Accumulation of Astragalosides and Related Gene Expression in Different Organs of Astragalus Membranaceus Bge. var Mongholicus (Bge.)
Abstract
:1. Introduction
2. Results and Discussion
2.1. Isolation and Sequence Analysis of 10 Terpenoid Genes from A. membranaceus
Gene Name | Full-Length (bp) | ORF(bp) | Amino Acid Sequence (aa) | MW(kDa) | pI Value | PSORT(Prediction of Targeting Localization) |
---|---|---|---|---|---|---|
AmAACT | - | 1155 | 384 | 39.48 | 6.03 | cytoplasm |
AmHMGS | 2088 | 1383 | 460 | 50.90 | 5.88 | microbody (peroxisome) |
AmHMGR1 | 2283 | 1707 | 568 | 60.84 | 8.45 | mitochondrial inner membrane |
AmHMGR2 | 2255 | 1695 | 564 | 60.15 | 6.89 | plasma membrane |
AmHMGR3 | 1971 | 1710 | 569 | 61.01 | 8.12 | plasma membrane |
AmMK | 1298 | 1167 | 388 | 41.04 | 5.48 | endoplasmic reticulum (membrane) |
AmPMK | - | 1527 | 508 | 55.13 | 5.67 | plasma membrane |
AmMVD | - | 1263 | 420 | 46.32 | 6.04 | microbody (peroxisome) |
AmIDI | - | 756 (partial) | 252 | - | - | plasma membrane |
AmFPS | 1167 | 1030 | 342 | 39.29 | 5.22 | cytoplasm |
AmSE | 2134 | 1587 | 528 | 57.41 | 8.92 | endoplasmic reticulum (membrane) |
AmCAS | 2833 | 2298 | 765 | 87.64 | 6.41 | microbody (peroxisome) |
2.2. Expression Levels of Triterpenoid Biosynthetic Genes in Different Organs of A. Membranaceus
2.3. Analyses of Astragalosides in Different Organs of A. Membranaceus
3. Experimental Section
3.1. Plant Materials and Growth Conditions
3.2. Total RNA Extraction and cDNA Preparation
3.3. Illumina Sequencing
3.4. Quantitative Real-Time PCR Analysis
3.5. Bioinformatics Analysis
Primer Name | Sequence 5' → 3' | Size (bp) |
---|---|---|
AmAACT-RT(F) | GGTGAGCGGAGAGAAGGCAT | 110 |
AmAACT-RT(R) | CGAGTGCTGGAGCGGTTGTA | |
AmHMGS-RT(F) | CCTTCTTCGGCATTGCTTTCATC | 127 |
AmHMGS-RT(R) | TCGAGATCCCGGCTTTGGTA | |
AmHMGR1-RT(F) | CCTTCTTCGGCATTGCTTTCATC | 180 |
AmHMGR1-RT(R) | ACTCCGGCAGTGGTTTCCTG | |
AmHMGR2-RT(F) | GCCGGCCACCATAAACGA | 155 |
AmHMGR2-RT(R) | CGACGGAGAAGAAGAGGGTGAA | |
AmHMGR3-RT(F) | GCCGGCCACCATAAACGA | 164 |
AmHMGR3-RT(R) | GGTCGGCAATTTTCGATGGTAG | |
AmMK-RT(F) | AACATGCCGTTGTTCACGGA | 139 |
AmMK-RT(R) | AACTCCAATGCCGCATCGTT | |
AmPMK-RT(F) | AGATCACCCGGACAGGAAGGA | 142 |
AmPMK-RT(R) | CCGCACATAGCGATGACTTCC | |
AmMVD-RT(F) | TAAGGGAGATCCGCGCTCGT | 144 |
AmMVD-RT(R) | CAGCTGACGAAGCCAGTCCA | |
AmIDI-RT(F) | TGCTGGTGAGGGAGGTTTGAA | 116 |
AmIDI-RT(R) | TCATGTCAGCGACCTCACCAA | |
AmFPS-RT(F) | CGACCGGATGCTGGACTACA | 136 |
AmFPS-RT(R) | CCAACCAAGAGCACTGGCAA | |
AmSS-RT(F) | AAGCAGATCCCTCCGGAACC | 113 |
AmSS-RT(R) | ACAGCGTTGCGAAGTTCGGT | |
AmSE-RT(F) | TGGAACAAGGAACCGTGACATCT | 150 |
AmSE-RT(R) | ACAAAGAGAACGCCTCAAGTTGGA | |
AmCAS-RT(F) | TGGAGATTTCCCACAGCAGGA | 150 |
AmCAS-RT(R) | CAAGTTGCGGCATTTGGTGT | |
Am18S(F) | TGCAGAATCCCGTGAACCATC | 104 |
Am18S(R) | AGGCATCGGGCAACGATATG |
3.6. Astragaloside Analysis
3.7. Statistical Analysis
4. Conclusions
Supplementary Materials
Supplementary Files
Supplementary File 1Acknowledgments
Author Contributions
Conflicts of Interest
References
- Wojciechowski, M.F.; Sanderson, M.J.; Hu, J.M. Evidence on the monophyly of Astragalus (Fabaceae) and its major subgroups based on nuclear ribosomal DNA ITS and chloroplast DNA trnL intron data. Syst. Bot. 1999, 24, 409–437. [Google Scholar] [CrossRef]
- Wagner, H.; Bauer, R.; Xiao, P.G.; Chen, J.M.; Michler, G. Radix Astragali (Huang Qi). Chin. Drug Monogr. Anal. 1997, 1, 1–17. [Google Scholar]
- Zheng, X.Y. Pharmacopoeia of the Peoples Republic of China, Chinese Edn ed; Chemical Industry Press: Beijing, China, 2005; Volume 1, pp. 212–213. [Google Scholar]
- Davis, E.M.; Croteau, R. Cyclization enzymes in the biosynthesis of monoterpenes, sesquiterpenes, and diterpenes. In Biosynthesis: Aromatic Polyketides, Isoprenoids, Alkaloids; Leeper, F.J., Vederas, J.C., Eds.; Springer-Verlag: Heidelberg, Germany, 2000; Volume 209, pp. 53–95. [Google Scholar]
- Lichtenthaler, H.K.; Rohmer, M.; Schwender, J. Two independent biochemical pathway for isopentenyl diphosphate and isoprenoid biosynthesis in higher plants. Physiol. Plant. 1997, 101, 643–652. [Google Scholar] [CrossRef]
- Ding, Y.X.; Ou-Yang, X.; Shang, C.H.; Ren, A.; Shi, L.; Li, Y.X.; Zhao, M.W. Molecular cloning, characterization, and differential expression of a farnesyl-diphosphate synthase gene from the basidiomycetous fungus Ganoderma lucidum. Biosci. Biotechnol. Biochem. 2008, 72, 1571–1579. [Google Scholar] [CrossRef]
- Abe, I.; Rohmer, M.; Prestwich, G.D. Enzymatic cyclization of squalene and oxidosqualene to sterols and triterpenes. Chem. Rev. 1993, 93, 2189–2206. [Google Scholar] [CrossRef]
- Huang, Z.; Jiang, K.; Pi, Y.; Hou, R.; Liao, Z.; Cao, Y.; Han, X.; Wang, Q.; Sun, X.; Tang, K. Molecular cloning and characterization of the yew gene encoding squalene synthase from Taxus cuspidata. J. Biochem. Mol. Biol. 2007, 40, 625–635. [Google Scholar] [CrossRef]
- He, F.; Zhu, Y.; He, M.; Zhang, Y. Molecular cloning and characterization of the gene encoding squalene epoxidase in Panax notoginseng. DNA Seq. 2008, 19, 270–273. [Google Scholar]
- Nes, W.D.; Heftmann, E. A comparison of triterpenoids with steroids as membrane components. J. Nat. Prod. 1981, 44, 377–400. [Google Scholar] [CrossRef]
- Song, Z.H.; Ji, Z.N.; Lo, C.K.; Dong, T.T.; Zhao, K.J.; Li, O.T.; Haines, C.J.; Kung, S.D.; Tsim, K.W. Chemical and biological assessment of a traditional Chinese herbal decoction prepared from Radix Astragali and Radix Angelicae Sinensis: Orthogonal array design to optimize the extraction of chemical constituents. Planta Med. 2004, 70, 1222–1227. [Google Scholar] [CrossRef]
- Wu, F.; Chen, X. A review of pharmacological study on Astragalus membranaceus (Fisch.) Bge. Zhong Yao Cai 2004, 27, 232–234. [Google Scholar]
- Kwon, H.J.; Hwang, J.; Lee, S.K.; Park, Y.D. Astragaloside content in the periderm, cortex, and xylem of Astragalus membranaceus root. J. Nat. Med. 2013, 67, 850–855. [Google Scholar] [CrossRef]
- Lai, P.K.; Chan, J.Y.; Cheng, L.; Lau, C.P.; Han, S.Q.; Leung, P.C.; Fung, K.P.; Lau, C.B. Isolation of anti-inflammatory fractions and compounds from the root of Astragalus membranaceus. Phytoth. Res. 2013, 27, 581–587. [Google Scholar] [CrossRef]
- Pan, H.; Wang, Y.; Zhang, Y.; Zhou, T.; Fang, C.; Nan, P.; Wang, X.; Li, X.; Wei, Y.J.C. Phenylalanine ammonia lyase functions as a switch directly controlling the accumulation of calycosin and calycosin-7-O-b-d-glucoside in Astragalus membranaceus var. mongholicus plants. J. Exp. Bot. 2008, 59, 3027–3037. [Google Scholar] [CrossRef]
- Xu, R.Y.; Nan, P.; Yang, Y.; Pan, H.; Zhou, T.; Chen, J. Ultraviolet irradiation induces accumulation of isoflavonoids and transcription of genes of enzymes involved in the calycosin-7-O-β-d-glucoside pathway in Astragalus membranaceus Bge. var. mongholicus (Bge.) Hsiao. Physiol. Plant. 2011, 142, 265–273. [Google Scholar] [CrossRef]
- Han, L.; Chen, K.J. Progress of experimental pharmacologic study on the effect of Astragalus on the cardiac vascular system. Chin. J. Integr. Med. 2000, 20, 234–237. [Google Scholar]
- Huang, C.L.; Lu, Y.P. Effect of Astragalus injection on insulin resistance in auxiliary treating patients with diabetes mellitus type 2. Chin. J. Integr. Med. 2003, 23, 779–780. [Google Scholar]
- Liu, Z.Q.; Li, Q.Z.; Qin, G.J. Effect of Astragalus injection on platelet function and plasma endothelin in patients with early stage diabetic nephropathy. Chin. J. Integr. Med. 2001, 21, 274–276. [Google Scholar]
- Chen, X.; Peng, L.H.; Li, N.; Li, Q.M.; Li, P.; Fung, K.P.; Leung, P.C.; Gao, J.Q. The healing and anti-scar effects of astragaloside IV on the wound repair in vitro and in vivo. J. Ethnopharmacol. 2012, 139, 721–727. [Google Scholar] [CrossRef]
- Anderson, V.E.; Bahnson, B.J.; Wlassics, I.D.; Walsh, C.T. The reaction of acetyldithio-CoA, a readily enolized analog of acetyl-CoA with thiolase from Zoogloea ramigera. J. Biol. Chem. 1990, 265, 6255–6261. [Google Scholar]
- Williams, S.F.; Palmer, M.A.; Peoples, O.P.; Walsh, C.T.; Sinskey, A.J.; Masamune, S. Biosynthetic thiolase from Zoogloea ramigera. Mutagenesis of the putative active-site base Cys-378 to Ser-378 changes the partitioning of the acetyl S-enzyme intermediate. J. Biol. Chem. 1992, 267, 16041–16043. [Google Scholar]
- Disch, A.; Hemmerlin, A.; Bach, T.J.; Rohmer, M. Mevalonate-derived isopentenyl diphosphate is the biosynthetic precursor of ubiquinone prenyl side chain in tobacco BY-2 cells. Biochem. J. 1998, 331, 615–621. [Google Scholar]
- Vishwakarma, R.K.; Ruby, V.; Singh, S.; Sonawane, P.D.; Srivastava, S.; Kumari, U.; Santosh, R.J.; Kumar, U.; Khan, B.M. Molecular cloning, biochemical characterization, and differential expression of an Acetyl-CoA C acetyltransferase gene (AACT) of Brahmi (Bacopa monniera). Plant Mol. Biol. Rep. 2013, 31, 547–557. [Google Scholar] [CrossRef]
- Ahumada, I.; Cairó, A.; Hemmerlin, A.; González, V.; Pateraki, I.; Bach, T.J.; Rodríguez-Concepción, M.; Campos, N.; Boronat, A. Characterization of the gene family encoding acetoacetyl-CoA thiolase in Arabidopsis. Funct. Plant Biol. 2008, 35, 1100–1111. [Google Scholar] [CrossRef]
- Cui, G.; Huang, L.; Tang, X.; Zhao, J. Candidate genes involved in tanshinone biosynthesis in hairy roots of Salvia miltiorrhiza revealed by cDNA microarray. Mol. Biol. Rep. 2011, 38, 2471–2478. [Google Scholar] [CrossRef]
- Soto, G.; Stritzler, M.; Lisi, C.; Alleva, K.; Pagano, M.E.; Ardila, F.; Mozzicafreddo, M.; Cuccioloni, M.; Angeletti, M.; Ayub, N.D. Acetoacetyl-CoA thiolase regulates the mevalonate pathway during abiotic stress adaptation. J. Exp. Bot. 2011, 62, 5699–5711. [Google Scholar] [CrossRef]
- Brown, M.S.; Goldstein, J.L. Multivalent feedback regulation of HMG CoA reductase, a control mechanism coordinating isoprenoid synthesis and cell growth. J. Lipid Res. 1980, 21, 505–517. [Google Scholar]
- Goldstein, J.L.; Brown, M.S. Regulation of the mevalonate pathway. Nature 1990, 343, 425–430. [Google Scholar] [CrossRef]
- Thorne Research Inc. Astragalus membranaceus. Monograph. Alternat. Med. Rev. 2003, 8, 72–77. [Google Scholar]
- Ma, X.Q.; Shi, Q.; Duan, J.A.; Dong, T.T.; Tsim, K.W. Chemical analysis of Radix Astragali (Huangqi) in China: A comparison with its adulterants and seasonal variations. J. Agric. Food Chem. 2002, 50, 4861–4866. [Google Scholar] [CrossRef]
- Luo, Y.; Qin, Z.; Hong, Z.; Zhang, X.; Ding, D.; Fu, J.; Zhang, W.; Chen, J. Astragaloside IV protects against ischemic brain injury in a murine model of transient focal ischemia. Neurosci. Lett. 2004, 363, 218–223. [Google Scholar] [CrossRef]
- Zhang, W.; Chen, H.; Zhang, C.; Liu, R.; Li, H.; Chen, H. Astragaloside IV from Astragalus membranaceus shows cardioprotection during myocardial ischemia in vivo and in vitro. Planta Med. 2006, 72, 4–8. [Google Scholar] [CrossRef]
- Chen, G.; Huang, W. Progress in pharmacological effects of compositions of Astragalus membranaceus. Chin. J. New Drugs 2008, 17, 1482–1485. [Google Scholar]
- Yung, L.Y.; Lam, W.S.; Ho, M.K.C.; Hu, Y.; Ip, F.C.F.; Pang, H.; Chin, A.C.; Harley, C.B.; Ip, N.Y.; Wong, Y.H. Astragaloside IV and cycloastragenol stimulate the phosphorylation of extracellular signal-regulated protein kinase in multiple cell types. Planta Med. 2012, 78, 115–121. [Google Scholar] [CrossRef]
- De Jesus, B.B.; Schneeberger, K.; Vera, E.; Tejera, A.; Harley, C.B.; Blasco, M.A. The telomerase activator TA-65 elongates short telomeres and increases health span of adult/old mice without increasing cancer incidence. Aging Cell 2011, 10, 604–621. [Google Scholar] [CrossRef]
- Sando, T.; Takaoka, C.; Mukai, Y.; Yamashita, A.; Hattori, M.; Ogasawara, N.; Fukusaki, E.; Kobayashi, A. Cloning and characterization of mevalonate pathway genes in a natural rubber producing plant, Hevea brasiliensis. Biosci. Biotechnol. Biochem. 2008, 72, 2049–2060. [Google Scholar] [CrossRef]
- Dhaubhadel, S.; McGarvey, B.D.; Williams, R.; Gijzen, M. Isoflavonoid biosynthesis and accumulation in developing soybean seeds. Plant Mol. Biol. 2003, 53, 733–743. [Google Scholar] [CrossRef]
- Gillissen, B.; Burkle, L.; Andre, B.; Kuhn, C.; Rentsch, D.; Brandl, B.; Frommer, W.B. A new family of high-affinity transporters for adenine, cytosine, and purine derivatives in Arabidopsis. Plant Cell 2000, 12, 291–300. [Google Scholar] [CrossRef]
- Lykkesfeldt, J.; Moller, B.L. Synthesis of Benzylglucosinolate in Tropaeolum majus L. (Isothiocyanates as Potent Enzyme Inhibitors). Plant Physiol. 1993, 102, 609–613. [Google Scholar]
- Chen, S.; Halkier, B.A. Characterization of glucosinolate uptake by leaf protoplasts of Brassica napus. J. Biol.Chem. 2000, 275, 22955–22960. [Google Scholar] [CrossRef]
- Kim, Y.B.; Thwe, A.A.; Li, X.; Tuan, P.A.; Zhao, S.; Park, C.G.; Lee, J.W.; Park, S.U. Accumulation of flavonoids and related gene expressions in different organs of Astragalus membranaceus Bge. Appl. Biochem. Biotechnol. 2014. [Google Scholar] [CrossRef]
- Gambino, G.; Perrone, I.; Gribaudo, I. A rapid and effective method for RNA extraction from different tissues of grapevine and other woody plants. Phytochem. Anal. 2008, 19, 520–525. [Google Scholar] [CrossRef]
- Schulz, M.H.; Zerbino, D.R.; Vingron, M.; Birney, E. Oases: Robust de novo RNA-seq assembly across the dynamic range of expression levels. Bioinformatics 2012, 28, 1086–1092. [Google Scholar] [CrossRef]
- Koressaar, T.; Remm, M. Enhancements and modifications of primer design program Primer3. Bioinformatics 2007, 23, 1289–1291. [Google Scholar] [CrossRef]
- Morgulis, A.; Coulouris, G.; Raytselis, Y.; Madden, T.L.; Agarwala, R.; Schäffer, A.A. Database indexing for production MegaBLAST searches. Bioinformatics 2008, 15, 1757–1764. [Google Scholar]
- Bjellqvist, B.; Hughes, G.J.; Pasquali, Ch.; Paquet, N.; Ravier, F.; Sanchez, J.-C.; Frutiger, S.; Hochstrasser, D.F. The focusing positions of polypeptides in immobilized pH gradients can be predicted from their amino acid sequences. Electrophoresis 1993, 14, 1023–1031. [Google Scholar] [CrossRef]
- Horton, P.; Park, K.-J.; Obayashi, T.; Nakai, K. Protein subcellular localization prediction with WoLF PSORT. In Proceedings of the 4th Annual Asia Pacific Bioinformatics Conference APBC06, Taipei, Taiwan; 2006; pp. 39–48. [Google Scholar]
- Thwe, A.A.; Mai, N.T.T.; Li, X.; Kim, Y.; Kim, Y.B.; Uddin, M.R.; Kim, Y.S.; Bae, H.; Kim, H.H.; Lee, M.Y. Production of astragaloside and flavones from adventitious root cultures of Astragalus membranaceus var. mongholicus. Plant Omics J. 2012, 5, 466–470. [Google Scholar]
- Sample Availability: Samples of the compounds analyzed herein are unavailable from the authors due to their isolation on a small scale. They are readily analyzed using the procedures described.
© 2014 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Kim, Y.B.; Thwe, A.A.; Li, X.; Tuan, P.A.; Lee, S.; Lee, J.W.; Arasu, M.V.; Al-Dhabi, N.A.; Park, S.U. Accumulation of Astragalosides and Related Gene Expression in Different Organs of Astragalus Membranaceus Bge. var Mongholicus (Bge.). Molecules 2014, 19, 10922-10935. https://doi.org/10.3390/molecules190810922
Kim YB, Thwe AA, Li X, Tuan PA, Lee S, Lee JW, Arasu MV, Al-Dhabi NA, Park SU. Accumulation of Astragalosides and Related Gene Expression in Different Organs of Astragalus Membranaceus Bge. var Mongholicus (Bge.). Molecules. 2014; 19(8):10922-10935. https://doi.org/10.3390/molecules190810922
Chicago/Turabian StyleKim, Yeon Bok, Aye Aye Thwe, Xiaohua Li, Pham Anh Tuan, Sanghyun Lee, Jong Won Lee, Mariadhas Valan Arasu, Naif Abdullah Al-Dhabi, and Sang Un Park. 2014. "Accumulation of Astragalosides and Related Gene Expression in Different Organs of Astragalus Membranaceus Bge. var Mongholicus (Bge.)" Molecules 19, no. 8: 10922-10935. https://doi.org/10.3390/molecules190810922