In Vitro Selection of DNA Aptamers that Binds Geniposide
Abstract
:1. Introduction
2. Results
2.1. SELEX Strategy
2.2. The SELEX Progress
2.3. Putative Aptamer Structures
2.4. Binding Affinity
2.5. Recognition Specificity
3. Discussion
4. Materials and Methods
4.1. DNA Oligonucleotides and Chemical Reagents
4.2. Stock Solutions for SELEX
4.3. In Vitro Selection Procedure
4.4. Binding Affinity Measurement
4.5. Recognization Specificity Measasurement
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Lu, W.I.; Lu, D.P. Impact of Chinese herbal medicine on American society and health care system: Perspective and concern. Evid. Based Complement. Altern. Med. 2014, 2014, 251891. [Google Scholar] [CrossRef] [PubMed]
- Boon, H.S.; Olatunde, F.; Zick, S.M. Trends in complementary/alternative medicine use by breast cancer survivors: Comparing survey data from 1998 and 2005. BMC Women’s Health 2007, 30, 4. [Google Scholar] [CrossRef] [PubMed]
- Ekor, M. The growing use of herbal medicines: Issues relating to adverse reactions and challenges in monitoring safety. Front. Pharmacol. 2014, 4, 177. [Google Scholar] [CrossRef] [PubMed]
- Frenzel, C.; Teschke, R. Herbal Hepatotoxicity: Clinical Characteristics and Listing Compilation. Int. J. Mol. Sci. 2016, 17, 588. [Google Scholar] [CrossRef] [PubMed]
- Newman, D.J.; Cragg, G.M. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Nat. Prod. 2012, 75, 311–335. [Google Scholar] [CrossRef] [PubMed]
- Sung, Y.; Lee, A.Y.; Kim, H.K. The Gardenia jasminoides extract and its constituent, geniposide, elicit anti-allergic effects on atopic dermatitis by inhibiting histamine in vitro and in vivo. J. Ethnopharmacol. 2014, 156, 33–40. [Google Scholar] [CrossRef] [PubMed]
- Kostova, M.B.; Konaklieva, M.I.; Alipieva, K.I.; Popov, S.S.; Handjieva, N.V. ESI-MS study of some C10 iridoid glycosides. Instrum. Sci. Technol. 2005, 33, 691–702. [Google Scholar] [CrossRef]
- Cho, Y.J.; Kim, S.Y.; Kim, J.; Choe, E.K.; Kim, S.I.; Shin, H.J. One-step enzymatic synthesis of blue pigments from geniposide for fabric dyeing. Biotechnol. Bioprocess Eng. 2006, 11, 230. [Google Scholar] [CrossRef]
- Sung, H.W.; Huang, R.N.; Huang, L.L.H.; Tsai, C.C.; Chiu, C.T. Feasibility study of a natural crosslinking reagent for biological tissue fixation. J. Biomed. Mater. Res. 1998, 42, 560–567. [Google Scholar] [CrossRef]
- Lee, I.A.; Lee, J.H.; Baek, N.I.; Kim, D.H. Antihyperlipidemic effect of crocin isolated from the fructus of Gardenia jasminoides and its metabolite Crocetin. Biol. Pharm. Bull. 2005, 28, 2106–2110. [Google Scholar] [CrossRef] [PubMed]
- Lee, S.J.; Oh, P.S.; Lim, K.T. Hepatoprotetive and hypolipidaemic effects of glycoprotein isolated from Gardenia jasminoides Ellis in mice. Clin. Exp. Pharmacol. Physiol. 2006, 33, 925–933. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Li, G.; Hölscher, C.; Li, L. Neuroprotective effects of geniposide on Alzheimer’s disease pathology. Rev. Neurosci. 2015, 26, 371–383. [Google Scholar] [CrossRef] [PubMed]
- Meng, S.; Peng, J.; Feng, Q.; Cao, J.; Hu, Y. The Role of Genipin and Geniposide in Liver Diseases: A Review. Altern. Integr. Med. 2013, 2, 117. [Google Scholar] [CrossRef]
- Chen, J.; Wu, H.; Li, H.; Hu, S.; Dai, M.; Chen, J. Anti-inflammatory effects and pharmacokinetics study of geniposide on rats with adjuvant arthritis. Int. Immunopharmacol. 2015, 24, 102–109. [Google Scholar] [CrossRef] [PubMed]
- Fu, Y.; Liu, B.; Liu, J.; Liu, Z.; Liang, D.; Li, F.; Li, D.; Cao, Y.; Zhang, X.; Zhang, N.; Yang, Z. Geniposide, from Gardenia jasminoides Ellis, inhibits the inflammatory response in the primary mouse macrophages and mouse models. Int. Immunopharmacol. 2012, 14, 792–798. [Google Scholar] [CrossRef] [PubMed]
- Ma, Z.G.; Dai, J.B.; Zhang, W.; Yuan, Y.; Liao, H.H.; Zhang, N.; Bian, Z.Y.; Tang, Q.Z. Protection against cardiac hypertrophy by geniposide involves the GLP-1 receptor/AMPKα signalling pathway. Br. J. Pharmacol. 2016, 173, 1502–1506. [Google Scholar] [CrossRef] [PubMed]
- Yin, F.; Liu, J.; Zheng, X.; Guo, L.; Xiao, H. Geniposide Induces the Expression of Heme Oxygenase-1 via PI3K/Nrf2-Signaling to Enhance the Antioxidant Capacity in Primary Hippocampal Neurons. Biol. Pharm. Bull. 2010, 33, 1841–1846. [Google Scholar] [CrossRef] [PubMed]
- Liu, H.; Chen, Y.F.; Li, F.; Zhang, H.Y. Fructus Gardenia (Gardenia jasminoides J. Ellis) phytochemistry, pharmacology of cardiovascular, and safety with the perspective of new drugs development. J. Asian Nat. Prod. Res. 2013, 15, 94–110. [Google Scholar] [CrossRef] [PubMed]
- Ding, Y.; Zhang, T.; Tao, J.S.; Zhang, L.Y.; Shi, J.R.; Ji, G. Potential hepatotoxicity of geniposide, the major iridoid glycoside in dried ripe fruits of Gardenia jasminoides (Zhi-zi). Nat. Prod. Res. 2013, 27, 929. [Google Scholar] [CrossRef] [PubMed]
- Yamano, T.; Tsujimoto, Y.; Noda, T.; Shimizu, M.; Ohmori, M.; Morita, S.; Yamada, A. Hepatotoxicity of geniposide in rats. Food Chem. Toxicol. 1990, 28, 515–519. [Google Scholar] [CrossRef]
- Wang, L.; Yuan, Q.; Marshall, G.; Cui, X.; Cheng, L.; Li, Y.; Shang, H.; Zhang, B.; Li, Y. Adverse drug reactions and adverse events of 33 varieties of traditional Chinese medicine injections on National Essential medicines List (2004 edition) of China: an overview on published literatures. J. Evid. Based Med. 2010, 3, 95–104. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wider, B.; Shang, H.; Ernst, E. Quality of herbal medicines: Challenges and solutions. Complement. Ther. Med. 2012, 20, 100–106. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.L. Conservation and sustainable use of medicinal plants: Problems, progress, and prospects. Chin. Med. 2016, 11, 37. [Google Scholar] [CrossRef] [PubMed]
- Cheng, K.F.; Leung, P.C. Safety in Chinese Medicine Research. Open J. Saf. Sci. Technol. 2012, 2, 32–39. [Google Scholar] [CrossRef]
- Tuerk, C.; Gold, L. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 1990, 249, 505–510. [Google Scholar] [CrossRef] [PubMed]
- Ellington, A.D.; Szostak, J.W. In vitro selection of RNA molecules that bind specific ligands. Nature 1990, 346, 818–822. [Google Scholar] [CrossRef] [PubMed]
- Wilson, D.S.; Szostak, J.W. In vitro selection of functional nucleic acids. Annu. Rev. Biochem. 1999, 68, 611–647. [Google Scholar] [CrossRef] [PubMed]
- Klussmann, S. The Aptamer Handbook: Functional Oligonucleotides and Their Applications; Wiley: Hoboken, NJ, USA, 2006; pp. 363–416. [Google Scholar]
- Li, Y.; Lu, Y. (Eds.) Functional Nucleic Acids for Analytical Applications; Springer: New York, NY, USA, 2009; Volume 398, pp. 15–16.
- Navani, N.K.; Li, Y. Nucleic acid aptamers and enzymes as sensors. Curr. Opin. Chem. Biol. 2006, 10, 272–281. [Google Scholar] [CrossRef] [PubMed]
- Liu, J.; Cao, Z.X.; Lu, Y. Functional nucleic acid sensors. Chem. Rev. 2009, 109, 1948–1998. [Google Scholar] [CrossRef] [PubMed]
- Biosensors Based on Aptamers and Enzymes; Gu, M.B.; Kim, H. (Eds.) Springer: Berlin, Germany, 2014.
- Nutiu, R.; Li, Y. In vitro selection of structure-switching signaling aptamers. Angew. Chem. Int. Ed. 2005, 44, 1061–1065. [Google Scholar] [CrossRef] [PubMed]
- Nutiu, R.; Li, Y. Aptamers with fluorescence-signaling properties. Methods 2005, 37, 16–25. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.A.; Barbu, M.; Halim, M.; Pallavi, P.; Kim, B.; Kolpashchikov, D.M.; Pecic, S.; Taylor, S.; Worgall, T.S.; Stojanovic, M.N. Recognition and sensing of low-epitope targets via ternary complexes with oligonucleotides and synthetic receptors. Nat. Chem. 2014, 6, 1003–1008. [Google Scholar] [CrossRef] [PubMed]
- Yang, K.A.; Pei, R.; Stojanovic, M.N. In vitro selection and amplification protocols for isolation of aptameric sensors for small molecules. Methods 2016, 15, 58–65. [Google Scholar] [CrossRef] [PubMed]
- Nutiu, R.; Li, Y. Structure-switching signaling aptamers. J. Am. Chem. Soc. 2003, 125, 4771–4778. [Google Scholar] [CrossRef] [PubMed]
- Nutiu, R.; Li, Y. Structure-switching signaling aptamers: Transducing molecular recognition into fluorescence signaling. Chemistry 2004, 10, 1868–1876. [Google Scholar] [CrossRef] [PubMed]
- Mao, Y.; Liu, M.; Tram, K.; Gu, J.; Salena, B.J.; Jiang, Y.; Li, Y. Optimal DNA templates for rolling circle amplification revealed by in vitro selection. Chemistry 2015, 21, 8069–8074. [Google Scholar] [CrossRef] [PubMed]
- Gysbers, R.; Tram, K.; Gu, J.; Li, Y. Evolution of an Enzyme from a Noncatalytic Nucleic Acid Sequence. Sci. Rep. 2015, 5, 11405. [Google Scholar] [CrossRef] [PubMed]
- Chan, L.; Tram, K.; Gysbers, R.; Gu, J.; Li, Y. Sequence Mutation and Structural Alteration Transform a Noncatalytic DNA Sequence into an Efficient RNA-Cleaving DNAzyme. J. Mol. Evol. 2015, 245–253. [Google Scholar] [CrossRef] [PubMed]
- The mfold Web Server. Available online: http://unafold.rna.albany.edu/?q=mfold/dna-folding-form (accessed on 24 February 2017).
- Hu, J.; Easley, C.J. A simple and rapid approach for measurement of dissociation constants of DNA aptamers against proteins and small molecules via automated microchip electrophoresis. Analyst 2011, 136, 3461–3468. [Google Scholar] [CrossRef] [PubMed]
- Stoltenburg, R.; Nikolaus, N.; Strehlitz, B. Capture-SELEX: Selection of DNA aptamers for aminoglycoside antibiotics. J. Anal. Methods Chem. 2012, 415697. [Google Scholar] [CrossRef] [PubMed]
- Mckeague, M.; Derosa, M.C. Challenges and Opportunities for Small Molecule Aptamer Development. J. Nuclic Acids 2012, 2012, 748913. [Google Scholar] [CrossRef] [PubMed]
- Chen, Y.; Yao, F.; Ming, K.; Wang, D.; Hu, Y.; Liu, J. Polysaccharides from Traditional Chinese Medicines: Extraction, Purification, Modification, and Biological Activity. Molecules 2016, 21, 1705. [Google Scholar] [CrossRef] [PubMed]
- Bergonzi, M.C.; Righeschi, C.; Isacchi, B.; Bilia, A.R. Identification and quantification of constituents of Gardenia jasminoides Ellis (Zhizi) by HPLC-DAD-ESI-MS. Food Chem. 2012, 134, 1199–1204. [Google Scholar] [CrossRef] [PubMed]
- Nagatoshi, M.; Terasaka, K.; Nagatsu, A.; Mizukami, H. Iridoid-specific glucosyltransferase from Gardenia jasminoides. J. Biol. Chem. 2011, 286, 32866–32874. [Google Scholar] [CrossRef] [PubMed]
- Ernst, E. Herbal medicines—They are popular, but are they also safe? Eur. J. Clin. Pharmacol. 2006, 62, 1–2. [Google Scholar] [CrossRef] [PubMed]
- Chen, S.; Pang, X.; Song, J.; Shi, L.; Yao, H.; Han, J.; Leon, C. A renaissance in herbal medicine identification: From morphology to DNA. Biotechnol. Adv. 2014, 32, 1237–1244. [Google Scholar] [CrossRef] [PubMed]
- Li, M.; Cao, H.; But, P.P.H.; Shaw, P.C. Identification of herbal medicinal materials using DNA barcodes. J. Syst. Evol. 2011, 49, 271–283. [Google Scholar] [CrossRef]
- Ohkubo, T.; Yamazaki, M.; Yoshida, A.; Kenzo, C.; Tetsuro, M. Detection of Genipin/Geniposide-Target Molecules by a Geniposide Overlay Method Using Anti-Geniposide Antibody. J. Health Sci. 2004, 50, 193–196. [Google Scholar] [CrossRef]
- Guijarro-Díez, M.; Castro-Puyana, M.; Crego, A.L.; Marina, M.L. Detection of saffron adulteration with gardenia extracts through the determination of geniposide by liquid chromatography–mass spectrometry. J. Food Compos. Anal. 2016, 55, 30–37. [Google Scholar] [CrossRef]
- Sample Availability: Samples of the compounds are not available from the authors.
Name | Sequence |
---|---|
DL1 | 5′-GGAGGCTCTCGGGACGAC-N40-GTCGTCCCGATGCTGCAATCGTAA-3′ |
BD1 | 5′-GTCGTCCCGAGAGCCATA-Biotin-3′ |
FP1 | 5′-GGAGGCTCTCGGGACGAC-3′ |
FP2 | 5′-Fluorescein-GGAGGCTCTCGGGACGAC-3′ |
RP1 | 5′-TTACGATTGCAGCATCGGGACG-3′ |
RP2 | 5′-T15-X18-TTACGATTGCAGCATCGGGACG-3′ 1 |
Name | Sequence 1 | Number of Copies |
---|---|---|
GP1 | GGGAGCATCATTCTGAGTGTTATGTGGATTGATACGTCTG | 934 |
GP2 | GGTGTGGCCCGTGGTGTCACTAATGAAGGGATTCATTTCA | 713 |
GP3 | GGCAGCCGATGTTCAATATATTAGTGACTCAGCGACTACT | 252 |
GP4 | GGCACATGACCGTTGATTTTCGCAGTTCCGTCATGCGATG | 233 |
GP5 | GGGGGCATCTAGCGCGCATTATAGCACACTGGTTGTTCAT | 220 |
GP6 | TCACGTACTGGATATACAGCCTGAGGATCCTGAGGTGGTA | 200 |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license ( http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, A.; Chang, D.; Zhang, Z.; Li, F.; Li, W.; Wang, X.; Li, Y.; Hua, Q. In Vitro Selection of DNA Aptamers that Binds Geniposide. Molecules 2017, 22, 383. https://doi.org/10.3390/molecules22030383
Zhang A, Chang D, Zhang Z, Li F, Li W, Wang X, Li Y, Hua Q. In Vitro Selection of DNA Aptamers that Binds Geniposide. Molecules. 2017; 22(3):383. https://doi.org/10.3390/molecules22030383
Chicago/Turabian StyleZhang, Aozhe, Dingran Chang, Zijian Zhang, Fan Li, Weihong Li, Xu Wang, Yingfu Li, and Qian Hua. 2017. "In Vitro Selection of DNA Aptamers that Binds Geniposide" Molecules 22, no. 3: 383. https://doi.org/10.3390/molecules22030383