Next Article in Journal
Comparison of Citrus Leaf Water Content Estimations Based on the Continuous Wavelet Transform and Fractional Derivative Methods
Previous Article in Journal
Monofilament Shading Nets Improved Water Use Efficiency on High-Temperature Days in Grapevines Subjected to Hyperarid Conditions
 
 
Search for Articles:
Title / Keyword
Author / Affiliation / Email
Journal
Article Type
 
 
Advanced Search
 
Section
Special Issue
Volume
Issue
Number
Page
 
Journals
Horticulturae
Volume 10
Issue 2
10.3390/horticulturae10020178
horticulturae-logo
Submit to this Journal Review for this Journal Propose a Special Issue
► Article Menu

Article Menu

share Share announcement Help format_quote Cite question_answer Discuss in SciProfiles thumb_up
...
Endorse textsms
...
Comment
first_page
settings
Order Article Reprints
Font Type:
Arial Georgia Verdana
Font Size:
Aa Aa Aa
Line Spacing:
Column Width:
Background:
Article

Molecular Characterization of MYB Transcription Factors in Camellia chekiangoleosa Reveals That CcMYB33 Is an Important Regulator Involved in Multiple Developmental Processes

by
Mingchuan Huang
1,2,
Sijia Li
2,†,
Minyan Wang
2,
Hengfu Yin
2,* and
Haimei Li
1,*,†
1
College of Landscape Architecture and Forestry, Qingdao Agriculture University, Qingdao 266000, China
2
Research Institute of Subtropical Forestry, Chinese Academy of Forestry, Hangzhou 311400, China
*
Authors to whom correspondence should be addressed.
†
These authors contributed equally to this work.
Horticulturae 2024, 10(2), 178; https://doi.org/10.3390/horticulturae10020178
Submission received: 10 January 2024 / Revised: 31 January 2024 / Accepted: 12 February 2024 / Published: 16 February 2024
(This article belongs to the Section Genetics, Genomics, Breeding, and Biotechnology (G2B2))
Browse Figures
Versions Notes

Abstract

:
Camellia chekiangoleosa is an economically important woody plant from the Genus Camellia in Theaceae, and its seed kernels are rich in edible oils of high health value. Yet, little is known about the molecular regulation of growth and development in C. chekiangoleosa. In this study, we characterized the MYB (Myeloblastosis) gene family that was widely involved in plant development and stress responses, and identified 235 members from the C. chekiangoleosa genome. Based on transcriptomic analysis of multiple tissues, we obtained tissue-specific expression profiles of the MYB genes. We found that 37 MYB genes were highly expressed during seed development, and among them, CcMYB33 (GAMYB) was specifically expressed in the seed coat, suggesting that it may be an important regulator. We cloned full-length sequences of the CcMYB33 gene and further analyzed its sequence characteristics and expression pattern. Our results indicated that CcMYB33 is an R2R3-type MYB transcription factor that is closely related to GAMYB genes of Arabidopsis thaliana. We showed that ectopic expression of CcMYB33 in Arabidopsis lines caused pleiotropical developmental defects, including abnormal leaves, fused stamen, and early flowering, among other things. This work identified important MYB regulators in the regulation of development and growth in C. chekiangoleosa, providing support for further molecular and genetic studies.

1. Introduction

Camellia chekiangoleosa Hu. is a unique species from the Genus Camellia in China, naturally distributed in the southern subtropical region of the mountainous areas at an altitude of 600 m to 1300 m [1]. Currently, C. chekiangoleosa is widely cultivated for its ornamental and economic value mainly through seedlings, while self-propagation methods such as grafting play a major role in breeding [2]. In particular, C. chekiangoleosa seed kernels produce a high-quality edible oil with an oil yield of more than 60%, and around 90% of total oil contents consist of unsaturated fatty acids (mainly oleic acid) [3]. In addition, the high oleic acid content of the oil can be used for a wide range of applications such as advanced natural skin care cosmetics [4].
Compared with other oil-containing camellia plants, C. chekiangoleosa oil is of high quality, and the oil’s biosynthesis and accumulation processes are distinctive [3]. Firstly, C. chekiangoleosa is mainly adapted to grow at high altitudes and is resilient to low temperatures and high day–night temperature differences [1]. Secondly, the oil accumulation cycle is shorter compared to the other primarily cultivated oil-containing camellia plant, C. oleifera [5]. Despite the promising applications of C. chekiangoleosa, few studies have been reported on the regulation of its growth and development and the formation of environmental adaptations.
MYB (Myeloblastosis) transcription factors are widely found in plants and have been shown to be involved in a variety of processes, including plant growth and development, and stress responses [6]. Most MYB members contain a highly conserved MYB domain at the N-terminus, which consists of one to four incomplete repeats (abbreviated R), with each repeat containing 50–53 conserved amino acid residues [7]. According to the number of R-repeat sequences and their alignment characteristics, the MYB domain can be classified into four major types: R1-MYB (1R), R2R3-MYB (2R), R1R2R3-MYB (3R), and 4R-MYB (4R) [7]. R2R3-MYB is the major group which usually has the largest number of members in plants [6,8]. R2R3-MYB transcription factors have been found to play important roles in plant secondary metabolism, growth and development, physiology and biochemistry, hormone synthesis and signaling, and in response to biotic and abiotic stresses [6,8,9,10].
GAMYB genes, a subgroup (SG18) of R2R3-MYB, are master regulators of various developmental processes including flowering time, flower organ development, seed germination, and the gibberellin auxin (GA) signaling pathway. A large number of studies have now shown that regulatory pathways centered on GAMYB are key to plant growth and development [11]. In Arabidopsis, three GAMYB-like genes, AtMYB33, AtMYB65, and AtMYB101, have been found to play important roles in GA signal pathways and flower development [12]. AtMYB33 and AtMYB65 are directly regulated by miR159 and miR319 to promote programmed cell death during reproductive development [13,14]. Ectopic expression of AtMYB33 may lead to a variety of growth inhibition phenotype, suggesting that miR159/miR319-mediated post-transcriptional regulatory mechanisms are essential in ensuring normal growth and development [12].
GAMYB is involved in the regulation of a large number of genes, mainly through transcriptional activation. In barley, HvGAMYB binds to the “TAACAAA” box of the α-amylase gene promoter in aleurone cells and activates its expression; the binding motif for GAMYB has been determined to contain an 8-bp DNA sequence centered on C/TAAC [15]. In Arabidopsis, AtMYB33 can bind to the promoter of LEAFY and activate its expression, thereby promoting flowering [12].
GA and its crosstalk between the salicylic acid and brassinosteroid signaling pathways are also involved in the fine-tuning of GAMYB functions in growth and stress responses. In several monocots, GAMYB genes have been shown to play critical roles in mediating downstream gene expression of the GA signaling pathway to regulate stamen and seed development [16]. In wheat, TaMYB33 gene expression is induced by salt stress, and overexpression of the TaMYB33 gene in Arabidopsis enhanced the synthesis of abscisic acid (ABA) to improve salt tolerance [17]. In Larix kaempferi, miR159-regulated LaMYB33 is thought to play an important role in the maintenance of embryonic cell identity and somatic embryo maturation [18]. In Solanum lycopersicum, overexpression of the SlMYB33 gene caused fruit enlargement and delayed flowering in tomato plants [19].
C. chekiangoleosa is a highly promising economically valuable plant; research on its genomic information and its regulation of growth and development is gradually emerging [20]. Considering the crucial regulatory role of MYB genes, this work systematically analyzes the MYB gene family, structural features, and tissue expression in C. chekiangoleosa, and identifies and characterizes the molecular functions of the CcMYB33 gene. We identified and characterized the molecular function of a CcMYB33 gene specifically expressed in seeds.

2. Materials and Methods

2.1. Plant Materials

The materials of C. chekiangoleosa used in this experiment were collected from the Camellia Germplasm Resource Nursery located at the Research Institute of Subtropical Forestry within the Chinese Academy of Forestry. For DNA and RNA preparation, the plant samples were collected, immediately frozen in liquid nitrogen, and stored at −80 °C. Arabidopsis and Nicotiana. benthamiana seedlings were maintained in a growth chamber for later experiments as described [21].

2.2. Gene Family Membership Identification

The hidden Markov file (Pfam Number: PF00249) of the structural domains of the MYB gene family genes of C. chekiangoleosa was downloaded from the Pfam database (http://pfam.xfam.org/ accessed on 16 May 2021) [22]. The MYB-containing sequences of C. chekiangoleosa protein sequences were obtained and screened using Hmmsearch [23], and the sequences were further verified for the presence of MYB transcription factors using tools from the National Center for Biotechnology Information (NCBI) CDD (https://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi accessed on 16 May 2021) and the SMART online website (http://smart.embl-heidelberg.de/ accessed on 16 May 2021) to further verify whether the obtained members contain MYB transcription factor features [24,25].

2.3. Systematic Evolutionary Analysis

Sequence comparison of the obtained MYB gene family members of C. chekiangoleosa was performed using MUSCLE within Tbtools v.2.030 software [26]. Then, further multiple sequence trimming was performed using TrimAL. Finally, the phylogenetic tree model was constructed using the IQtree function, and the constructed evolutionary tree was used via the online website iTOL (https://itol.embl.de accessed on 30 October 2021) for further analysis [27,28].

2.4. Gene Chromosomal Localization and Intron–Exon Analysis

The chromosomal localization of CcMYBs gene family members obtained from the screening was visualized using Tbtools software, and tandem genes (genes less than 50 kb apart) were screened [26]. Based on the annotation file of the C. chekiangoleosa MYB gene family, the intron and exon lengths of the obtained members were analyzed and plotted using prism v.8.0 software [29].

2.5. Gene Expression Pattern Analysis

In this study, we analyzed the transcriptional expression data of CcMYBs genes in different tissues on the basis of the transcriptome data of C. chekiangoleosa previously obtained by the group [30]. After removing the minimally expressed genes, the fragments per kilobase of exon model per million mapped fragments (FPKM) values of the highly expressed genes were obtained, and a clustering heatmap of the expression patterns of the CcMYBs genes was plotted based on the FPKM values using TBtools software [26].

2.6. RNA Extraction and cDNA Synthesis

Plant RNA was extracted using an RNAprep Pure Polysaccharide Polyphenol Plant Total RNA Extraction Kit (Cat. DP441, Tiangen, Beijing, China), and RNA integrity was detected by 1.5% agarose gel electrophoresis. A PrimeScript II 1st Strand cDNA Synthesis Kit reagent (Cat. 6210A, TaKaRa, Beijing, China) was used for reverse transcription synthesis of cDNA.

2.7. Gene Cloning

The cDNA sequences homologous to MYB were found by local BLASTP comparison, specific primers (Table 1) were designed according to the coding region of the gene on the Primer3 Plus website (http://www.primer3plus.com/ last accessed on 20 October 2022), and cDNA fragments were amplified [31]. For PCR amplification reactions, the instructions of a Premix Taq Reagent (Cat. RR003A, TaKaRa, Beijing) kit were referred to. The target fragment was extracted and ligated into a T-vector pMD20 vector (Cat. 3270, TaKaRa, Beijing), which was transformed into E. coli DH5α competent cells (Cat. 9507, TaKaRa, Beijing); then, positive single clones were screened for sequencing to validate the sequence and ultimately obtain the correct sequence of the target gene.

2.8. Expression Analysis

Total RNA and cDNA from different tissue parts of Camellia chekiangoleosa were obtained as mentioned above. The quantitative PCR primers were designed according to the sequence of CcMYB33 gene, and the GAPDH gene was used as the internal reference. A TB Green Premix Ex Taq II (Tli RNaseH Plus, TAKARA, Dalian, China) kit was used for quantitative PCR reactions, and the instrument used was ABI 7300 Real-time PCR (USA) [32]. Finally, the relative expression was calculated and analyzed using the 2−ΔΔCt algorithm, and the results were analyzed for significance of differences using SPSS 22.0 statistical analysis software with three replications for each experiment and sample [33].

2.9. Subcellular Localization Analysis

To validate the subcellular localization of the CcMYB33 protein, the CcMYB33 gene was constructed into a pCAMBIA1300-GFP expression vector according to the instructions of an EXclone kit (Cat. exv09, Biogle, Changzhou, China). The recombinant fusion expression vector was transformed into Agrobacterium tumefaciens GV3101 receptor cells. Additionally, tobacco infiltration procedures were performed as described [34]. Samples were taken and placed in a laser confocal fluorescence microscope (LSM900, Zesis, Germany) to detect the fluorescence signals before being observed and photographed for recording.

3. Results

3.1. Identification of MYB Transcription Factors in C. chekiangoleosa

Based on the HMMER search results, a total of 235 MYB gene family members were obtained, including 182 R2R3-MYB proteins, 5 3R-MYB proteins, 43 1R-MYB proteins, and 5 less conserved “Unusual” MYB proteins. We compared the results with Arabidopsis, C. oleifera and Populus trichocarpa and found that the number of R2R3-MYB proteins of C. chekiangoleosa was higher than that of Arabidopsis and C. oleifera and similar to that of P. trichocarpa, whereas the number of 1R-MYB proteins was closer to that of C. oleifera (Table 2).

3.2. Chromosome Localization and Intron–Exon Analysis of CcMYBs

Chromosomal localization analysis showed that C. chekiangoleosa MYB gene was distributed on all 15 chromosomes (2n = 2x = 30) (Figure 1A). These 235 MYB genes were renamed according to their locations on the chromosomes. The tandem duplication genes, which are closely distributed on the chromosomes, were screened based on certain conditions, and 29 tandem duplication events containing 83 MYB genes were found on 14 chromosomes (Figure 1A and Table 3). Analysis of the intron and exon lengths revealed that most of the introns were distributed between 0 and 600 bp, with the largest number of introns in the length range of 0–300 bp, and a few introns exceeding 3000 bp in length (with a maximum of no more than 12,000 bp). The exon length distribution was more variable, although most of them were distributed between 0 and 1000 bp (Figure 1B).

3.3. Phylogenetic Analysis

A phylogenetic tree was constructed using 182 C. chekiangoleosa R2R3-MYB genes and 103 Arabidopsis R2R3-MYB genes (Figure 2). Based on the Arabidopsis R2R3-MYB gene family subgroup grouping information [38], the C. chekiangoleosa R2R3-MYB gene family was categorized into 22 subgroups, denoted by S1–S22 (Table 4). Among them, 18 subgroups of C. chekiangoleosa were consistent with the Arabidopsis subgroup grouping, whereas four subgroups from Arabidopsis, namely S5, S12, S15, and S19, had no CcMYBs.

3.4. Analysis of the Expression Pattern of the CcMYB Gene in Different Tissues and Phylogenetic Analysis of the CcMYB33 Gene

We analyzed the expression profiles of CcMYBs based on our previous transcriptome data of C. chekiangoleosa containing seed kernel, endocarp, pericarp, floral bud, mesocarp, and seed coat. We found that there were 37 CcMYB genes that were highly expressed in the seed coat (Figure 3A). Among them, we found that a GAMYB-like gene (renamed CcMYB33) was highly expressed in the seed coat tissues (Figure 3A). To investigate the function of the CcMYB33 gene protein, we used 12 species for multiple sequence comparison, and all of them were found to contain the conserved R2R3-MYB structural domain (Figure 3B). Their phylogenetic tree was constructed and revealed that C. chekiangoleosa CcMYB33 formed a subgroup with other GAMYB genes from other Camellia plants and was most related to Camellia lanceoleosa ClGAMYB (Figure 3C).

3.5. Tissue-Specific Expression Analysis and Subcellular Localization of the CcMYB33 Gene

To further analyze the expression pattern of CcMYB33, we performed qRT-PCR analysis using various tissues of wild C. chekiangoleosa. The results showed (Figure 4A) that CcMYB33 was expressed in all tissue parts of wild C. chekiangoleosa, and CcMYB33 was higher in stamens, petals, tender leaves, sepals, and carpels, being highest in mature leaves. In our previous transcriptome data, no leaf samples were used. Taking these results together, we showed that CcMYB33 might have important regulatory functions in leaf and floral development. In order to clarify the subcellular localization of the CcMYB33 protein, we obtained an over-expression vector containing a 35s promoter for tobacco transient expression. We found that the signals of the CcMYB33-EGFP fusion protein were exclusively observed in the nucleus, proving that CcMYB33 was localized to the nucleus (Figure 4B).

3.6. Overexpression of CcMYB33 in Arabidopsis thaliana

To further study the molecular functions of CcMYB33, we generated transgenic lines in Arabidopsis thaliana with ectopic expression of CcMYB33. We found the overexpression lines had pleiotropical defects including early flowering and abnormal leaf development (Figure 5). To further analyze the phenotypes, we obtained six transgenic lines with high expression levels of CcMYB33 (Figure 5F), among which two strong lines, OE-1 and OE-2, were analyzed for detail (Figure 5). We showed that the transgenic Arabidopsis lines showed a variety of phenotypic alterations. The most conspicuous phenotype was that the leaves showed varying degrees of curling toward the upper surface (Figure 5A,B); we also observed that transgenic lines had delayed flowering times and produced fused anthers and petals (Figure 5C,D). We also observed that the stems of the transgenic line were thicker than WT Arabidopsis and contained more vascular bundles (Figure 5E). Taking these results together, we proposed that CcMYB33 might have prominent functions in the regulation of various organs’ development in C. chekiangoleosa.

4. Discussion

The genus Camellia comprises a large number of economic shrubs, and the process of selective breeding has resulted in many excellent varieties for producing ornaments, beverages, edible oils, and other products [39]. C. chekiangoleosa, a native species of China, has significant potential for both ornamental and oil-producing applications. The seed oil of C. chekiangoleosa has been found to be comparable to or even better than oil from other oil-containing camellia plants such as C. oleifera [20]. Analysis of fatty acid composition showed that C. chekiangoleosa seed oil consists of around 84% oleic acid and unsaturated fatty acids on average, which mean it meets modern standards for a healthy vegetable oil. Unlike most oil-containing camellia plants, the process of fruit development, fruit size, and lignification in C. chekiangoleosa is unique. The pericarp of C. chekiangoleosa is thick and has a low level of lignin, which leads to difficulties in large-scale oil production [40]. Currently, studies on the regulation of growth and development in C. chekiangoleosa are lacking, mainly due to the limited genetic and genomic information and techniques for studying gene function. In this paper, based on the C. chekiangoleosa genome, we systematically identified members of the MYB gene family. We found that the MYB family genes are conserved to other plants in terms of composition of the family members and the domain of subgroups (Table 2 and Table 3). This suggests that MYB genes may have the same important regulatory function in the growth and development of C. chekiangoleosa.
In the C. chekiangoleosa R2R3-MYB gene family, we found that 44 CcMYB genes located in the same branch of the S21 subfamily but lacking the typical motif of the S21 subfamily (Figure 2). In Arabidopsis, S21 subfamily genes have been found to play key roles in growth and development [41]. For example, AtMYB117 is involved in ovule and fruit development; MYB105 is involved in the regulation of pollen maturation [41,42]. In addition to this, some members of S21, such as MYB52/ABSCISIC ACID HYPERSENSITIVE1 (AHS1), have been found to be associated with salt and drought tolerance and may play a role in the regulation of cell wall biosynthesis in an ABA-dependent manner [43]. It has also been reported that in poplar, PdMYB2R089 can enhance lateral root growth and potentially improves drought tolerance in plants [44]. We found that these 44 CcMYB genes were closely related to the Arabidopsis AtMYB88 gene, which has been shown to be involved in regulating drought and high salt stresses [45]. These results suggest that the S21 subfamily might be expanded in C. chekiangoleosa and potentially have important functions in stress responses.
GAMYB genes, belonging to a subclade of the R2R3-MYB transcription factors, are core regulators for plant development and growth. In rice, mutations in OsGAMYB have resulted in growth inhibition and defects in floral organ development, especially anthers and pollen [46]. In Arabidopsis, double mutations of AtMYB33 and AtMYB65 genes have caused male sterility and abnormal anther development [11]. It has been shown that the expression of AtMYB33 and AtMYB65 is post-transcriptionally regulated by miR159 [11,47,48,49], and ectopic expression of AtMYB33 that carried the mutated target sequence resulted in severe leaf defects [48]. Notably, the mir159ab double mutant exhibits pleiotropic developmental defects, but all developmental defects of mir159ab are suppressed in the mir159ab-myb33-myb65 quadruple mutant [50]. These results suggest that despite the presence of seven potential miR159-regulated GAMYB genes in Arabidopsis, the phenotypes of mir159ab were caused exclusively by the activity of AtMYB33 and AtMYB65. In this work, we identified CcMYB33 as a GAMYB homolog from C. chekiangoleosa (Figure 3). We showed that the expression of CcMYB33 was present in all tissues tested, with high expression in leaves and seeds (Figure 3). We also found a potential binding site for miR159 in the sequence of CcMYB33, but whether it is regulated by miR159 needs to be further investigated.
Disruption of the expression pattern of the GAMYB gene often produces multiple developmental defects. Evidence from many studies suggests that GAMYB is involved in the regulation of the expression of a large number of downstream genes, and that the balance of expression levels as well as the redundancy of gene functions are important aspects of GAMYB function. For example, a recent study in cotton has revealed that the miR319c-MYB33 module plays a central role in the balance between growth and disease resistance [51]. Through ectopic expression CcMYB33 gene in Arabidopsis, we showed that although containing the recognition site of miR159, the transgenic lines displayed various developmental defects, including leaf, anther, and flowering time (Figure 5). These results suggest that CcMYB33 might have conserved functions in development and growth of C. chekiangoleosa; further in-depth studies are needed to elucidate the regulatory relationships of miR159 and its roles in organ development.

Author Contributions

H.L. conceived this study. H.Y. analyzed the data. M.H. and S.L. performed gene family analysis. M.W. provided supports on gene functional analyses. H.Y. and M.H. drafted the manuscript and all authors contributed to the writing and approved the submission. All authors have read and agreed to the published version of the manuscript.

Funding

This work was funded by the Nonprofit Research Projects (CAFYBB2021QD001) of the Chinese Academy of Forestry and National Science Foundation of China (32271839).

Data Availability Statement

All data are provided and associated with the manuscript.

Acknowledgments

We would like to thank Yingkun Sun for her support in this work.

Conflicts of Interest

The authors declare no competing interests.

References

  1. Tienlu, M. The classification, differentiation and distribution of the genus Camellia Sect. Camellia. Acta Bot. Yunnanica 1998, 20, 127–148. [Google Scholar]
  2. Huang, B.; Wang, Z.; Huang, J.; Li, X.; Zhu, H.; Wen, Q.; Xu, L.-A. Population genetic structure analysis reveals significant genetic differentiation of the endemic species Camellia chekiangoleosa Hu. with a narrow geographic range. Forests 2022, 13, 234. [Google Scholar] [CrossRef]
  3. Wei, T.; Dong, L.; Zhong, S.; Jing, H.; Deng, Z.; Wen, Q.; Li, J. Chemical composition of Camellia chekiangoleosa Hu. seeds during ripening and evaluations of seed oils quality. Ind. Crops Prod. 2022, 177, 114499. [Google Scholar] [CrossRef]
  4. Cao, Y.; Yao, X.; Ren, H.; Wang, K. Determination of fatty acid composition and metallic element content of four Camellia species used for edible oil extraction in China. J. Consum. Prot. Food Saf. 2017, 12, 165–169. [Google Scholar] [CrossRef]
  5. Yan, R.; Ruan, C.; Zhao, S.; Ding, J.; Du, W.; Wang, H.; Han, P. SNP discovery of Camellia oleifera based on RNA-seq and its application for identification of genetic relationships and locus for oil content among different cultivars. J. Hortic. Sci. Biotechnol. 2020, 95, 687–702. [Google Scholar] [CrossRef]
  6. Dubos, C.; Stracke, R.; Grotewold, E.; Weisshaar, B.; Martin, C.; Lepiniec, L. MYB transcription factors in Arabidopsis. Trends Plant Sci. 2010, 15, 573–581. [Google Scholar] [CrossRef]
  7. Du, H.; Feng, B.-R.; Yang, S.-S.; Huang, Y.-B.; Tang, Y.-X. The R2R3-MYB transcription factor gene family in maize. PLoS ONE 2012, 7, e37463. [Google Scholar] [CrossRef] [PubMed]
  8. Nesi, N.; Jond, C.; Debeaujon, I.; Caboche, M.; Lepiniec, L. The Arabidopsis TT2 gene encodes an R2R3 MYB domain protein that acts as a key determinant for proanthocyanidin accumulation in developing seed. Plant Cell 2001, 13, 2099–2114. [Google Scholar] [CrossRef]
  9. Baldoni, E.; Genga, A.; Cominelli, E. Plant MYB transcription factors: Their role in drought response mechanisms. Int. J. Mol. Sci. 2015, 16, 15811–15851. [Google Scholar] [CrossRef] [PubMed]
  10. Feller, A.; Machemer, K.; Braun, E.L.; Grotewold, E. Evolutionary and comparative analysis of MYB and bHLH plant transcription factors. Plant J. 2011, 66, 94–116. [Google Scholar] [CrossRef]
  11. Millar, A.A.; Gubler, F. The Arabidopsis GAMYB-like genes, MYB33 and MYB65, are microRNA-regulated genes that redundantly facilitate anther development. Plant Cell 2005, 17, 705–721. [Google Scholar] [CrossRef]
  12. Gocal, G.F.; Sheldon, C.C.; Gubler, F.; Moritz, T.; Bagnall, D.J.; MacMillan, C.P.; Li, S.F.; Parish, R.W.; Dennis, E.S.; Weigel, D. GAMYB-like genes, flowering, and gibberellin signaling in Arabidopsis. Plant Physiol. 2001, 127, 1682–1693. [Google Scholar] [CrossRef]
  13. Alonso-Peral, M.M.; Li, J.; Li, Y.; Allen, R.S.; Schnippenkoetter, W.; Ohms, S.; White, R.G.; Millar, A.A. The microRNA159-regulated GAMYB-like genes inhibit growth and promote programmed cell death in Arabidopsis. Plant Physiol. 2010, 154, 757–771. [Google Scholar] [CrossRef]
  14. Millar, A.A.; Lohe, A.; Wong, G. Biology and function of miR159 in plants. Plants 2019, 8, 255. [Google Scholar] [CrossRef] [PubMed]
  15. Gubler, F.; Raventos, D.; Keys, M.; Watts, R.; Mundy, J.; Jacobsen, J.V. Target genes and regulatory domains of the GAMYB transcriptional activator in cereal aleurone. Plant J. 1999, 17, 1–9. [Google Scholar] [CrossRef] [PubMed]
  16. Aya, K.; Ueguchi-Tanaka, M.; Kondo, M.; Hamada, K.; Yano, K.; Nishimura, M.; Matsuoka, M. Gibberellin modulates anther development in rice via the transcriptional regulation of GAMYB. Plant Cell 2009, 21, 1453–1472. [Google Scholar] [CrossRef] [PubMed]
  17. Qin, Y.; Wang, M.; Tian, Y.; He, W.; Han, L.; Xia, G. Over-expression of TaMYB33 encoding a novel wheat MYB transcription factor increases salt and drought tolerance in Arabidopsis. Mol. Biol. Rep. 2012, 39, 7183–7192. [Google Scholar] [CrossRef] [PubMed]
  18. Li, W.-F.; Zhang, S.-G.; Han, S.-Y.; Wu, T.; Zhang, J.-H.; Qi, L.-W. Regulation of LaMYB33 by miR159 during maintenance of embryogenic potential and somatic embryo maturation in Larix kaempferi (Lamb.) Carr. Plant Cell Tissue Organ Cult. (PCTOC) 2013, 113, 131–136. [Google Scholar] [CrossRef]
  19. Zhang, B. Effect of GA signal factor SlMYB33 on flowering time and fruit size of tomato. Acta Agric. Boreali Occident. Sin. 2020, 29, 1859–1866. [Google Scholar]
  20. Xie, Y.; Wang, X. Comparative transcriptomic analysis identifies genes responsible for fruit count and oil yield in the oil tea plant Camellia chekiangoleosa. Sci. Rep. 2018, 8, 6637. [Google Scholar] [CrossRef] [PubMed]
  21. Ma, X.; Nie, Z.; Huang, H.; Yan, C.; Li, S.; Hu, Z.; Wang, Y.; Yin, H. Small RNA profiling reveals that an ovule-specific microRNA, cja-miR5179, targets a B-class MADS-box gene in Camellia japonica. Ann. Bot. 2023, 132, mcad155. [Google Scholar] [CrossRef]
  22. Finn, R.D.; Bateman, A.; Clements, J.; Coggill, P.; Eberhardt, R.Y.; Eddy, S.R.; Heger, A.; Hetherington, K.; Holm, L.; Mistry, J. Pfam: The protein families database. Nucleic Acids Res. 2014, 42, D222–D230. [Google Scholar] [CrossRef] [PubMed]
  23. Shen, T.-f.; Huang, B.; Xu, M.; Zhou, P.-y.; Ni, Z.-x.; Gong, C.; Wen, Q.; Cao, F.-l.; Xu, L.-A. The reference genome of Camellia chekiangoleosa provides insights into Camellia evolution and tea oil biosynthesis. Hortic. Res. 2022, 9, uhab083. [Google Scholar] [CrossRef] [PubMed]
  24. Eddy, S.R. Accelerated profile HMM searches. PLoS Comput. Biol. 2011, 7, e1002195. [Google Scholar] [CrossRef]
  25. Schultz, J.; Copley, R.R.; Doerks, T.; Ponting, C.P.; Bork, P. SMART: A web-based tool for the study of genetically mobile domains. Nucleic Acids Res. 2000, 28, 231–234. [Google Scholar] [CrossRef]
  26. Chen, C.; Chen, H.; Zhang, Y.; Thomas, H.R.; Frank, M.H.; He, Y.; Xia, R. TBtools: An integrative toolkit developed for interactive analyses of big biological data. Mol. Plant 2020, 13, 1194–1202. [Google Scholar] [CrossRef] [PubMed]
  27. Letunic, I.; Bork, P. Interactive Tree of Life (iTOL) v4: Recent updates and new developments. Nucleic Acids Res. 2019, 47, W256–W259. [Google Scholar] [CrossRef]
  28. Capella-Gutiérrez, S.; Silla-Martínez, J.M.; Gabaldón, T. trimAl: A tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 2009, 25, 1972–1973. [Google Scholar] [CrossRef]
  29. Swift, M.L. GraphPad prism, data analysis, and scientific graphing. J. Chem. Inf. Comput. Sci. 1997, 37, 411–412. [Google Scholar] [CrossRef]
  30. Yan, C.; Nie, Z.; Hu, Z.; Huang, H.; Ma, X.; Li, S.; Li, J.; Yao, X.; Yin, H. Tissue-specific transcriptomics reveals a central role of CcNST1 in regulating the fruit lignification pattern in Camellia chekiangoleosa, a woody oil-crop. For. Res. 2022, 2, 10. [Google Scholar] [CrossRef]
  31. Untergasser, A.; Nijveen, H.; Rao, X.; Bisseling, T.; Geurts, R.; Leunissen, J.A. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 2007, 35, W71–W74. [Google Scholar] [CrossRef]
  32. Heid, C.A.; Stevens, J.; Livak, K.J.; Williams, P.M. Real time quantitative PCR. Genome Res. 1996, 6, 986–994. [Google Scholar] [CrossRef]
  33. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
  34. Ma, L.; Lukasik, E.; Gawehns, F.; Takken, F.L. The use of agroinfiltration for transient expression of plant resistance and fungal effector proteins in Nicotiana benthamiana leaves. In Plant Fungal Pathogens; Springer: Berlin/Heidelberg, Germany, 2012; pp. 61–74. [Google Scholar]
  35. Stracke, R.; Werber, M.; Weisshaar, B. The R2R3-MYB gene family in Arabidopsis thaliana. Curr. Opin. Plant Biol. 2001, 4, 447–456. [Google Scholar] [CrossRef]
  36. Li, S.; Huang, H.; Ma, X.; Hu, Z.; Li, J.; Yin, H. Characterizations of MYB transcription factors in Camellia oleifera reveal the key regulators involved in Oil Biosynthesis. Horticulturae 2022, 8, 742. [Google Scholar] [CrossRef]
  37. Yang, X.; Li, J.; Guo, T.; Guo, B.; Chen, Z.; An, X. Comprehensive analysis of the R2R3-MYB transcription factor gene family in Populus trichocarpa. Ind. Crops Prod. 2021, 168, 113614. [Google Scholar] [CrossRef]
  38. Kranz, H.D.; Denekamp, M.; Greco, R.; Jin, H.; Leyva, A.; Meissner, R.C.; Petroni, K.; Urzainqui, A.; Bevan, M.; Martin, C. Towards functional characterisation of the members of the R2R3-MYB gene family from Arabidopsis thaliana. Plant J. 1998, 16, 263–276. [Google Scholar] [CrossRef]
  39. Yan, C.; Lin, P.; Lyu, T.; Hu, Z.; Fan, Z.; Li, X.; Yao, X.; Li, J.; Yin, H. Unraveling the roles of regulatory genes during domestication of cultivated Camellia: Evidence and insights from comparative and evolutionary genomics. Genes 2018, 9, 488. [Google Scholar] [CrossRef]
  40. Yan, C.; Hu, Z.; Nie, Z.; Li, J.; Yao, X.; Yin, H. CcBLH6, a bell-like homeodomain-containing transcription factor, regulates the fruit lignification pattern. Planta 2021, 253, 90. [Google Scholar] [CrossRef]
  41. Alves-Ferreira, M.; Wellmer, F.; Banhara, A.; Kumar, V.; Riechmann, J.L.; Meyerowitz, E.M. Global expression profiling applied to the analysis of Arabidopsis stamen development. Plant Physiol. 2007, 145, 747–762. [Google Scholar] [CrossRef]
  42. Gomez, M.D.; Urbez, C.; Perez-Amador, M.A.; Carbonell, J. Characterization of constricted fruit (ctf) mutant uncovers a role for AtMYB117/LOF1 in ovule and fruit development in Arabidopsis thaliana. PLoS ONE 2011, 6, e18760. [Google Scholar] [CrossRef]
  43. Park, M.Y.; Kang, J.-y.; Kim, S.Y. Overexpression of AtMYB52 confers ABA hypersensitivity and drought tolerance. Mol. Cells 2011, 31, 447–454. [Google Scholar] [CrossRef]
  44. Zhang, X.; Wang, H.; Chen, Y.; Huang, M.; Zhu, S. The Over-Expression of Two R2R3-MYB Genes, PdMYB2R089 and PdMYB2R151, Increases the Drought-Resistant Capacity of Transgenic Arabidopsis. Int. J. Mol. Sci. 2023, 24, 13466. [Google Scholar] [CrossRef]
  45. Xie, Z.; Li, D.; Wang, L.; Sack, F.D.; Grotewold, E. Role of the stomatal development regulators FLP/MYB88 in abiotic stress responses. Plant J. 2010, 64, 731–739. [Google Scholar] [CrossRef]
  46. Kaneko, M.; Inukai, Y.; Ueguchi-Tanaka, M.; Itoh, H.; Izawa, T.; Kobayashi, Y.; Hattori, T.; Miyao, A.; Hirochika, H.; Ashikari, M. Loss-of-function mutations of the rice GAMYB gene impair α-amylase expression in aleurone and flower development. Plant Cell 2004, 16, 33–44. [Google Scholar] [CrossRef]
  47. Achard, P.; Herr, A.; Baulcombe, D.C.; Harberd, N.P. Modulation of floral development by a gibberellin-regulated microRNA. Development 2004, 131, 3357–3365. [Google Scholar] [CrossRef]
  48. Palatnik, J.F.; Allen, E.; Wu, X.; Schommer, C.; Schwab, R.; Carrington, J.C.; Weigel, D. Control of leaf morphogenesis by microRNAs. Nature 2003, 425, 257–263. [Google Scholar] [CrossRef] [PubMed]
  49. Schwab, R.; Palatnik, J.F.; Riester, M.; Schommer, C.; Schmid, M.; Weigel, D. Specific effects of microRNAs on the plant transcriptome. Dev. Cell 2005, 8, 517–527. [Google Scholar] [CrossRef]
  50. Allen, R.S.; Li, J.; Stahle, M.I.; Dubroué, A.; Gubler, F.; Millar, A.A. Genetic analysis reveals functional redundancy and the major target genes of the Arabidopsis miR159 family. Proc. Natl. Acad. Sci. USA 2007, 104, 16371–16376. [Google Scholar] [CrossRef]
  51. Guang, H.; Xiaoyang, G.; Zhian, W.; Ye, W.; Peng, W.; Linfang, S.; Bingting, W.; Anhong, Z.; Fuguang, L.; Jiahe, W. The cotton MYB33 gene is a hub gene regulating the trade-off between plant growth and defense in Verticillium dahliae infection. J. Adv. Res. 2023, in press. [Google Scholar] [CrossRef]
Horticulturae 10 00178 g001
Figure 1. Chromosomal distribution and distribution of exon and intron lengths in the CcMYBs genes. (A) Chromosomal distribution of 235 CcMYBs genes; gene names in blue boxes represent tandem duplication. (B) Distribution of exon and intron length; the purple line is the density of the distribution.
Figure 1. Chromosomal distribution and distribution of exon and intron lengths in the CcMYBs genes. (A) Chromosomal distribution of 235 CcMYBs genes; gene names in blue boxes represent tandem duplication. (B) Distribution of exon and intron length; the purple line is the density of the distribution.
Horticulturae 10 00178 g001
Horticulturae 10 00178 g002
Figure 2. Phylogenetic tree of 182 R2R3-MYB transcription factors of C. chekiangoleosa. Different colored bands represent different subgroups.
Figure 2. Phylogenetic tree of 182 R2R3-MYB transcription factors of C. chekiangoleosa. Different colored bands represent different subgroups.
Horticulturae 10 00178 g002
Horticulturae 10 00178 g003
Figure 3. Expression pattern analysis, sequence comparison analysis of similar species, and phylogenetic analysis. (A) Clustering and expression pattern analysis of CcMYBs in different tissues of C. chekiangoleosa. Branches in red boxes represent genes highly expressed in the seed coat. Abbreviations represent different parts of tissues and organs, EM, embryo; EN, endocarp; EP, epicarp, FB. floral bud; ME, mesocarp; SC, seed coat. (B) Homologous sequence comparison of the CcMYB33 protein. The red color indicates the conserved amino acids. (C) Phylogenetic analysis of the CcMYB33 protein. The shading indicated the closely-related GAMYB genes.
Figure 3. Expression pattern analysis, sequence comparison analysis of similar species, and phylogenetic analysis. (A) Clustering and expression pattern analysis of CcMYBs in different tissues of C. chekiangoleosa. Branches in red boxes represent genes highly expressed in the seed coat. Abbreviations represent different parts of tissues and organs, EM, embryo; EN, endocarp; EP, epicarp, FB. floral bud; ME, mesocarp; SC, seed coat. (B) Homologous sequence comparison of the CcMYB33 protein. The red color indicates the conserved amino acids. (C) Phylogenetic analysis of the CcMYB33 protein. The shading indicated the closely-related GAMYB genes.
Horticulturae 10 00178 g003
Horticulturae 10 00178 g004
Figure 4. Relative expression levels of CcMYB33 in different tissues and subcellular localization analysis of the CcMYB33 protein. (A) Different tissue parts of C. chekiangoleosa and their relative expressions. Abbreviations represent different parts of tissues and organs. ST, stamen; PE, petal; FI, filament; ML, mature leaf; TL, tender leaf; SE, sepal; CA, carpel. Different normal letters indicate significant difference in gene expression levels among different tissues (p < 0.05). (B) Subcellular localization analysis of the CcMYB33 protein. From left to right: GFP signal, nuclear signal from H2A-mCherry, light field, and merged signal. The white arrows indicate the nuclei.
Figure 4. Relative expression levels of CcMYB33 in different tissues and subcellular localization analysis of the CcMYB33 protein. (A) Different tissue parts of C. chekiangoleosa and their relative expressions. Abbreviations represent different parts of tissues and organs. ST, stamen; PE, petal; FI, filament; ML, mature leaf; TL, tender leaf; SE, sepal; CA, carpel. Different normal letters indicate significant difference in gene expression levels among different tissues (p < 0.05). (B) Subcellular localization analysis of the CcMYB33 protein. From left to right: GFP signal, nuclear signal from H2A-mCherry, light field, and merged signal. The white arrows indicate the nuclei.
Horticulturae 10 00178 g004
Horticulturae 10 00178 g005
Figure 5. Overexpression of CcMYB33 in Arabidopsis thaliana caused pleiotropical developmental defects. (A) Curling leaves in CcMYB33 transgenic lines. (B) Leaves of the heterologous strain were more curly compared to the WT. (C) Flowers of heterologously expressed strains undergo anther-petal fusion compared to the WT. The red arrow indicates the fused tissue of petal and stamen (D) Overexpressing strains bloomed later compared to the WT. (E) Paraffin sections of cross-sections of stems from overexpression strains and WT. (F) Relative expression levels of individuals in different strains. Different normal letters indicate significant difference in gene expression levels among different tissues (p < 0.05).
Figure 5. Overexpression of CcMYB33 in Arabidopsis thaliana caused pleiotropical developmental defects. (A) Curling leaves in CcMYB33 transgenic lines. (B) Leaves of the heterologous strain were more curly compared to the WT. (C) Flowers of heterologously expressed strains undergo anther-petal fusion compared to the WT. The red arrow indicates the fused tissue of petal and stamen (D) Overexpressing strains bloomed later compared to the WT. (E) Paraffin sections of cross-sections of stems from overexpression strains and WT. (F) Relative expression levels of individuals in different strains. Different normal letters indicate significant difference in gene expression levels among different tissues (p < 0.05).
Horticulturae 10 00178 g005
Table 1. All primers used in this study and their sequences.
Table 1. All primers used in this study and their sequences.
Primer NamePrimer Sequence (5′-3′)
CcMYB33-FGCAGTGCCTTTTCTCTCTCTAGA
CcMYB33-RGCAGGCTCCTTTAGCTGTTC
EX-GY2-FTCAGCAGTCGAAGAGCATGAGTCACATGACAAATGA
EX-GY2-RTTAGCGTGTGAAGAGCATCCATCCAAACAGACCCT
CchGAPDH-Q-FTGACCTCACTGCGAGGATTG
CchGAPDH-Q-RCCTCCTTGATAGCAGCTTTGATC
Cch-GY1-2FGGGAATTGGAATGCTGTTCAGA
Cch-GY1-2RGACGGCAACTTTTCCCACAA
Table 2. Numbers of MYB transcription factors in four plant species.
Table 2. Numbers of MYB transcription factors in four plant species.
SpeciesR2R33R1R and MYB-Related“Unusual” MYB Genes with Two or More RepeatsTotal
A. thaliana [35]1265642197
C. oleifera [36]1285449186
P. trichocarpa [37]19651521354
C. Chekiangoleosa1825435235
Table 3. Distribution of tandem repeat events on different chromosomes.
Table 3. Distribution of tandem repeat events on different chromosomes.
ChrNumberMember
Chr15CcMYB10, CcMYB11, CcMYB17, CcMYB18, CcMYB20, CcMYB21, CcMYB24, CcMYB25, CcMYB27, CcMYB28, CcMYB29, CcMYB30, CcMYB31
Chr22CcMYB40, CcMYB41, CcMYB50, CcMYB51
Chr33CcMYB62, CcMYB63, CcMYB64, CcMYB65, CcMYB66, CcMYB67, CcMYB68, CcMYB69, CcMYB70, CcMYB71, CcMYB74, CcMYB75
Chr52CcMYB89, CcMYB90, CcMYB92, CcMYB93
Chr63CcMYB97, CcMYB98, CcMYB99, CcMYB101, CcMYB102, CcMYB106, CcMYB107, CcMYB108, CcMYB109, CcMYB110
Chr73CcMYB117, CcMYB118, CcMYB119, CcMYB120, CcMYB121, CcMYB130, CcMYB131, CcMYB135, CcMYB136
Chr82CcMYB140, CcMYB141, CcMYB148, CcMYB149
Chr91CcMYB158, CcMYB159
Chr101CcMYB168, CcMYB169
Chr111CcMYB182, CcMYB183
Chr122CcMYB184, CcMYB185, CcMYB186, CcMYB187, CcMYB188, CcMYB189, CcMYB190
Chr132CcMYB200, CcMYB201, CcMYB206, CcMYB207
Chr141CcMYB219, CcMYB220
Chr151CcMYB226, CcMYB227, CcMYB228, CcMYB229, CcMYB230, CcMYB231, CcMYB232, CcMYB233
Table 4. Conserved motifs of subgroups.
Table 4. Conserved motifs of subgroups.
SubgroupConserved Motif
Subgroup1 (S1)YaSS[T/A]eNI[A/S][R/K]Ll
Subgroup2 (S2)IDeSFWx[E/D]xlstd; [E/N]ddMdFwynvfi
Subgroup3 (S3)QEVDKP[E/D]LLE[I/M]PFD; WFKHLESELGLEE[N/D]DNQQQ
Subgroup4 (S4)LlsrGIDPx[T/S]HRx[I/L]; pdLNL[D/E]Lxo[G/S]; CX1–2CX7–12CX2C(Zn-finger)
Subgroup5 (S5)SSDDCSSAASVS; PCFSGDGDGDWMDD
Subgroup6 (S6)VNNL[M/I][N/D]GDNMWLE
Subgroup7 (S7)KRR[L/P]GRT[G/S]RSAMKPK
Subgroup8 (S8)LRKMGIDplTHKPLS
Subgroup9 (S9)MGiDPvTHkp; HmaQWeSARleSEaRlxR[E/Q]SxL
Subgroup10 (S10)L[L/I]QMG[I/F]DP[M/V]THxPRTD
Subgroup11 (S11)LlrmGIDPVTHsPRldLLd[L/I]SSiL
Subgroup12 (S12)EY[N/D]F[S/P]QFLEQ; IT[G/S]WS[N/T]YLLDH
Subgroup13 (S13)GIDPxTHKPxSEV; DVFxKDLQRMA
Subgroup14 (S14)SFSQLLLDPN; TSTSADQSTISWEDI
Subgroup15 (S15)lWVheDdFELSsLtxMMdF
Subgroup16 (S16)LEFSEW[I/L]SSS[N/Y]PH[I/T]DYSS
Subgroup17 (S17)QR[E/Q][I/M]ELQQEQQL
Subgroup18 (S18)QRaGLPxYPx[E/S]
Subgroup19 (S19)nyWs[V/M][E/D]DlW[P/S]
Subgroup20 (S20)AkqLkcdvNSkqFkdtmrylWmPRL
Subgroup21 (S21)VppFFDFLSVGNSAS
Subgroup22 (S22)GEFMtVVQEMIkaEVRSYM
Subgroups were distinguished as previously reported in Arabidopsis. “x” represents any amino acid residue; the letters in “[]” represent amino acid residues in the same position; “/” stands for “or”.
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content.

Share and Cite

MDPI and ACS Style

Huang, M.; Li, S.; Wang, M.; Yin, H.; Li, H. Molecular Characterization of MYB Transcription Factors in Camellia chekiangoleosa Reveals That CcMYB33 Is an Important Regulator Involved in Multiple Developmental Processes. Horticulturae 2024, 10, 178. https://doi.org/10.3390/horticulturae10020178

AMA Style

Huang M, Li S, Wang M, Yin H, Li H. Molecular Characterization of MYB Transcription Factors in Camellia chekiangoleosa Reveals That CcMYB33 Is an Important Regulator Involved in Multiple Developmental Processes. Horticulturae. 2024; 10(2):178. https://doi.org/10.3390/horticulturae10020178

Chicago/Turabian Style

Huang, Mingchuan, Sijia Li, Minyan Wang, Hengfu Yin, and Haimei Li. 2024. "Molecular Characterization of MYB Transcription Factors in Camellia chekiangoleosa Reveals That CcMYB33 Is an Important Regulator Involved in Multiple Developmental Processes" Horticulturae 10, no. 2: 178. https://doi.org/10.3390/horticulturae10020178

Note that from the first issue of 2016, this journal uses article numbers instead of page numbers. See further details here.

Article Metrics

Back to TopTop