracts reduced hepatic lipid accumulation involving regulation of adenosine monophosphate activated protein kinase and lipogenic enzymes. J. Funct. Foods 2013, 5, 1620–1632. [Google Scholar] [CrossRef] [Scilit]
- Hodson, L.; Rosqvist, F.; Parry, S.A. The influence of dietary fatty acids on liver fat content and metabolism. Proc. Nutr. Soc. 2020, 79, 30–41. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shi, L.; Jiang, Z.Y.; Zhang, L. Childhood obesity and central precocious puberty. Front. Endocrinol. 2022, 13, 1056871. [Google Scholar] [CrossRef] [Scilit]
- Wagner, I.V.; Sabin, M.A.; Pfaeffle, R.W.; Hiemisch, A.; Sergeyev, E.; Koerner, A.; Kiess, W. Effects of obesity on human sexual development. Nat. Rev. Endocrinol. 2012, 8, 246–254. [Google Scholar] [CrossRef] [Scilit]
- Yu, H.J.; Li, F.; Hu, Y.F.; Li, C.F.; Yuan, S.; Song, Y.; Zheng, M.B.; Gong, J.; He, Q.Q. Improving the Metabolic and Mental Health of Children with Obesity: A School-Based Nutrition Education and Physical Activity Intervention in Wuhan, China. Nutrients 2020, 12, 194. [Google Scholar] [CrossRef] [Scilit]
- Kim, J.H.; Lee, S.W.; Lee, J.E.; Ha, E.K.; Han, M.Y.; Lee, E. Breastmilk Feeding during the First 4 to 6 Months of Age and Childhood Disease Burden until 10 Years of Age. Nutrients 2021, 13, 2825. [Google Scholar] [CrossRef] [Scilit]
- Nakayama, J.; Yamamoto, A.; Palermo-Conde, L.A.; Higashi, K.; Sonomoto, K.; Tan, J.; Lee, Y.K. Impact of Westernized Diet on Gut Microbiota in Children on Leyte Island. Front. Microbiol. 2017, 8, 197. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- López-Contreras, B.E.; Morán-Ramos, S.; Villarruel-Vázquez, R.; Macías-Kauffer, L.; Villamil-Ramírez, H.; León-Mimila, P.; Vega-Badillo, J.; Sánchez-Muñoz, F.; Llanos-Moreno, L.E.; Canizalez-Román, A.; et al. Composition of gut microbiota in obese and normal-weight Mexican school-age children and its association with metabolic traits. Pediatr. Obes. 2018, 13, 381–388. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Stellaard, F.; Lütjohann, D. Dynamics of the enterohepatic circulation of bile acids in healthy humans. Am. J. Physiol.-Gastrointest. Liver Physiol. 2021, 321, G55–G66. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fiorucci, S.; Baldoni, M.; Ricci, P.; Zampella, A.; Distrutti, E.; Biagioli, M. Bile acid-activated receptors and the regulation of macrophages function in metabolic disorders. Curr. Opin. Pharmacol. 2020, 53, 45–54. [Google Scholar] [CrossRef] [Scilit]
- Sciarrillo, C.M.; Keirns, B.H.; Koemel, N.A.; Anderson, K.L.; Emerson, S.R. Fibroblast Growth Factor 19: Potential modulation of hepatic metabolism for the treatment of non-alcoholic fatty liver disease. Liver Int. 2021, 41, 894–904. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ge, X.; Chang, C.e.; Chen, H.; Liu, T.; Chen, L.; Huang, Y.; Zeng, F.; Liu, B. Luteolin cooperated with metformin hydrochloride alleviates lipid metabolism disorders and optimizes intestinal flora compositions of high-fat diet mice. Food Funct. 2020, 11, 10033–10046. [Google Scholar] [CrossRef] [Scilit]
- Esquejo, R.M.; Roqueta-Rivera, M.; Shao, W.; Phelan, P.E.; Seneviratne, U.; Ende, C.W.a.; Hershberger, P.M.; Machamer, C.E.; Espenshade, P.J.; Osborne, T.F. Dipyridamole Inhibits Lipogenic Gene Expression by Retaining SCAP-SREBP in the Endoplasmic Reticulum. Cell Chem. Biol. 2021, 28, 169–179. [Google Scholar] [CrossRef] [Scilit]
- Geng, Y.; Faber, K.N.; Meijer, V.E.D.; Blokzijl, H.; Moshage, H. How does hepatic lipid accumulation lead to lipotoxicity in non-alcoholic fatty liver disease? Hepatol. Int. 2021, 15, 21–35. [Google Scholar] [CrossRef] [Scilit]
- Aggarwal, B.B. Targeting Inflammation-Induced Obesity and Metabolic Diseases by Curcumin and Other Nutraceuticals. Annu. Rev. Nutr. 2010, 30, 173–199. [Google Scholar] [CrossRef] [Scilit]
- Jia, W.; Xie, G.; Jia, W. Bile acid-microbiota crosstalk in gastrointestinal inflammation and carcinogenesis. Nat. Rev. Gastroenterol. Hepatol. 2018, 15, 111–128. [Google Scholar] [CrossRef] [Scilit]
- Wang, L.; Zhang, P.; Li, C.; Xu, F.; Chen, J. A polysaccharide from Rosa roxburghii Tratt fruit attenuates high-fat diet-induced intestinal barrier dysfunction and inflammation in mice by modulating the gut microbiota. Food Funct. 2022, 13, 530–547. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Little, T.J.; Horowitz, M.; Feinle-Bisset, C. Role of cholecystokinin in appetite control and body weight regulation. Obes. Rev. 2005, 6, 297–306. [Google Scholar] [CrossRef] [Scilit]
- Farhadipour, M.; Depoortere, I. The Function of Gastrointestinal Hormones in Obesity-Implications for the Regulation of Energy Intake. Nutrients 2021, 13, 1839. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al Shukor, N.; Ravallec, R.; Van Camp, J.; Raes, K.; Smagghe, G. Flavonoids stimulate cholecystokinin peptide secretion from the enteroendocrine STC-1 cells. Fitoterapia 2016, 113, 128–131. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kiran, S.; Rakib, A.; Kodidela, S.; Kumar, S.; Singh, U.P. High-Fat Diet-Induced Dysregulation of Immune Cells Correlates with Macrophage Phenotypes and Chronic Inflammation in Adipose Tissue. Cells 2022, 11, 1327. [Google Scholar] [CrossRef] [Scilit]
- Artemniak-Wojtowicz, D.; Kucharska, A.; Pyrzak, B. Obesity and chronic inflammation crosslinking. Cent. Eur. J. Immunol. 2020, 45, 461–468. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Park, S.S.; Lee, Y.J.; Kang, H.; Yang, G.; Hong, E.J.; Lim, J.Y.; Oh, S.; Kim, E. Lactobacillus amylovorus KU4 ameliorates diet-induced obesity in mice by promoting adipose browning through PPARγ signaling. Sci. Rep. 2019, 9, 20152. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Li, H.Z.; Liu, F.; Lu, J.J.; Shi, J.L.; Guan, J.Q.; Yan, F.F.; Li, B.L.; Huo, G.C. Probiotic Mixture of Lactobacillus plantarum Strains Improves Lipid Metabolism and Gut Microbiota Structure in High Fat Diet-Fed Mice. Front. Microbiol. 2020, 11, 512. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ismail, N.A.; Ragab, S.H.; ElBaky, A.A.; Shoeib, A.R.S.; Alhosary, Y.; Fekry, D. Frequency of Firmicutes and Bacteroidetes in gut microbiota in obese and normal weight Egyptian children and adults. Arch. Med. Sci. 2011, 7, 501–507. [Google Scholar] [CrossRef] [Scilit]
- Hou, Y.P.; He, Q.Q.; Ouyang, H.M.; Peng, H.S.; Wang, Q.; Li, J.; Lv, X.F.; Zheng, Y.N.; Li, S.C.; Liu, H.L.; et al. Human Gut Microbiota Associated with Obesity in Chinese Children and Adolescents. BioMed Res. Int. 2017, 2017, 7585989. [Google Scholar] [CrossRef] [Scilit]
- Karlsson, C.L.J.; Onnerfalt, J.; Xu, J.; Molin, G.; Ahrne, S.; Thorngren-Jerneck, K. The Microbiota of the Gut in Preschool Children with Normal and Excessive Body Weight. Obesity 2012, 20, 2257–2261. [Google Scholar] [CrossRef] [Scilit] [PubMed]






| Variable | OB-FF | N-FF | p-Values |
|---|---|---|---|
| Male/female | 10/7 | 14/14 | / |
| Age, years | 10.27 ± 2.66 | 9.07 ± 2.33 | 0.1167 |
| Height, m | 1.48 ± 0.17 | 1.33 ± 0.14 | 0.0035 |
| Weight, kg | 59.55 ± 17.79 | 29.11 ± 8.24 | <0.0001 |
| BMI, kg/m2 | 26.48 ± 3.69 | 15.97 ± 1.63 | <0.0001 |
| Gene | Forward Primer | Reverse Primer |
|---|---|---|
| SREBP-1C | GCGCTACCGGTCTTCTATCA | TGCTGCCAAAAGACAAGGG |
| FAS | CTGCGGAAACTTCAGGAAATG | GGTTCGGAATGCTATCCAGG |
| FXR | ACATCCCCATCTCTCTGCAC | TGTGAGGGCTGCAAAGGTTT |
| SHP | CGATCCTCTTCAACCCAGATG | AGGGCTCCAAGACTTCACACA |
| β-actin | CCTAAGGCCAACCGTGAAAAG | TCTTCATGGTGCTAGGAGCCA |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Liang, C.; Zhang, L.-W. Profiling the Gut Microbiota in Obese Children with Formula Feeding in Early Life and Selecting Strains against Obesity. Foods 2024, 13, 1379. https://doi.org/10.3390/foods13091379
Liang C, Zhang L-W. Profiling the Gut Microbiota in Obese Children with Formula Feeding in Early Life and Selecting Strains against Obesity. Foods. 2024; 13(9):1379. https://doi.org/10.3390/foods13091379
Chicago/Turabian StyleLiang, Cong, and Lan-Wei Zhang. 2024. "Profiling the Gut Microbiota in Obese Children with Formula Feeding in Early Life and Selecting Strains against Obesity" Foods 13, no. 9: 1379. https://doi.org/10.3390/foods13091379
APA StyleLiang, C., & Zhang, L.-W. (2024). Profiling the Gut Microbiota in Obese Children with Formula Feeding in Early Life and Selecting Strains against Obesity. Foods, 13(9), 1379. https://doi.org/10.3390/foods13091379

