Bioexploration and Phylogenetic Placement of Entomopathogenic Fungi of the Genus Beauveria in Soils of Lebanon Cedar Forests
Abstract
:1. Introduction
2. Materials and Methods
2.1. Study Sites and Collection of Soil Samples
2.2. Isolation of EPF from Soil by Means of Insect Bait
2.3. Isolation of EPF from Soil by Means of Selective Media
2.4. Morphological Identification of Fungal Isolates
2.5. Molecular Characterization
2.6. Phylogenetic Analysis
2.7. Statistical Analysis
3. Results
3.1. Occurrence of EPF
3.2. Morphological Characterization of Beauveria Isolates
3.3. Phylogenetic Placement of Isolates
3.4. Taxonomy
3.4.1. Mycobank: MB 832258
3.4.2. Mycobank: MB 832259
4. Discussion
4.1. Bioexploration of EPF
4.2. Identification and Phylogenetic Placement
4.3. Occurence of EPF
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Acknowledgments
Conflicts of Interest
References
- Keller, S.; Zimmermann, G. Mycopathogens of soil insects. In Insect-Fungus Interactions; Wilding, N., Collins, N.M., Hammond, P.M., Webber, J.F., Eds.; Academic Press: London, UK, 1989; pp. 239–270. [Google Scholar]
- Rehner, S.A.; Minnis, A.M.; Sung, G.; Luangsa-ard, J.J.; Devotto, L.; Humber, R.A. Phylogeny and systematics of the anamorphic, entomopathogenic genus Beauveria. Mycologia 2011, 103, 1055–1073. [Google Scholar] [CrossRef]
- de Faria, M.R.; Wraight, S.P. Mycoinsecticides and mycoacaricides: A comprehensive list with worldwide coverage and international classification of formulation types. Biol. Control 2007, 43, 237–256. [Google Scholar] [CrossRef]
- Li, Z.Z. A list of insect hosts of Beauveria bassiana. In Study and Application of Entomogenous Fungi in China; Li, Y.W., Li, Z.Z., Liang, Z.Q., Wu, J.W., Wu, Z.K., Xi., Q.F., Eds.; Academic Periodical Press: Beijing, China, 1988; Volume 1, pp. 241–255. [Google Scholar]
- Chandler, D.; Davidson, G.; Pell, J.K.; Ball, B.V.; Shaw, K.; Sunderland, K.D. Fungal biocontrol of Acari. Biocontrol Sci. Technol. 2000, 10, 357–384. [Google Scholar] [CrossRef]
- Al Khoury, C.; Nemer, N.; Nemer, G. Beauvericin potentiates the activity of pesticides by neutralizing the ATP-binding cassette transporters in arthropods. Sci. Rep. 2021, 11, 10865. [Google Scholar] [CrossRef]
- Al Khoury, C.; Nemer, N.; Nemer, G.; Kurban, M.; Bernigaud, C.; Fischer, K.; Guillot, J. In vitro activity of beauvericin against all developmental stages of Sarcoptes scabiei. Antimicrob. Agents Chemother. 2020, 64, 2118. [Google Scholar] [CrossRef] [PubMed]
- Wu, Q.; Patocka, J.; Nepovimova, E.; Kuca, K. A review on the synthesis and bioactivity aspects of beauvericin, a Fusarium mycotoxin. Front. Pharmacol. 2018, 9, 1338. [Google Scholar] [CrossRef] [Green Version]
- Zhang, S.; He, L.; Chen, X.; Huang, B. Beauveria lii sp. nov. isolated from Henosepilachna vigintioctopunctata. Mycotaxon 2013, 121, 199–206. [Google Scholar] [CrossRef]
- Robène-Soustrade, I.; Jouen, E.; Pastou, D.; Payet-Hoarau, M.; Goble, T.; Linderme, D.; Lefeuvre, P.; Calmès, C.; Reynaud, B.; Nibouche, S. Description and phylogenetic placement of Beauveria hoplocheli sp. nov. used in the biological control of the sugarcane white grub, Hoplochelus marginalis, on Reunion Island. Mycologia 2015, 107, 1221–1232. [Google Scholar] [CrossRef] [PubMed]
- Abdo, C.; Nemer, N.; Nemer, G.; Abou Jawdah, Y.; Atamian, H.; Kawar, N.S. Isolation of Beauveria species from Lebanon and evaluation of its efficacy against the cedar web-spinning sawfly, Cephalcia tannourinensis. Biocontrol 2008, 53, 341–352. [Google Scholar] [CrossRef]
- Nemer, N.; El Beyrouthy, M.; Lahoud, C.; Mnif, W.; Bashour, I.; Kawar, N. The influence of soil properties on the development of Cephalcia tannourinensis Chevin (Hym. Pamphiliidae) infesting the cedar forests in Lebanon. Afr. J. Biotechnol. 2014, 13, 4369–4381. [Google Scholar]
- Nemer, N.; Demolin, G.; Kawar, N.; Kfoury, L.; Zakhour, E. Monitoring of the new cedar web-spinning sawfly, Cephalcia tannourinensis n. sp. in cedar forests of Lebanon. In Entomological Research in Mediterranean Forest Ecosystems; Lieutier, F., Ghaioule, D., Eds.; INRA Publications: Paris, France, 2005; pp. 247–255. [Google Scholar]
- Zimmermann, G. The ‘Galleria bait method’ for detection of entomopathogenic fungi in soil. J. Appl. Entomol. 1986, 102, 213–215. [Google Scholar] [CrossRef]
- Meyling, N.V.; Eilenberg, J. Isolation and characterisation of Beauveria bassiana isolates from phylloplanes of hedgerow vegetation. Mycol. Res. 2006, 110, 188–195. [Google Scholar] [CrossRef]
- Beilharz, V.C.; Parbery, D.G.; Swart, H.J. Dodine: A selective agent for certain soil fungi. Trans. Br. Mycol. Soc. 1982, 79, 507–511. [Google Scholar] [CrossRef]
- Keller, S.; Kessler, P.; Schweizer, C. Distribution of insect pathogenic soil fungi in Switzerland with special reference to Beauveria brongniartii and Metharhizium anisopliae. Biocontrol 2003, 48, 307–319. [Google Scholar] [CrossRef]
- Kessler, P.; Matzke, H.; Keller, S. The effect of application time and soil factors on the occurrence of Beauveria brongniartii applied as a biological control agent in soil. J. Invertebr. Pathol. 2003, 84, 15–23. [Google Scholar] [CrossRef]
- Kessler, P.; Enkerl, J.; Schweize, C.; Keller, S. Survival of Beauveria brongniartii in the soil after application as a biocontrol agent against the European cockchafer Melolontha melolontha. Biocontrol 2004, 49, 563–581. [Google Scholar] [CrossRef]
- Enkerli, J.; Widmer, F.; Keller, S. Long-term field persistence of Beauveria brongniartii strains applied as biocontrol agents against European cockchafer larvae in Switzerland. Biol. Control 2004, 29, 115–123. [Google Scholar] [CrossRef]
- Posadas, J.B.; Comerio, R.M.; Mini, J.I.; Nussenbaum, A.L.; Lecuona, R.E. A novel dodine-free selective medium based on the use of cetyl trimethyl ammonium bromide (CTAB) to isolate Beauveria bassiana, Metarhizium anisopliae sensu lato and Paecilomyces lilacinus from soil. Mycologia 2012, 104, 974–980. [Google Scholar] [CrossRef]
- Shimazu, M.; Sato, H. Media for selective isolation of an entomogenous fungus, Beauveria bassiana (Deuteromycotina: Hyphomycetes). Appl. Entomol. Zool. 1996, 31, 291–298. [Google Scholar] [CrossRef] [Green Version]
- Humber, R.A. Fungal pathogens and parasites of insects. In Applied Microbial Systematics; Priest, F.G., Goodfellow, M., Eds.; Kluwer Academic Publishers: Derdrecht, The Netherlands, 2000; pp. 203–230. [Google Scholar]
- Rehner, S.A.; Buckley, E. A Beauveria phylogeny inferred from nuclear ITS and EF1-α sequences: Evidence for cryptic diversification and links to Cordyceps teleomorphs. Mycologia 2005, 97, 84–98. [Google Scholar] [CrossRef] [PubMed]
- Rehner, S.A.; Posada, F.; Buckley, E.P.; Infante, F.; Castillo, A.; Vega, F.E. Phylogenetic origins of African and Neotropical Beauveria bassiana sl pathogens of the coffee berry borer, Hypothenemus hampei. J. Invertebr. Pathol. 2006, 93, 11–21. [Google Scholar] [CrossRef] [PubMed]
- Nemer, G.; Fadlalah, F.; Usta, J.; Nemer, M.; Dbaibo, G.; Obeid, M.; Bitar, F. A novel mutation in the GATA4 gene in patients with Tetralogy of Fallot. Hum. Mutat. 2006, 27, 293–294. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.J.; Whelen, S.; Hall, B.D. Phylogenetic relationships among ascomycetes: Evidence from an RNA polymerse II subunit. Mol. Biol. Evol. 1999, 16, 1799–1808. [Google Scholar] [CrossRef]
- Reeb, V.; Lutzoni, F.; Roux, C. Contribution of RPB2 to multilocus phylogenetic studies of the euascomycetes (Pezizomycotina, Fungi) with special emphasis on the lichen-forming Acarosporaceae and evolution of polyspory. Mol. Phylogenet. Evol. 2004, 32, 1036–1060. [Google Scholar] [CrossRef] [PubMed]
- White, T.J.; Bruns, T.; Lee, S.; Taylor, J. Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protoc. A Guide Methods Appl. 1990, 18, 315–322. [Google Scholar]
- Edgar, R.C. MUSCLE: Multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Res. 2004, 32, 1792–1797. [Google Scholar] [CrossRef] [Green Version]
- Kumar, S.; Stecher, G.; Li, M.; Knyaz, C.; Tamura, K. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol. Biol. Evol. 2018, 35, 1547. [Google Scholar] [CrossRef]
- Vaidya, G.; Lohman, D.J.; Meier, R. SequenceMatrix: Concatenation software for the fast assembly of multi-gene datasets with character set and codon information. Cladistics 2011, 27, 171–180. [Google Scholar] [CrossRef]
- Kalyaanamoorthy, S.; Minh, B.Q.; Wong, T.K.; Von Haeseler, A.; Jermiin, L.S. ModelFinder: Fast model selection for accurate phylogenetic estimates. Nat. Methods 2017, 14, 587–589. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Minh, B.Q.; Nguyen, M.A.T.; von Haeseler, A. Ultrafast approximation for phylogenetic bootstrap. Mol. Biol. Evol. 2013, 30, 1188–1195. [Google Scholar] [CrossRef]
- Swofford, D.L. PAUP: Phylogenetic Analysis Using Parsimony; Mac Version 3.1.1 (Computer Program and Manual); Sinauer Associates: Sunderland, MA, USA, 2003. [Google Scholar]
- Mason-Gamer, R.J.; Kellogg, E.A. Testing for phylogenetic conflict among molecular data sets in the tribe Triticeae (Gramineae). Syst. Biol. 1996, 45, 524–545. [Google Scholar] [CrossRef]
- Ronquist, F.; Teslenko, M.; Van Der Mark, P.; Ayres, D.L.; Darling, A.; Höhna, S.; Larget, B.; Liu, L.; Suchard, M.A.; Huelsenbeck, J.P. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 2012, 61, 539–542. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Brown, J.M.; Hedtke, S.M.; Lemmon, A.R.; Lemmon, E.M. When trees grow too long: Investigating the causes of highly inaccurate Bayesian branch-length estimates. Syst. Biol. 2010, 59, 145–161. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rambaut, A.; Suchard, M.A.; Xie, D.; Drummond, A.J. Tracer Version 1.6. Available online: http://tree.bio.ed.ac.uk/software/tracer/ (accessed on 14 May 2018).
- Shimodaira, H.; Hasegawa, M. Multiple comparisons of log-likelihoods with applications to phylogenetic inference. Mol. Biol. Evol. 1999, 16, 1114–1116. [Google Scholar] [CrossRef] [Green Version]
- Kishino, H.; Hasegawa, M. Evaluation of the maximum likelihood estimate of the evolutionary tree topologies from DNA sequence data, and the branching order in Hominoidea. J. Mol. Evol. 1989, 29, 170–179. [Google Scholar] [CrossRef] [PubMed]
- Rath, A.C.; Koen, T.B.; Yip, H.Y. The influence of abiotic factors on the distribution and abundance of Metarhizium anisopliae in Tasmanian pasture soils. Mycol. Res. 1992, 96, 378–384. [Google Scholar] [CrossRef]
- Bidochka, M.J.; Kasperski, J.E.; Wild, G.A. Occurrence of the entomopathogenic fungi Metarhizium anisopliae and Beauveria bassiana in soils from temperate and near-northern habitats. Can. J. Bot. 1998, 76, 1198–1204. [Google Scholar]
- Pérez-González, V.H.; Guzmán-Franco, A.W.; Alatorre-Rosas, R.; Hernández-López, J.; Hernández-López, A.; Carrillo-Benítez, M.G.; Baverstock, J. Specific diversity of the entomopathogenic fungi Beauveria and Metarhizium in Mexican agricultural soils. J. Invertebr. Pathol. 2014, 119, 54–61. [Google Scholar] [CrossRef]
- Niemczyk, M.; Sierpińska, A.; Tereba, A.; Sokołowski, K.; Przybylski, P. Natural occurrence of Beauveria spp. in outbreak areas of cockchafers (Melolontha spp.) in forest soils from Poland. Biocontrol 2019, 64, 159–172. [Google Scholar] [CrossRef] [Green Version]
- Sánchez-Peña, S.R.; Lara, J.S.; Medina, R.F. Occurrence of entomopathogenic fungi from agricultural and natural ecosystems in Saltillo, México, and their virulence towards thrips and whiteflies. J. Insect Sci. 2011, 11, 1. [Google Scholar] [CrossRef] [PubMed]
- Strasser, H.; Forer, A.; Schinner, F. Development of media for the selective isolation and maintenance of virulence of Beauveria brongniartii. In Proceedings of the 3rd International Workshop on Microbial Control of Soil Dwelling Pests, Lincoln, New Zealand, 21–23 February 1996; pp. 21–23. [Google Scholar]
- Safavi, S. Isolation, identification and pathogenicity assessment of a new isolate of entomopathogenic fungus, Beauveria bassiana in Iran. J. Plant Prot. Res. 2010, 50, 158–163. [Google Scholar] [CrossRef]
- Klingen, I.; Eilenberg, J.; Meadow, R. Effects of farming system, field margins and bait insect on the occurrence of insect pathogenic fungi in soils. Agric. Ecosyst. Environ. 2002, 91, 191–198. [Google Scholar] [CrossRef]
- Al Khoury, C.; Nemer, N.; Bernigaud, C.; Fischer, K.; Guillot, J. First evidence of the activity of an entomopathogenic fungus against the eggs of Sarcoptes scabiei. Vet. Parasitol. 2021, 298, 109553. [Google Scholar] [CrossRef]
- Abou-Jawdah, Y.; Atamian, H.; Nemer, G.; Kfoury, L.; Choukrallah, N.; Hanna, L.; Nemer, N. Efficacy and molecular studies of a Lebanese isolate of Beauveria for control of Thaumetopoea wilkinsoni (Lepidoptera: Thaumetopoeidae). Biocontrol Sci. Technol. 2008, 18, 573–581. [Google Scholar] [CrossRef]
- Al Khoury, C.; Nemer, G.; Guillot, J.; Nour, A.A.; Nemer, N. Expression analysis of the genes involved in the virulence of Beauveria bassiana. Agri Gene 2019, 14, 100094. [Google Scholar] [CrossRef]
- Al Khoury, C.; Guillot, J.; Nemer, N. Susceptibility and development of resistance of the mite Tetranychus urticae to aerial conidia and blastospores of the entomopathogenic fungus Beauveria bassiana. Syst. Appl. Acarol. 2020, 25, 429–443. [Google Scholar]
- Strasser, H. Use of hyphomycetous fungi for managing insect pests. In Fungi as Biocontrol Agents: Progress Problems and Potential; Butt, T.M., Jackson, C., Magan, N., Eds.; CABI: Wallingford, UK, 2001; p. 23. [Google Scholar]
- Quesada-Moraga, E.; Navas-Cortés, J.A.; Maranhao, E.A.; Ortiz-Urquiza, A.; Santiago-Álvarez, C. Factors affecting the occurrence and distribution of entomopathogenic fungi in natural and cultivated soils. Mycol. Res. 2007, 111, 947–966. [Google Scholar] [CrossRef] [PubMed]
- Abdullah, S.K.; Mustafa, R.A.; Assaf, L.H. Isolation of entomopathogenic and opportunistic fungi from soil in Duhok province, Kurdistan region of Iraq by different selective isolation media. J. Biol. Agric. Healthc. 2015, 5, 73–79. [Google Scholar]
- Bueno-Pallero, F.Á.; Blanco-Pérez, R.; Vicente-Díez, I.; Rodríguez Martín, J.A.; Dionísio, L.; Campos-Herrera, R. Patterns of occurrence and activity of entomopathogenic fungi in the Algarve (Portugal) using different isolation methods. Insects 2020, 11, 352. [Google Scholar] [CrossRef]
- Carrillo-Benítez, M.G.; Guzmán-Franco, A.W.; Alatorre-Rosas, R.; Enríquez-Vara, J.N. Diversity and genetic population structure of fungal pathogens infecting white grub larvae in agricultural soils. Microb. Ecol. 2013, 65, 437–449. [Google Scholar] [CrossRef] [PubMed]
- Vega, F.E.; Meyling, N.V.; Luangsa-ard, J.J.; Blackwell, M. Fungal entomopathogens. In Insect Pathology; Academic Press: Cambridge, MA, USA, 2012; pp. 171–220. [Google Scholar]
- Bassil, S.; Kattar, S.; Navarro-Cerrillo, R.M.; Navarrete Poyatos, M.A.; Nemer, N.; Palacios Rodriguez, G. Stand structure and regeneration of Cedrus libani (A. Rich) in Tannourine Cedar Forest Reserve (Lebanon) affected by cedar web-spinning sawfly (Cephalcia tannourinensis, Hymenoptera: Pamphiliidae). iFor.-Biogeosci. For. 2018, 11, 300. [Google Scholar] [CrossRef] [Green Version]
- Rehayem, M.; Noujeim, E.; Nemer, N.; Pagès, S.; Ogier, J.; Thaler, O.; Duvic, B. New Insights in biocontrol strategy against Cephalcia tannourinensis, the principal insect defoliator of Lebanese cedars. For. Sci. 2018, 64, 383–391. [Google Scholar] [CrossRef] [Green Version]
- Tartanus, M.; Furmanczyk, E.M.; Canfora, L.; Pinzari, F.; Tkaczuk, C.; Majchrowska-Safaryan, A.; Malusá, E. Biocontrol of Melolontha spp. grubs in organic strawberry plantations by entomopathogenic fungi as affected by environmental and metabolic factors and the interaction with soil microbial biodiversity. Insects 2021, 12, 127. [Google Scholar] [CrossRef] [PubMed]


| Locus | Primer | PCR | Sequence (5–3′) a | Reference |
|---|---|---|---|---|
| Bloc | B5.1F | x | CGACCCGGCCAACTACTTTGA | [25] |
| B3.1R | x | GTCTTCCAGTACCACTACGCC | [25] | |
| B822Ldg | AGATYCGYAACGTCAACTTT | [25] | ||
| B22Udg | GTCGBAGCCAGAGCAACT | [25] | ||
| B5.4F | CATTCGMGGCYTGTTCTTTGG | [25] | ||
| BRn2 | CTCCACGCATTCCGCACCAG | [25] | ||
| Bfint | GTTCCTTGCCCTCGGTAATGAA | [25] | ||
| BFn2 | TCTCGATGCCGTTACCTACA | [25] | ||
| Brint | AGCATATCGGGCATGACTGA | [25] | ||
| BFn6 | TGGTGCGGAATGCGTGGAGC | [25] | ||
| B3.3R | TTCCAGTACCACTACGCCGGC | [25] | ||
| Rbp2 | fRPB2_5F | x | GACGAYAGAGAYCAYTTYGG | [27] |
| RPB2A_7cR | x | CCCATRGCTTGYTTRCCCAT | [27] | |
| fRPB2-7cF | x | ATGGGYAARCAAGCYATGGG | [27] | |
| RPB2-3053bR | x | TGRATYTTRTCRTCSACCAT | [28] | |
| Bv-RPB2A_R1 | CCCCTGTTGATCATRAAGTCA | [25] | ||
| Bv-RPB2A_F3 | CCMGCCGARCCRCTYATTGA | [25] | ||
| Bv-RPB2A_F4 | CGCCTGAAGACDAARACMAACC | [25] | ||
| Bv-RPB2B_R4 | CRGCGTTRACAGRCACRATGA | [25] | ||
| Bv-RPB2B_F1 | AAGCGTCTTGATTTRGCRGGYCC | [25] | ||
| Bv-RPB2B_R2 | GCGTGAATYTTRTCRTCCAC | [25] | ||
| TEF–α | 983F | x | GCYCCYGGHCAYCGTGAYTTYAT | [24] |
| 2218R | x | ATGACACCRACRGCRACRGTYTG | [24] | |
| 1567RintB | ACHGTRCCRATACCACCRAT | [24] | ||
| 1577F | CARGAYGTBTACAAGATYGGTGG | [24] | ||
| ITS | ITS4 | x | TCCTCCGCTTATTGATATGC | [29] |
| ITS5 | x | GGAAGTAAAAGTCGTAACAAGG | [29] |
| Tannourine Cedar Forest Nature Reserve | |||||||
|---|---|---|---|---|---|---|---|
| Plot | Soil Texture | Crop | Occurrence Frequency (%) | ||||
| CT | GM | Dodine | Ctab | DOC2 | |||
| T1 | Clayey | Cedars | 26.7 a * | 31.7 a | 45 a | 28.3 a | 0 b |
| T2 | Clayey | Cedars | 26.7 a | 36.7 a | 43.3 a | 31.7 a | 0 b |
| T3 | Sandy | Cedars | 0 b | 0 b | 0 b | 0 b | 0 b |
| Horch Ehden Natural Reserve | |||||||
| Plot | Soil Texture | Crop | Occurrence Frequency (%) | ||||
| CT | GM | dodine | Ctab | DOC2 | |||
| E1 | Clayey | Cedars | 13.3 a | 18.2 a | 35 a | 21.7 a | 0 |
| E2 | Clayey | Pine | 3.3 b | 1.7 b | 5 b | 3.3 b | 0 |
| Bcharre Cedar Forest | |||||||
| Plot | Soil Texture | Crop | Occurrence Frequency (%) | ||||
| CT | GM | Dodine | Ctab | DOC2 | |||
| B1 | Clayey | Cedars | 0 | 0 | 0 | 0 | 0 |
| Isolate | Area | Accession Number | |||
|---|---|---|---|---|---|
| TEF-α | RBP2 | Bloc | ITS | ||
| LTB01 | T1 | EU177813 | MK908095 | MK884877 | DQ984676 |
| LTB02 | T1 | MK975955 | MK908082 | MK884864 | MK884879 |
| LTB03 | T1 | MK975954 | MK908081 | MK884863 | MK884880 |
| LTB04 | T1 | MK975964 | MK908091 | MK884873 | MK884884 |
| LTB05 | T2 | MK975960 | MK908087 | MK884869 | MK884892 |
| LTB06 | T2 | MK975965 | MK908092 | MK884874 | MK884887 |
| LTB07 | T2 | MK975959 | MK908086 | MK884868 | MK884886 |
| LTB08 | E1 | MK975961 | MK908088 | MK884870 | MK884882 |
| LTB09 | E1 | MK975962 | MK908089 | MK884871 | MK884885 |
| LTB10 | E2 | MK975963 | MK908090 | MK884872 | MK884891 |
| LTB11 | T1 | MK975956 | MK908083 | MK884865 | MK884889 |
| LTB12 | T1 | MK975953 | MK908080 | MK884862 | MK884878 |
| LTB13 | T2 | MK975966 | MK908093 | MK884875 | MK884888 |
| LTB14 | T2 | MK975967 | MK908094 | MK884876 | MK884881 |
| LTB15 | E1 | MK975958 | MK908085 | MK884867 | MK884883 |
| LTB16 | E1 | MK975957 | MK908084 | MK884866 | MK884890 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al Khoury, C.; Nemer, G.; Humber, R.; El-Hachem, N.; Guillot, J.; Chehab, R.; Noujeim, E.; El Khoury, Y.; Skaff, W.; Estephan, N.; et al. Bioexploration and Phylogenetic Placement of Entomopathogenic Fungi of the Genus Beauveria in Soils of Lebanon Cedar Forests. J. Fungi 2021, 7, 924. https://doi.org/10.3390/jof7110924
Al Khoury C, Nemer G, Humber R, El-Hachem N, Guillot J, Chehab R, Noujeim E, El Khoury Y, Skaff W, Estephan N, et al. Bioexploration and Phylogenetic Placement of Entomopathogenic Fungi of the Genus Beauveria in Soils of Lebanon Cedar Forests. Journal of Fungi. 2021; 7(11):924. https://doi.org/10.3390/jof7110924
Chicago/Turabian StyleAl Khoury, Charbel, Georges Nemer, Richard Humber, Nehme El-Hachem, Jacques Guillot, Racha Chehab, Elise Noujeim, Yara El Khoury, Wadih Skaff, Nathalie Estephan, and et al. 2021. "Bioexploration and Phylogenetic Placement of Entomopathogenic Fungi of the Genus Beauveria in Soils of Lebanon Cedar Forests" Journal of Fungi 7, no. 11: 924. https://doi.org/10.3390/jof7110924
APA StyleAl Khoury, C., Nemer, G., Humber, R., El-Hachem, N., Guillot, J., Chehab, R., Noujeim, E., El Khoury, Y., Skaff, W., Estephan, N., & Nemer, N. (2021). Bioexploration and Phylogenetic Placement of Entomopathogenic Fungi of the Genus Beauveria in Soils of Lebanon Cedar Forests. Journal of Fungi, 7(11), 924. https://doi.org/10.3390/jof7110924

