Anti-Adipogenic Effects of Delphinidin-3-O-β-Glucoside in 3T3-L1 Preadipocytes and Primary White Adipocytes
Abstract
:1. Introduction
2. Results
2.1. Effects of D3G on Viability and Intracellular Lipid Accumulation
2.2. Effect of D3G on Adipogenesis
2.3. Effect of D3G on Fatty Acid Metabolism-Associated Genes
2.4. Effect of D3G on AMPK in 3T3-L1 Preadipocytes and PWATs
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture, Animal Preparation, and Differentiation
4.3. Cell Viability Assay
4.4. Quantification of Accumulated Lipids by Oil Red O Staining
4.5. RNA Extraction and cDNA Synthesis
4.6. Gene Expression Analysis Using a Quantitative Polymerase Chain Reaction (qPCR)
4.7. Protein Quantification and Immunoblot Analysis
4.8. AMPK Activation or Inhibition
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Smeriglio, A.; Barreca, D.; Bellocco, E.; Trombetta, D. Chemistry, Pharmacology and Health Benefits of Anthocyanins. Phytother. Res. 2016, 30, 1265–1286. [Google Scholar] [CrossRef] [PubMed]
- Azzini, E.; Giacometti, J.; Russo, G.L. Antiobesity effects of anthocyanins in preclinical and clinical studies. Oxid. Med. Cell. Longev. 2017, 2017, 1–11. [Google Scholar] [CrossRef]
- He, J.; Giusti, M.M. Anthocyanins: Natural colorants with health-promoting properties. Annu. Rev. Food Sci. Technol. 2010, 1, 163–187. [Google Scholar] [CrossRef] [PubMed]
- Yousuf, B.; Gul, K.; Wani, A.A.; Singh, P. Health benefits of anthocyanins and their encapsulation for potential use in food systems: A review. Crit. Rev. Food Sci. Nutr. 2016, 56, 2223–2230. [Google Scholar] [CrossRef] [PubMed]
- Ganesan, K.; Xu, B. A critical review on polyphenols and health benefits of black soybeans. Nutrients 2017, 9, 455. [Google Scholar]
- Lee, Y.-M.; Yoon, Y.; Yoon, H.; Park, H.-M.; Song, S.; Yeum, K.-J. Dietary anthocyanins against obesity and inflammation. Nutrients 2017, 9, 1089. [Google Scholar] [CrossRef]
- Kowalska, K.; Olejnik, A.; Rychlik, J.; Grajek, W. Cranberries (Oxycoccus quadripetalus) inhibit adipogenesis and lipogenesis in 3T3-L1 cells. Food Chem. 2014, 148, 246–252. [Google Scholar] [CrossRef]
- Kowalska, K.; Olejnik, A.; Szwajgier, D.; Olkowicz, M. Inhibitory activity of chokeberry, bilberry, raspberry and cranberry polyphenol-rich extract towards adipogenesis and oxidative stress in differentiated 3T3-L1 adipose cells. PLoS ONE 2017, 12, e0188583. [Google Scholar] [CrossRef]
- Han, M.H.; Kim, H.J.; Jeong, J.-W.; Park, C.; Kim, B.W.; Choi, Y.H. Inhibition of adipocyte differentiation by anthocyanins isolated from the fruit of Vitis coignetiae Pulliat is associated with the activation of AMPK signaling pathway. Toxicol. Res. 2018, 34, 13. [Google Scholar] [CrossRef] [PubMed]
- Tsuda, T. Recent progress in anti-obesity and anti-diabetes effect of berries. Antioxidants 2016, 5, 13. [Google Scholar] [CrossRef]
- Hsiao, Y.-H.; Hsieh, J.-F. The conversion and deglycosylation of isoflavones and anthocyanins in black soymilk process. Food Chem. 2018, 261, 8–14. [Google Scholar] [CrossRef]
- Jung, H.; Kwak, H.-K.; Hwang, K.T. Antioxidant and antiinflammatory activities of cyanidin-3-glucoside and cyanidin-3-rutinoside in hydrogen peroxide and lipopolysaccharide-treated RAW264. 7 cells. Food Sci. Biotechnol. 2014, 23, 2053–2062. [Google Scholar] [CrossRef]
- Cai, H.; Yang, B.; Xu, Z.; Zhang, B.; Xu, B.; Li, X.; Wu, P.; Chen, K.; Rajotte, R.V.; Wu, Y. Cyanidin-3-O-glucoside enhanced the function of syngeneic mouse islets transplanted under the kidney capsule or into the portal vein. Transplantation 2015, 99, 508–514. [Google Scholar] [CrossRef] [PubMed]
- Matsukawa, T.; Villareal, M.O.; Motojima, H.; Isoda, H. Increasing cAMP levels of preadipocytes by cyanidin-3-glucoside treatment induces the formation of beige phenotypes in 3T3-L1 adipocytes. J. Nutr. Biochem. 2017, 40, 77–85. [Google Scholar] [CrossRef] [Green Version]
- Ma, M.-M.; Li, Y.; Liu, X.-Y.; Zhu, W.-W.; Ren, X.; Kong, G.-Q.; Huang, X.; Wang, L.-P.; Luo, L.-Q.; Wang, X.-Z. Cyanidin-3-O-glucoside ameliorates lipopolysaccharide-induced injury both in vivo and in vitro suppression of NF-κB and MAPK pathways. Inflammation 2015, 38, 1669–1682. [Google Scholar] [CrossRef]
- Pompei, A.; Toniato, E.; Innocenti, P.; Cellini, C.; Mattoscio, D.; Cotellese, R.; Bosco, D.; Ciccarelli, R.; Dadorante, V.; Martinotti, S. Cyanidin reduces preadipocyte differentiation and relative ChREBP expression. J. Biol. Regul. Homeost. Agents 2012, 26, 253–264. [Google Scholar]
- Kim, H.-K.; Kim, J.N.; Han, S.N.; Nam, J.-H.; Na, H.-N.; Ha, T.J. Black soybean anthocyanins inhibit adipocyte differentiation in 3T3-L1 cells. Nutr. Res. 2012, 32, 770–777. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Q.; de Mejia, E.G.; Luna-Vital, D.; Tao, T.; Chandrasekaran, S.; Chatham, L.; Juvik, J.; Singh, V.; Kumar, D. Relationship of phenolic composition of selected purple maize (Zea mays L.) genotypes with their anti-inflammatory, anti-adipogenic and anti-diabetic potential. Food Chem. 2019, 289, 739–750. [Google Scholar] [CrossRef]
- Ma, A.; Wang, J.; Yang, L.; An, Y.; Zhu, H. AMPK activation enhances the anti-atherogenic effects of high density lipoproteins in apoE(−/−) mice. J. Lipid Res 2017, 58, 1536–1547. [Google Scholar] [CrossRef] [PubMed]
- Kang, H.M.; Park, B.S.; Kang, H.K.; Park, H.R.; Yu, S.B.; Kim, I.R. Delphinidin induces apoptosis and inhibits epithelial-to-mesenchymal transition via the ERK/p38 MAPK-signaling pathway in human osteosarcoma cell lines. Environ. Toxicol. 2018, 33, 640–649. [Google Scholar] [CrossRef] [PubMed]
- Jin, X.; Chen, M.; Yi, L.; Chang, H.; Zhang, T.; Wang, L.; Ma, W.; Peng, X.; Zhou, Y.; Mi, M. Delphinidin-3-glucoside protects human umbilical vein endothelial cells against oxidized low-density lipoprotein-induced injury by autophagy upregulation via the AMPK/SIRT1 signaling pathway. Mol. Nutr. Food Res. 2014, 58, 1941–1951. [Google Scholar] [CrossRef]
- Chen, J.; Zhu, Y.; Zhang, W.; Peng, X.; Zhou, J.; Li, F.; Han, B.; Liu, X.; Ou, Y.; Yu, X. Delphinidin induced protective autophagy via mTOR pathway suppression and AMPK pathway activation in HER-2 positive breast cancer cells. BMC Cancer 2018, 18, 342. [Google Scholar] [CrossRef] [PubMed]
- Murata, M.; Nonaka, H.; Komatsu, S.; Goto, M.; Morozumi, M.; Yamada, S.; Lin, I.C.; Yamashita, S.; Tachibana, H. Delphinidin prevents muscle atrophy and upregulates MIR-23a expression. J. Agric. Food Chem. 2016, 65, 45–50. [Google Scholar] [CrossRef] [PubMed]
- Moriwaki, S.; Suzuki, K.; Muramatsu, M.; Nomura, A.; Inoue, F.; Into, T.; Yoshiko, Y.; Niida, S. Delphinidin, one of the major anthocyanidins, prevents bone loss through the inhibition of excessive osteoclastogenesis in osteoporosis model mice. PLoS ONE 2014, 9, e97177. [Google Scholar] [CrossRef]
- Rahman, N.; Jeon, M.; Kim, Y.S. Delphinidin, a major anthocyanin, inhibits 3T3-L1 pre-adipocyte differentiation through activation of Wnt/β-catenin signaling. Biofactors 2016, 42, 49–59. [Google Scholar]
- Harada, G.; Onoue, S.; Inoue, C.; Hanada, S.; Katakura, Y. Delphinidin-3-glucoside suppresses lipid accumulation in HepG2 cells. Cytotechnology 2018, 70, 1707–1712. [Google Scholar] [CrossRef] [PubMed]
- Finelli, C.; Padula, M.C.; Martelli, G.; Tarantino, G. Could the improvement of obesity-related co-morbidities depend on modified gut hormones secretion? World J. Gastroenterol. 2014, 20, 16649–16664. [Google Scholar] [CrossRef]
- Bordoni, A.; Boesch, C.; Malpuech-Brugère, C.; Orfila, C.; Tomás-Cobos, L. The role of bioactives in energy metabolism and metabolic syndrome. Proc. Nutr. Soc. 2019, 1–11. [Google Scholar] [CrossRef] [PubMed]
- Angin, Y.; Beauloye, C.; Horman, S.; Bertrand, L. Regulation of carbohydrate metabolism, lipid metabolism, and protein metabolism by AMPK. In AMP-Activated Protein Kinase; Cordero, M.D., Viollet, B., Eds.; Springer International Publishing: Cham, Switzerland, 2016; pp. 23–43. [Google Scholar]
- Kim, K.H. Regulation of mammalian acetyl-coenzyme A carboxylase. Annu. Rev. Nutr. 1997, 17, 77–99. [Google Scholar] [CrossRef]
- Tsuda, T.; Horio, F.; Uchida, K.; Aoki, H.; Osawa, T. Dietary cyanidin 3-O-β-d-glucoside-rich purple corn color prevents obesity and ameliorates hyperglycemia in mice. J. Nutr. 2003, 133, 2125–2130. [Google Scholar] [CrossRef]
- Fu, C.; Jiang, Y.; Guo, J.; Su, Z. Natural products with anti-obesity effects and different mechanisms of action. J. Agric. Food Chem. 2016, 64, 9571–9585. [Google Scholar] [CrossRef]
- Thompson, K.; Pederick, W.; Santhakumar, A.B. Anthocyanins in obesity-associated thrombogenesis: A review of the potential mechanism of action. Food Funct. 2016, 7, 2169–2178. [Google Scholar] [CrossRef]
- Kowalska, K.; Olejnik, A.; Rychlik, J.; Grajek, W. Cranberries (Oxycoccus quadripetalus) inhibit lipid metabolism and modulate leptin and adiponectin secretion in 3T3-L1 adipocytes. Food Chem. 2015, 185, 383–388. [Google Scholar] [CrossRef]
- Khalilpourfarshbafi, M.; Gholami, K.; Murugan, D.D.; Sattar, M.Z.A.; Abdullah, N.A. Differential effects of dietary flavonoids on adipogenesis. Eur. J. Nutr. 2019, 58, 5–25. [Google Scholar] [CrossRef]
- Lefterova, M.I.; Lazar, M.A. New developments in adipogenesis. Trends Endocrinol. Metabol. 2009, 20, 107–114. [Google Scholar] [CrossRef]
- Rangwala, S.M.; Lazar, M.A. Transcriptional control of adipogenesis. Annu. Rev. Nutr. 2000, 20, 535–559. [Google Scholar] [CrossRef]
- Schmid, B.; Rippmann, J.F.; Tadayyon, M.; Hamilton, B.S. Inhibition of fatty acid synthase prevents preadipocyte differentiation. Biochem. Biophys. Res. Commun. 2005, 328, 1073–1082. [Google Scholar] [CrossRef]
- Zhou, J.; Poudel, A.; Chandramani-Shivalingappa, P.; Xu, B.; Welchko, R.; Li, L. Liraglutide induces beige fat development and promotes mitochondrial function in diet induced obesity mice partially through AMPK-SIRT-1-PGC1-α cell signaling pathway. Endocrine 2018. [Google Scholar] [CrossRef]
- Picard, F.; Kurtev, M.; Chung, N.; Topark-Ngarm, A.; Senawong, T.; Machado De Oliveira, R.; Leid, M.; McBurney, M.W.; Guarente, L. Sirt1 promotes fat mobilization in white adipocytes by repressing PPAR-gamma. Nature 2004, 429, 771–776. [Google Scholar] [CrossRef]
- Townsend, K.L.; An, D.; Lynes, M.D.; Huang, T.L.; Zhang, H.; Goodyear, L.J.; Tseng, Y.-H. Increased mitochondrial activity in BMP7-treated brown adipocytes, due to increased CPT1-and CD36-mediated fatty acid uptake. Antioxid. Redox Signal. 2013, 19, 243–257. [Google Scholar] [CrossRef]
- Kang, S.-W.; Kang, S.-I.; Shin, H.-S.; Yoon, S.-A.; Kim, J.-H.; Ko, H.-C.; Kim, S.-J. Sasa quelpaertensis Nakai extract and its constituent p-coumaric acid inhibit adipogenesis in 3T3-L1 cells through activation of the AMPK pathway. Food Chem. Toxicol. 2013, 59, 380–385. [Google Scholar] [CrossRef] [PubMed]
- Lee, M.; Sorn, S.R.; Park, Y.; Park, H.K. Anthocyanin rich-black soybean testa improved visceral fat and plasma lipid profiles in overweight/obese Korean adults: A randomized controlled trial. J. Med. Food. 2016, 19, 995–1003. [Google Scholar] [CrossRef] [PubMed]
- Aune, U.L.; Ruiz, L.; Kajimura, S. Isolation and differentiation of stromal vascular cells to beige/brite cells. J. Vis. Exp. 2013, e50191. [Google Scholar] [CrossRef]
Sample Availability: Not available. |
Gene | Forward (5′- 3′) | Reverse (5′- 3′) |
---|---|---|
C/EBPα | TTACAACAGGCCAGGTTTCC | GGCTGGCGACATACAGTACA |
PPARγ | TTTTCAAGGGTGCCAGTTTC | AATCCTTGGCCCTCTGAGAT |
SREBP1 | TGTTGGCATCCTGCTATCTG | AGGGAAAGCTTTGGGGTCTA |
β-actin | CTGTCCCTGTATGCCTCTG | ATGTCACGCACGATTTCC |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, M.; Sharma, A.; Lee, H.-J. Anti-Adipogenic Effects of Delphinidin-3-O-β-Glucoside in 3T3-L1 Preadipocytes and Primary White Adipocytes. Molecules 2019, 24, 1848. https://doi.org/10.3390/molecules24101848
Park M, Sharma A, Lee H-J. Anti-Adipogenic Effects of Delphinidin-3-O-β-Glucoside in 3T3-L1 Preadipocytes and Primary White Adipocytes. Molecules. 2019; 24(10):1848. https://doi.org/10.3390/molecules24101848
Chicago/Turabian StylePark, Miey, Anshul Sharma, and Hae-Jeung Lee. 2019. "Anti-Adipogenic Effects of Delphinidin-3-O-β-Glucoside in 3T3-L1 Preadipocytes and Primary White Adipocytes" Molecules 24, no. 10: 1848. https://doi.org/10.3390/molecules24101848