HSF3 and Hsp70 Expression during Post-Hatch Cold Stress in Broiler Chickens Subjected to Embryonic Thermal Manipulation
Abstract
1. Introduction
2. Materials and Methods
2.1. Incubation
2.2. Hatchery Management
2.3. Cold Stress
2.4. RNA Isolation and cDNA Synthesis
2.5. Primer Design
2.6. Real-Time qRT-qPCR
2.7. Statistical Analysis
3. Results
3.1. Effect of Embryonic Thermal Manipulation (TM) on Physiological Parameters
3.2. Effect of Post-Hatch Cold Stress (CS) on the Physiological Parameters
3.3. Effect of Post-Hatch Cold Stress (CS) on the mRNA Levels of HSF3
3.3.1. Hepatic Expression
3.3.2. Splenic Expression
3.4. Effect of Post-Hatch Cold Stress (CS) on the mRNA Levels of Hsp70
3.4.1. Hepatic Expression
3.4.2. Splenic Expression
4. Discussion
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Renema, R.A.; Rustad, M.E.; Robinson, F.E. Implications of changes to commercial broiler and broiler breeder body weight targets over the past 30 years. Worlds. Poult. Sci. J. 2007, 63, 457–472. [Google Scholar] [CrossRef] [Scilit]
- Bennett, C.E.; Thomas, R.; Williams, M.; Zalasiewicz, J.; Edgeworth, M.; Miller, H.; Coles, B.; Foster, A.; Burton, E.J.; Marume, U. The broiler chicken as a signal of a human reconfigured biosphere. R. Soc. Open Sci. 2018, 5, 180325. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Shrader, H.L. The Chicken-of-Tomorrow Program; Its Influence on “Meat-Type” Poultry Production. Poult. Sci. 1952, 31, 3–10. [Google Scholar] [CrossRef] [Scilit]
- Tallentire, C.W.; Leinonen, I.; Kyriazakis, I. Breeding for efficiency in the broiler chicken: A review. Agron. Sustain. Dev. 2016, 36, 66. [Google Scholar] [CrossRef] [Scilit]
- Zuidhof, M.J.; Schneider, B.L.; Carney, V.L.; Korver, D.R.; Robinson, F.E. Growth, efficiency, and yield of commercial broilers from 1957, 1978, and 20051. Poult. Sci. 2014, 93, 2970–2982. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaboli, G.; Huang, X.; Feng, X.; Ahn, D.U. How can heat stress affect chicken meat quality?—A review. Poult. Sci. 2019, 98, 1551–1556. [Google Scholar] [CrossRef] [Scilit]
- Weaver, W.D. Poultry Housing. In Commercial Chicken Meat and Egg Production; Springer: Norwell, MA, USA, 2002; pp. 101–111. [Google Scholar]
- Lourençoni, D.; Junior, T.Y.; de Yanagi, S.N.M.; de Abreu, P.G.; Campos, A.T. Productive responses from broiler chickens raised in different commercial production system-part II: Impact of climate change. Eng. Agric. 2019, 39, 11–17. [Google Scholar] [CrossRef] [Scilit]
- Tickle, P.G.; Hutchinson, J.R.; Codd, J.R. Energy allocation and behaviour in the growing broiler chicken. Sci. Rep. 2018, 8, 4562. [Google Scholar] [CrossRef] [Scilit]
- Lara, L.J.; Rostagno, M.H. Impact of Heat Stress on Poultry Production. Animal 2013, 3, 356–369. [Google Scholar] [CrossRef] [Scilit]
- Mengesha, M. Climate change and the preference of rearing poultry for the demands of protein foods. Asian J. Poult. Sci. 2011, 5, 135–143. [Google Scholar] [CrossRef] [Scilit]
- Cedraz, H.; Gromboni, J.G.G.; Garcia, A.A.P.; Farias Filho, R.V.; Souza, T.M.; de Oliveira, E.R.; de Oliveira, E.B.; do Nascimento, C.S.; Meneghetti, C.; Wenceslau, A.A. Heat stress induces expression of HSP genes in genetically divergent chickens. PLoS ONE 2017, 12, e0186083. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Zghoul, M.B.; Saleh, K.M.; Ababneh, M.M.K. Effects of pre-hatch thermal manipulation and post-hatch acute heat stress on the mRNA expression of interleukin-6 and genes involved in its induction pathways in 2 broiler chicken breeds. Poult. Sci. 2019, 98, 1805–1819. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Guertin, M.J.; Petesch, S.J.; Zobeck, K.L.; Min, I.M.; Lis, J.T. Drosophila heat shock system as a general model to investigate transcriptional regulation. Cold Spring Harb. Symp. Quant. Biol. 2010, 75, 1–9. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Causton, H.C.; Ren, B.; Koh, S.S.; Harbison, C.T.; Kanin, E.; Jennings, E.G.; Lee, T.I.; True, H.L.; Lander, E.S.; Young, R.A. Remodeling of yeast genome expression in response to environmental changes. Mol. Biol. Cell 2001, 12, 323–337. [Google Scholar] [CrossRef] [Scilit]
- Gasch, A.P.; Spellman, P.T.; Kao, C.M.; Carmel-Harel, O.; Eisen, M.B.; Storz, G.; Botstein, D.; Brown, P.O. Genomic expression programs in the response of yeast cells to environmental changes. Mol. Biol. Cell 2000, 11, 4241–4257. [Google Scholar] [CrossRef] [Scilit]
- Weake, V.M.; Workman, J.L. Inducible gene expression: Diverse regulatory mechanisms. Nat. Rev. Genet. 2010, 11, 426–437. [Google Scholar] [CrossRef] [Scilit]
- Surai, P.F.; Kochish, I.I.; Fisinin, V.I.; Kidd, M.T. Antioxidant defence systems and oxidative stress in poultry biology: An update. Antioxidants 2019, 8, 235. [Google Scholar] [CrossRef] [Scilit]
- Nitika; Truman, A.W. Cracking the Chaperone Code: Cellular Roles for Hsp70 Phosphorylation. Trends Biochem. Sci. 2017, 42, 932–935. [Google Scholar] [CrossRef] [Scilit]
- Asea, A.; Rehli, M.; Kabingu, E.; Boch, J.A.; Baré, O.; Auron, P.E.; Stevenson, M.A.; Calderwood, S.K. Novel signal transduction pathway utilized by extracellular HSP70. Role of toll-like receptor (TLR) 2 and TLR4. J. Biol. Chem. 2002, 277, 15028–15034. [Google Scholar] [CrossRef] [Scilit]
- Liu, T.; Zhang, L.; Joo, D.; Sun, S.C. NF-κB signaling in inflammation. Signal Transduct. Target. Ther. 2017, 2, 1–7. [Google Scholar] [CrossRef] [Scilit]
- Hoesel, B.; Schmid, J.A. The complexity of NF-κB signaling in inflammation and cancer. Mol. Cancer 2013, 12, 86. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tanabe, M.; Kawazoe, Y.; Takeda, S.; Morimoto, R.I.; Nagata, K.; Nakai, A. Disruption of the HSF3 gene results in the severe reduction of heat shock gene expression and loss of thermotolerance. EMBO J. 1998, 17, 1750–1758. [Google Scholar] [CrossRef] [Scilit]
- Prakasam, R.; Fujimoto, M.; Takii, R.; Hayashida, N.; Takaki, E.; Tan, K.; Wu, F.; Inouye, S.; Nakai, A. Chicken IL-6 is a heat-shock gene. FEBS Lett. 2013, 587, 3541–3547. [Google Scholar] [CrossRef] [Scilit]
- Yalcin, S.; Siegel, P. Exposure to cold or heat during incubation on developmental stability of broiler embryos. Poult. Sci. 2003, 82, 1388–1392. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Yahav, S.; Rath, R.S.; Shinder, D. The effect of thermal manipulations during embryogenesis of broiler chicks (Gallus domesticus) on hatchability, body weight and thermoregulation after hatch. J. Therm. Biol. 2004, 29, 245–250. [Google Scholar] [CrossRef] [Scilit]
- Al-Zghoul, M.B.; Al-Natour, M.Q.; Dalab, A.S.; Alturki, O.I.; Althnaian, T.; Al-ramadan, S.Y.; Hannon, K.M. Thermal manipulation mid-term broiler chicken embryogenesis: Effect on muscle growth factors and muscle marker genes. Rev. Bras. Cienc. Avic. 2016, 18, 607–618. [Google Scholar] [CrossRef] [Scilit]
- Loyau, T.; Hennequet-Antier, C.; Coustham, V.; Berri, C.; Leduc, M.; Crochet, S.; Sannier, M.; Duclos, M.J.; Mignon-Grasteau, S.; Tesseraud, S.; et al. Thermal manipulation of the chicken embryo triggers differential gene expression in response to a later heat challenge. BMC Genom. 2016, 17, 329. [Google Scholar] [CrossRef] [Scilit]
- Saleh, K.M.M.; Tarkhan, A.H.; Al-Zghoul, M.B. Embryonic Thermal Manipulation Affects the Antioxidant Response to Post-Hatch Thermal Exposure in Broiler Chickens. Animals 2020, 10, 126. [Google Scholar] [CrossRef] [Scilit]
- Al-Zghoul, M.B.; Mohammad Saleh, K.M. Effects of thermal manipulation of eggs on the response of jejunal mucosae to posthatch chronic heat stress in broiler chickens. Poult. Sci. 2020. [Google Scholar] [CrossRef] [Scilit]
- Collin, A.; Berri, C.; Tesseraud, S.; Rodon, F.E.R.; Skiba-Cassy, S.; Crochet, S.; Duclos, M.J.; Rideau, N.; Tona, K.; Buyse, J.; et al. Effects of Thermal Manipulation During Early and Late Embryogenesis on Thermotolerance and Breast Muscle Characteristics in Broiler Chickens. Poult. Sci. 2007, 86, 795–800. [Google Scholar] [CrossRef] [Scilit]
- Al-Zghoul, M.B.; El-Bahr, S.M. Thermal manipulation of the broilers embryos: Expression of muscle markers genes and weights of body and internal organs during embryonic and post-hatch days. BMC Vet. Res. 2019, 15, 166. [Google Scholar] [CrossRef] [Scilit]
- Dalab, A.S.; Ali, A.M. Morphological investigations of the effect of thermal manipulation during embryogenesis on body performance and structure of pectoral and thigh muscle of ross broiler chicken. Rev. Bras. Cienc. Avic. 2019, 21. [Google Scholar] [CrossRef] [Scilit]
- Al-Zghoul, M.B.; Dalab, A.E.S.; Yahya, I.E.; Althnaian, T.A.; Al-ramadan, S.Y.; Ali, A.M.; Albokhadaim, I.F.; El-Bahr, S.M.; Al Busadah, K.A.; Hannon, K.M. Thermal manipulation during broiler chicken embryogenesis: Effect on mRNA expressions of Hsp108, Hsp70, Hsp47 and Hsf-3 during subsequent post-hatch thermal challenge. Res. Vet. Sci. 2015, 103, 211–217. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Al-Zghoul, M.B. Thermal manipulation during broiler chicken embryogenesis increases basal mRNA levels and alters production dynamics of heat shock proteins 70 and 60 and heat shock factors 3 and 4 during thermal stress. Poult. Sci. 2018, 97, 3661–3670. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Narinç, D.; Erdoğan, S.; Tahtabiçen, E.; Aksoy, T. Effects of thermal manipulations during embryogenesis of broiler chickens on developmental stability, hatchability and chick quality. Animal 2016, 10, 1328–1335. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Collin, A.; Picard, M.; Yahav, S. The effect of duration of thermal manipulation during broiler chick embryogenesis on body weight and body temperature of post-hatched chicks. Anim. Res. 2005, 54, 105–111. [Google Scholar] [CrossRef] [Scilit]
- Yassin, H.; Velthuis, A.G.J.; Boerjan, M.; Van Riel, J.; Huirne, R.B.M. Field study on broiler eggs hatchability. Poult. Sci. 2008, 87, 2408–2417. [Google Scholar] [CrossRef] [Scilit]
- Vitorino Carvalho, A.; Hennequet-Antier, C.; Crochet, S.; Bordeau, T.; Couroussé, N.; Cailleau-Audouin, E.; Chartrin, P.; Darras, V.M.; Zerjal, T.; Collin, A.; et al. Embryonic thermal manipulation has short and long-term effects on the development and the physiology of the Japanese quail. PLoS ONE 2020, 15, e0227700. [Google Scholar] [CrossRef] [Scilit]
- Elsayed, M.A. Effects of thermal manipulation during late incubation period on post-hatch thermotolerance in ostrich. Czech J. Anim. Sci. 2016, 61, 421–431. [Google Scholar] [CrossRef] [Scilit]
- Piestun, Y.; Halevy, O.; Shinder, D.; Ruzal, M.; Druyan, S.; Yahav, S. Thermal manipulations during broiler embryogenesis improves post-hatch performance under hot conditions. J. Therm. Biol. 2011, 36, 469–474. [Google Scholar] [CrossRef] [Scilit]
- Al-Zhgoul, M.B.; Dalab, A.E.S.; Ababneh, M.M.; Jawasreh, K.I.; Al Busadah, K.A.; Ismail, Z.B. Thermal manipulation during chicken embryogenesis results in enhanced Hsp70 gene expression and the acquisition of thermotolerance. Res. Vet. Sci. 2013, 95, 502–507. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Piestun, Y.; Shinder, D.; Ruzal, M.; Halevy, O.; Yahav, S. The effect of thermal manipulations during the development of the thyroid and adrenal axes on in-hatch and post-hatch thermoregulation. J. Therm. Biol. 2008, 33, 413–418. [Google Scholar] [CrossRef] [Scilit]
- Al-Zghoul, M.B.; Alliftawi, A.R.S.; Saleh, K.M.M.; Jaradat, Z.W. Expression of digestive enzyme and intestinal transporter genes during chronic heat stress in the thermally manipulated broiler chicken. Poult. Sci. 2019, 98, 4113–4122. [Google Scholar] [CrossRef] [Scilit]
- Lourens, A.; Van Den Brand, H.; Meijerhof, R.; Kemp, B. Effect of eggshell temperature during incubation on embryo development, hatchability, and posthatch development. Poult. Sci. 2005, 84, 914–920. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Loyau, T.; Berri, C.; Bedrani, L.; Métayer-Coustard, S.; Praud, C.; Duclos, M.J.; Tesseraud, S.; Rideau, N.; Everaert, N.; Yahav, S.; et al. Thermal manipulation of the embryo modifies the physiology and body composition of broiler chickens reared in floor pens without affecting breast meat processing quality1. J. Anim. Sci. 2013, 91, 3674–3685. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mack, L.A.; Felver-Gant, J.N.; Dennis, R.L.; Cheng, H.W. Genetic variations alter production and behavioral responses following heat stress in 2 strains of laying hens. Poult. Sci. 2013, 92, 285–294. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zaboli, G.-R.; Rahimi, S.; Shariatmadari, F.; Torshizi, M.A.K.; Baghbanzadeh, A.; Mehri, M. Thermal manipulation during Pre and Post-Hatch on thermotolerance of male broiler chickens exposed to chronic heat stress. Poult. Sci. 2017, 96, 478–485. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Mashaly, M.M.; Hendricks, G.L.; Kalama, M.A.; Gehad, A.E.; Abbas, A.O.; Patterson, P.H. Effect of heat stress on production parameters and immune responses of commercial laying hens. Poult. Sci. 2004, 83, 889–894. [Google Scholar] [CrossRef] [Scilit]
- Piestun, Y.; Yahav, S.; Halevy, O. Thermal manipulation during embryogenesis affects myoblast proliferation and skeletal muscle growth in meat-type chickens. Poult. Sci. 2015, 94, 2528–2536. [Google Scholar] [CrossRef] [Scilit]
- Tanabe, M.; Nakai, A.; Kawazoe, Y.; Nagata, K. Different thresholds in the responses of two heat shock transcription factors, HSF1 and HSF3. J. Biol. Chem. 1997, 272, 15389–15395. [Google Scholar] [CrossRef] [Scilit]
- Takii, R.; Fujimoto, M.; Matsuura, Y.; Wu, F.; Oshibe, N.; Takaki, E.; Katiyar, A.; Akashi, H.; Makino, T.; Kawata, M.; et al. HSF1 and HSF3 cooperatively regulate the heat shock response in lizards. PLoS ONE 2017, 12, e0180776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kanei-Ishii, C.; Tanikawa, J.; Nakai, A.; Morimoto, R.I.; Ishii, S. Activation of heat shock transcription factor 3 by c-Myb in the absence of cellular stress. Science 1997, 277, 246–248. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Fulda, S.; Gorman, A.M.; Hori, O.; Samali, A. Cellular stress responses: Cell survival and cell death. Int. J. Cell Biol. 2010. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vinoth, A.; Thirunalasundari, T.; Shanmugam, M.; Uthrakumar, A.; Suji, S.; Rajkumar, U. Evaluation of DNA methylation and mRNA expression of heat shock proteins in thermal manipulated chicken. Cell Stress Chaperones 2018, 23, 235–252. [Google Scholar] [CrossRef] [Scilit]






| Gene | Sequence (5′ to 3′) |
|---|---|
| 28S rRNA 1 | F: CCTGAATCCCGAGGTTAACTATT R: GAGGTGCGGCTTATCATCTATC |
| HSF3 | F: TTAGAGAGGTTGGAGGGTATGA R: GAATCTGCTCGAGGCGTATAG |
| Hsp70 | F: AGAGGAAACTGTGACCCGATGA R: AACGAAGAGGAAGATGGCGA |
| Parameter | Control | TM |
|---|---|---|
| Total eggs | 266 | 268 |
| Hatched eggs | 248 | 234 |
| Hatchability | 93.23% a | 87.31% b |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tarkhan, A.H.; Saleh, K.M.M.; Al-Zghoul, M.B. HSF3 and Hsp70 Expression during Post-Hatch Cold Stress in Broiler Chickens Subjected to Embryonic Thermal Manipulation. Vet. Sci. 2020, 7, 49. https://doi.org/10.3390/vetsci7020049
Tarkhan AH, Saleh KMM, Al-Zghoul MB. HSF3 and Hsp70 Expression during Post-Hatch Cold Stress in Broiler Chickens Subjected to Embryonic Thermal Manipulation. Veterinary Sciences. 2020; 7(2):49. https://doi.org/10.3390/vetsci7020049
Chicago/Turabian StyleTarkhan, Amneh H., Khaled M. M. Saleh, and Mohammad Borhan Al-Zghoul. 2020. "HSF3 and Hsp70 Expression during Post-Hatch Cold Stress in Broiler Chickens Subjected to Embryonic Thermal Manipulation" Veterinary Sciences 7, no. 2: 49. https://doi.org/10.3390/vetsci7020049
APA StyleTarkhan, A. H., Saleh, K. M. M., & Al-Zghoul, M. B. (2020). HSF3 and Hsp70 Expression during Post-Hatch Cold Stress in Broiler Chickens Subjected to Embryonic Thermal Manipulation. Veterinary Sciences, 7(2), 49. https://doi.org/10.3390/vetsci7020049

