First Molecular Detection of Pathogens Leptospira in Common Rodent Captured in North Algeria Urban Areas
Abstract
1. Introduction
2. Materials and Methods
2.1. Regulatory and Ethical Aspects
2.2. Rodent’s Capture
2.3. Collecting Samples
2.4. DNA Extraction
2.5. Detection and Identification of Pathogenic Leptospires by Real-Time PCR Assays
2.6. Conventional PCR and Sequencing
3. Results
3.1. Capture of Rodents
3.2. Detection of the Leptospira DNA by Real-Time PCR
3.3. Leptospira Species Identification
4. Discussion
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Evangelista, K.V.; Coburn, J. Leptospira as an emerging pathogen: A review of its biology, pathogenesis and host immune responses. Future Microbiol. 2010, 5, 1413–1425. [Google Scholar] [CrossRef] [Scilit]
- Bharti, A.R.; Nally, J.E.; Ricaldi, J.N.; Matthias, M.A.; Diaz, M.M.; Lovett, M.A.; Levett, P.N.; Gilman, R.H.; Willig, M.R.; Gotuzzo, E. Leptospirosis: A zoonotic disease of global importance. Lancet Infect. Dis. 2003, 3, 757–771. [Google Scholar] [CrossRef] [Scilit]
- Costa, F.; Hagan, J.E.; Calcagno, J.; Kane, M.; Torgerson, P.; Martinez-Silveira, M.S.; Stein, C.; Abela-Ridder, B.; Ko, A.I. Global morbidity and mortality of leptospirosis: A systematic review. PLoS Negl. Trop. Dis. 2015, 9, e0003898. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bomfim, M.R.Q.; Barbosa-Stancioli, E.F.; Koury, M.C. Detection of pathogenic leptospires in urine from naturally infected cattle by nested PCR. Vet. J. 2008, 178, 251–256. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Levett, P.N. Systematics of leptospiraceae. In Leptospira and Leptospirosis; Adler, B., Ed.; Springer: Berlin/Heidelberg, Germany, 2015; p. 387. [Google Scholar] [CrossRef] [Scilit]
- Mohammed, H.; Nozha, C.; Hakim, K.; Abdelaziz, F.; Rekia, B. Leptospira: Morphology, classification and pathogenesis. J. Bacteriol. Parasitol. 2011, 2, 120. [Google Scholar] [CrossRef]
- NCBI National Center for Biotechnology Information Database. Available online: https://www.ncbi.nlm.nih.gov/genome (accessed on 30 December 2021).
- Korba, A.A.; Lounici, H.; Kainiu, M.; Vincent, A.T.; Mariet, J.F.; Veyrier, F.J.; Goarant, C.; Picardeau, M. Leptospira ainlahdjerensis sp. nov., Leptospira ainazelensis sp. nov., Leptospira abararensis sp. nov.and Leptospira chreensis sp. nov., four new species isolated from water sources in Algeria. Int. J. Syst. Evol. Microbiol. 2021, 71, 5148. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ko, A.I.; Goarant, C.; Picardeau, M. Leptospira: The dawn of the molecular genetics era for an emerging zoonotic pathogen. Nat. Rev. Microbiol. 2009, 7, 736–747. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ellis, W.A. Animal leptospirosis. Curr. Top. Microbiol. Immunol. 2015, 387, 99–137. [Google Scholar] [CrossRef] [Scilit]
- Plank, R.; Dean, D. Overview of the epidemiology, microbiology, and pathogenesis of Leptospira spp. in humans. Microbes Infect. 2000, 2, 1265–1276. [Google Scholar] [CrossRef] [Scilit]
- Thaipadungpanit, J.; Wuthiekanun, V.; Chierakul, W.; Smythe, L.D.; Petkanchanapong, W.; Limpaiboon, R.; Apiwatanaporn, A.; Slack, A.T.; Suputtamongkol, Y.; White, N.J.; et al. A dominant clone of Leptospira interrogans associated with an outbreak of human leptospirosis in Thailand. PLoS Negl. Trop. Dis. 2007, 1, e56. [Google Scholar] [CrossRef] [Scilit]
- Boey, K.; Shiokawa, K.; Rajeev, S. Leptospira infection in rats: A literature review of global prevalence and distribution. PLoS Negl. Trop. Dis. 2019, 13, e0007499. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Rahelinirina, S.; Bourhy, P.; Andriamiaramanana, F.; Garin, B.; Rajerison, M. High prevalence of Leptospira spp. in rodents in an urban setting in Madagascar. Am. J. Trop. Med. Hyg. 2019, 100, 1079–1081. [Google Scholar] [CrossRef] [Scilit]
- Xu, G.; Qiu, H.; Liu, W.; Jiang, X.; Chang, Y.F.; Wang, J.; Li, Z.; Zhu, Y.; Zhang, C.; Xiao, F. Serological and molecular characteristics of pathogenic Leptospira in rodent populations in Fujian Province, China, 2018–2020. BMC Microbiol. 2022, 22, 151. [Google Scholar] [CrossRef] [Scilit]
- World Health Organization. Human Leptospirosis: Guidance for Diagnosis, Surveillance and Control, World Health Organization. 2003. Available online: http://www.who.int/csr/don/en/WHO_CDS_CSR_EPH_2002.23.pdf (accessed on 20 December 2020).
- Levett, P.N. Leptospirosis. J. Clin. Microbiol. Rev. 2001, 2, 296–326. [Google Scholar] [CrossRef] [Scilit]
- Andre-Fontaine, G. Canine leptospirosis—Do we have a problem? Vet. Microbiol. 2006, 117, 19–24. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Pappas, G.; Papadimitriou, P.; Siozopoulou, V.; Christou, L.; Akritidis, N. The globalization of leptospirosis: Worldwide incidence trends. Int. J. Infect. Dis. 2008, 12, 351–357. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Verma, A.; Matsunaga, J.; Artiushin, S.; Pinne, M.; Houwers, D.J.; Haake, D.A.; Stevenson, B.; Timoney, J.F. Antibodies to a novel leptospiral protein, LruC, in the eye fluids and sera of horses with Leptospira-associated uveitis. Clin. Vaccine Immunol. 2012, 19, 452–456. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Afiri, M.; Toudeft, F.; AitKaid, D. Leptospirosis epidemic: 48 cases. Med. Sante Trop. 2013, 23, 234. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Afiri, M. Renal manifestations of leptospirosis: 88 cases. Med. Sante Trop. 2013, 23, 234–235. [Google Scholar] [CrossRef] [Scilit]
- Zaidi, S.; Bouam, A.; Bessas, A.; Hezil, D.; Ghaoui, H.; Ait-Oudhia, K.; Drancourt, M.; Bitam, I. Urinary shedding of pathogenic Leptospira in stray dogs and cats, Algiers: A prospective study. PLoS ONE 2018, 13, e0197068. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Derdour, S.Y.; Hafsi, F.; Azzag, N.; Tennah, S.; Laamari, A.; China, B.; Ghalmi, F. Prevalence of the main infectious causes of abortion in dairy cattle in Algeria. J. Vet. Res. 2017, 61, 337. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Benseghir, H.; Amara-Korba, A.; Azzag, N.; Hezil, D.; Ghalmi, F. Seroprevalence of and associated risk factors for Leptospira interrogans serovar Hardjo infection of cattle in Setif, Algeria. Afr. J. Clin. Exp. Microbiol. 2020, 21, 185–191. [Google Scholar] [CrossRef]
- Yahiaoui, W.I.; Amara-Korba, A.; Aggad, H.; Khelef, D. Seroprevalence of leptospirosis in some farms of Algiers (Algeria). Lucr. Stiintifice-Univ. De StiinteAgric. A Banat. Timis. Med. Vet. 2018, 51, 111–118. [Google Scholar]
- Ruedas, L.A. Rattus Norvegicus (Errata Version Published in 2020), IUCN Red List Threat. Species. 2016, p. e.T19353A165118026. Available online: https://www.iucnredlist.org (accessed on 29 December 2020).
- Krystufek, B.; Palomo, L.; Hutterer, R.; Mitsain, G.; Yigit, N. RattusRattus (Errata Version), IUCN Red List Threat. Species. 2017, p. e.T19360A115148682. Available online: https://www.iucnredlist.org/species/19360/192565917 (accessed on 29 December 2020).
- Musser, G.; Hutterer, R.; Krystufek, B.; Yigit, N.; Mitsain, G. MusMusculus (Errata Version), IUCN Red List of Threatened Species. 2017, p. e.T13972A115117618. Available online: https://www.iucnredlist.org/species/13972/197519724 (accessed on 29 December 2020).
- Ahmim, M. Les Mammiferes d’Algerie. Des Origines A Nos Jours; Ministère de l’Aménagement du Territoire et de l’Environnement: Alger, Algérie, 2004; p. 266. [Google Scholar]
- Herbreteau, V.; Jittapalapong, S.; Rerkamnuaychoke, W.; Chaval, Y.; Cosson, J.F.; Morand, S. Protocols for Field and Laboratory Rodent Studies; Kasetsart University: Bangkok, Thailand, 2011; p. 51. [Google Scholar]
- Waggoner, J.J.; Balassiano, I.; Abeynayake, J.; Sahoo, M.K.; Mohamed-Hadley, A.; Liu, Y.; Vital-Brazil, J.M.; Pinsky, B.A. Sensitive real-time PCR detection of pathogenic Leptospira spp. and a comparison of nucleic acid amplification methods for the diagnosis of leptospirosis. PLoS ONE 2014, 9, e112356. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ferreira, A.S.; Costa, P.; Rocha, T.; Amaro, A.; Vieira, M.L.; Ahmed, A.; Thompson, G.; Hartskeerl, R.A.; Inácio, J. Direct detection and differentiation of pathogenic Leptospira species using a multi-gene targeted real time PCR approach. PLoS ONE 2014, 9, e112312. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Postic, D.; Riquelme-Sertour, N.; Merien, F.; Perolat, P.; Baranton, G. Interest of partial 16S rDNA gene sequences to resolve heterogeneities between Leptospira collections: Application to L. meyeri. Res. Microbiol. 2000, 151, 333–341. [Google Scholar] [CrossRef] [Scilit]
- BLAST: Basic Local Alignment Search Tool. Available online: https://blast.ncbi.nlm.nih.gov/Blast.cgi (accessed on 30 December 2020).
- Dobigny, G.; Garba, M.; Tatard, C.; Loiseau, A.; Galan, M.; Kadaoure, I.; Rossi, J.P.; Picardeau, M.; Bertherat, E. Urban market gardening and rodent-borne pathogenic Leptospira in arid zones: A case study in Niamey, Niger. PLoS Negl. Trop. Dis. 2015, 9, e0004097. [Google Scholar] [CrossRef] [Scilit]
- Felt, S.A.; Wasfy, M.O.; Wael, F.; Samir, A.; Rahaman, B.A.; Boshra, M.; Parker, T.M.; Hatem, M.E.; El-Bassiouny, A.A.; Murray, C.K. Cross-species surveillance of Leptospira in domestic and peri-domestic animals in Mahalla City, Gharbeya Governorate, Egypt. Am. J. Trop. Med. Hyg. 2011, 84, 420–425. [Google Scholar] [CrossRef] [Scilit]
- Samir, A.; Soliman, R.; El-Hariri, M.; Abdel-Moein, K.; Hatem, M.E. Leptospirosis in animals and human contacts in Egypt: Broad range surveillance. Rev. Soc. Bras. Med. Trop. 2015, 48, 272–277. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Halliday, J.E.B.; Knobel, D.L.; Allan, K.J.; Bronsvoort, B.M.D.C.; Handel, I.; Agwanda, B.; Cutler, S.J.; Olack, B.; Ahmed, A.; Hartskeerl, R.A.; et al. Urban leptospirosis in Africa: A cross-sectional survey of Leptospira infection in rodents in the Kibera urban settlement, Nairobi, Kenya. Am. J. Trop. Med. Hyg. 2013, 89, 1095–1102. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Millán, J.; Cevidanes, A.; Chirife, A.D.; Candela, M.G.; León-Vizcaíno, L. Risk factors of Leptospira infection in Mediterranean periurban micromammals. Zoonoses Public Health 2018, 65, e79–e85. [Google Scholar] [CrossRef] [Scilit]
- Izquierdo-Rodríguez, E.; Fernandez-Alvarez, A.; Martín-Carrillo, N.; Marchand, B.; Feliu, C.; Miquel, J.; Foronda, P.; Quilichini, Y. Pathogenic Leptospira species in rodents from Corsica (France). PLoS ONE 2020, 15, e0233776. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Vitale, M.; Agnello, S.; Chetta, M.; Amato, B.; Vitale, G.; Bella, C.D.; Vicari, D.; Presti, V.D.M.L. Human leptospirosis cases in Palermo Italy. The role of rodents and climate. J. Infect. Public Health 2018, 11, 209–214. [Google Scholar] [CrossRef] [Scilit]
- Zilber, A.L.; Belli, P.; Artois, M.; Kodjo, A.; Djelouadji, Z. First Observation of Leptospira interrogans in the Lungs of Rattusnorvegicus. Biomed Res. Int. 2016, 2016, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Athanazio, D.A.; Silva, E.F.; Santos, C.S.; Rocha, G.M.; Vannier-Santos, M.A.; McBride, A.J.A.; Ko, A.I.; Reis, M.G. Rattusnorvegicus as a model for persistent renal colonization by pathogenic Leptospira interrogans. Acta Trop. 2008, 105, 176–180. [Google Scholar] [CrossRef] [Scilit]
- Ratet, G.; Veyrier, F.J.; Fantond’Andon, M.; Kammerscheit, X.; Nicola, M.A.; Picardeau, M.; Boneca, I.G.; Werts, C. Live imaging of bioluminescent Leptospira interrogans in mice reveals renal colonization as a stealth escape from the blood defenses and antibiotics. PLoS Negl. Trop. Dis. 2014, 8, e3359. [Google Scholar] [CrossRef] [Scilit]
- Houemenou, G.; Ahmed, A.; Libois, R.; Hartskeerl, R.A. Leptospira spp. Prevalence in Small Mammal Populations in Cotonou, Benin. ISRN Epidemiol. 2013, 2013, 8. [Google Scholar] [CrossRef] [Scilit]
- Griffiths, J.; Yeo, H.L.; Yap, G.; Mailepessov, D.; Johansson, P.; Low, H.T.; Siew, C.C.; Lam, P.; Ng, L.C. Survey of rodent-borne pathogens in Singapore reveals the circulation of Leptospira spp., Seoul hantavirus, and Rickettsia typhi. Sci. Rep. 2022, 12, 1–14. [Google Scholar] [CrossRef] [Scilit]
- Biscornet, L.; Révillion, C.; Jégo, S.; Lagadec, E.; Gomard, Y.; Le Minter, G.; Rocamora, G.; Guernier-Cambert, V.; Mélade, J.; Dellagi, K. Predicting the presence of leptospires in rodents from environmental indicators opens up opportunities for environmental monitoring of human leptospirosis. Remote Sens. 2021, 13, 325. [Google Scholar] [CrossRef] [Scilit]
- Krøjgaard, L.H.; Villumsen, S.; Markussen, M.D.K.; Jensen, J.S.; Leirs, H.; Heiberg, A.C. High prevalence of Leptospira spp. in sewer rats (Rattusnorvegicus). Epidemiol. Infect. 2009, 137, 1586–1592. [Google Scholar] [CrossRef] [Scilit]
- Santos, A.A.N.; Ribeiro, P.D.S.; da França, G.V.; Souza, F.N.; Ramos, E.A.G.; Figueira, C.P.; Reis, M.G.; Costa, F.; Ristow, P. Leptospirainterrogans biofilm formation in Rattus norvegicus (Norway rats) natural reservoirs. PLoS Negl. Trop. Dis. 2021, 15, e0009736. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Desvars-Larrive, A.; Smith, S.; Munimanda, G.; Bourhy, P.; Waigner, T.; Odom, M.; Gliga, D.S.; Walzer, C. Prevalence and risk factors of Leptospira infection in urban brown rats (Rattus norvegicus), Vienna, Austria. Urban Ecosyst. 2020, 23, 775–784. [Google Scholar] [CrossRef] [Scilit]
- Minter, A.; Himsworth, C.G.; Byers, K.A.; Childs, J.E.; Ko, A.I.; Costa, F. Tails of two cities: Age and wounding are associated with carriage of Leptospira interrogans by Norway rats (Rattus norvegicus) in ecologically distinct urban environments. Front. Ecol. Evol. 2019, 7, 14. [Google Scholar] [CrossRef] [Scilit]
- Minter, A.; Diggle, P.J.; Costa, F.; Childs, J.; Ko, A.I.; Begon, M. Evidence of multiple intraspecific transmission routes for Leptospira acquisition in Norway rats (Rattus norvegicus). Epidemiol. Infect. 2017, 145, 3438–3448. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Theuerkauf, J.; Perez, J.; Taugamoa, A.; Niutoua, I.; Labrousse, D.; Gula, R.; Bogdanowicz, W.; Jourdan, H.; Goarant, C. Leptospirosis risk increases with changes in species composition of rat populations. Naturwissenschaften 2013, 100, 385–388. [Google Scholar] [CrossRef] [Scilit]
- Schweinfurth, M.K. The social life of Norway rats (Rattus norvegicus). Elife 2020, 9, e54020. [Google Scholar] [CrossRef] [Scilit]
- Mohamed-Hassan, S.N.; Bahaman, A.R.; Mutalib, A.R.; Khairani-Bejo, S. Serological prevalence of leptospiral infection in wild rats at the National Service Training Centres in Kelantan and Terengganu. Trop. Biomed. 2010, 27, 30–32. [Google Scholar] [PubMed]
- Guiry, E.; Buckley, M. Urban rats have less variable, higher protein diets. Proc. R. Soc. B Boil. Sci. 2018, 285, 20181441. [Google Scholar] [CrossRef] [Scilit]
- Desvars-Larrive, A.; Baldi, M.; Walter, T.; Zink, R.; Walzer, C. Brown rats (Rattus norvegicus) in urban ecosystems: Are the constraints related to fieldwork a limit to their study? Urban Ecosyst. 2018, 21, 951–964. [Google Scholar] [CrossRef] [Scilit]
- Moseley, M.; Naidoo, K.; Bastos, A.; Retief, L.; Frean, J.; Telfer, S.; Rossouw, J. Multi-locus sequence analyses reveal a clonal L. borgpetersenii genotype in a heterogeneous invasive Rattus spp. community across the City of Johannesburg, South Africa. Parasit. Vectors 2020, 13, 1–9. [Google Scholar] [CrossRef] [Scilit]
- Shinya, S.; Muraoka, Y.; Negishi, D.; Koizumi, N. Molecular epidemiology of Leptospira spp. among wild mammals and a dog in AmamiOshima Island, Japan. PLoS ONE 2021, 16, e0249987. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Cordonin, C.; Turpin, M.; Bringart, M.; Bascands, J.L.; Flores, O.; Dellagi, K.; Mavingui, P.; Roche, M.; Tortosa, P. Pathogenic Leptospira and their animal reservoirs: Testing host specificity through experimental infection. Sci. Rep. 2020, 10, 1–8. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Bulach, D.M.; Zuerner, R.L.; Wilson, P.; Seemann, T.; McGrath, A.; Cullen, P.A.; Davis, J.; Johnson, M.; Kuczek, E.; Alt, D.P. Genome reduction in Leptospira borgpetersenii reflects limited transmission potential. Proc. Natl. Acad. Sci. USA 2006, 103, 14560–14565. [Google Scholar] [CrossRef] [Scilit] [PubMed]

| Prime/Probe | Sequence5′-3′ | Targeted Gene |
|---|---|---|
| Forward Reverse Pathogen probe | CGGGAGGCAGCAGTTAAGAA CGTATGGTGCAAGCGTTGTT GCAATGTGATGATGGTACCTGCC | Leptospira 16S rRNA (rrs) gene [32] |
| PFLint2 PRLint2 TaqLint2 | CTT GAG CCT GCG CGT TAY C CCG ATA ATT CCA GCG AAG ATC TET-CTC ATT TGG TTA GGA GAA CAG ATC A-BHQ1 | secY gene of L. interrogans [33] |
| F_bpn R_bpn1 TqM_bpn | GAT TCG GGT TAC AAT TAG ACC TTG ATC TAA CCG GAC CAT AGT Cy5.5 (Quasar 705)-TAC TAA GGA TGG TTT GGA CGC TGC-BHQ2 | ompL1 gene of L. borgpetersenii [33] |
| F_nery R_nery TqM_nery | CTG GCT TAA TCA ATG CTT CTG CTC TTT CGG TGA TCT GTT CC Texas Red-CAG TTC CAG TTG TAA TAG ATA AGA TTC-BHQ2 | secY gene of L. kirschneri [33] |
| FLnog2 RLnog2 TaqLnog | TCA GGG TGT AAG AAA GGT TC CAA AAT TAA AGA AGA AGC AAA GAT FAM-CGA TTG GCT TTT TGC TTG AAC CATC-BHQ1 | secY gene of L. noguchii [33] |
| Total Number | Positive Number | ||
|---|---|---|---|
| Gender | Female | 49 | 17 |
| Male | 52 | 24 | |
| Age | Adult | 89 | 39 |
| Subadult | 4 | 1 | |
| Young | 8 | 1 | |
| Habitat | Urban | 62 | 28 |
| Peri-urban | 27 | 10 | |
| Rural | 12 | 3 |
| Total Number | Positive Number | Prevalence | ||
|---|---|---|---|---|
| Rodent species | Rattus Norvegicus | 95 | 40 | 42.1%, 95% IC [32–52.7%] |
| Rattus Rattus | 5 | 1 | 20%, 95% IC [0.5–71.6%] | |
| Mus Musculus | 1 | 0 | 0%, 95% IC [0–97.5%] | |
| Total | 101 | 41 | 40.6%, 95% IC [30.9–50.8%] |
| Rodent Specimen (n) | Total Positive | Species-Specific PCR Identification | Sequencing * | Unknown |
|---|---|---|---|---|
| Kidney (101) | 36 | 30 | 5 | 1 |
| Lung (101) | 3 | 1 | 2 | 0 |
| Urine (24) | 13 | 11 | 1 | 1 |
| Total(226) | 52 | 42 | 8 | 2 |
| Number of Leptospira Species Identified | |||
|---|---|---|---|
| Rodent Positive Specimen (n) | L. interrogans | L.borgpetersenii | Unknown |
| Kidney (36) | 34 | 1 | 1 |
| Lung (3) | 3 | 0 | 0 |
| Urine (13) | 12 | 0 | 1 |
| Total (52) | 49 | 1 | 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lekhal, L.; Harran, E.; Aragon, A.; Groud, K.; Le Guyader, M.; Kaidi, R.; Khelef, D.; Djelouadji, Z. First Molecular Detection of Pathogens Leptospira in Common Rodent Captured in North Algeria Urban Areas. Trop. Med. Infect. Dis. 2022, 7, 335. https://doi.org/10.3390/tropicalmed7110335
Lekhal L, Harran E, Aragon A, Groud K, Le Guyader M, Kaidi R, Khelef D, Djelouadji Z. First Molecular Detection of Pathogens Leptospira in Common Rodent Captured in North Algeria Urban Areas. Tropical Medicine and Infectious Disease. 2022; 7(11):335. https://doi.org/10.3390/tropicalmed7110335
Chicago/Turabian StyleLekhal, Lila, Elena Harran, Anaïs Aragon, Karine Groud, Marine Le Guyader, Rachid Kaidi, Djamel Khelef, and Zouheira Djelouadji. 2022. "First Molecular Detection of Pathogens Leptospira in Common Rodent Captured in North Algeria Urban Areas" Tropical Medicine and Infectious Disease 7, no. 11: 335. https://doi.org/10.3390/tropicalmed7110335
APA StyleLekhal, L., Harran, E., Aragon, A., Groud, K., Le Guyader, M., Kaidi, R., Khelef, D., & Djelouadji, Z. (2022). First Molecular Detection of Pathogens Leptospira in Common Rodent Captured in North Algeria Urban Areas. Tropical Medicine and Infectious Disease, 7(11), 335. https://doi.org/10.3390/tropicalmed7110335

