Overexpression of Pear (Pyrus pyrifolia) CAD2 in Tomato Affects Lignin Content
Abstract
:1. Introduction
2. Results and Discussion
2.1. Generation of Transgenic Tomato Plants
2.2. The Morphology Indexes of Transgenic Plants Overexpressing PpCAD2
2.3. Overexprssion of PpCAD2 in Tomato Increased the Lignin Content and CAD Enzymatic Activity in Stem
2.4. Overexpression of PpCAD2 in Tomato Increased the Lignin Content in Fruit Pericarp and Leaf
3. Materials and Methods
3.1. Plant Material
3.2. Vector Construction and Tomato Transformation
3.3. PCR Analysis and Gene Expression Analysis
3.4. Lignin Content Determination
3.5. Determination of Biomass Parameters
3.6. CAD Enzyme Activity
3.7. Weisner Staining and Microscopy
4. Conclusions
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Boudet, A.M.; Kajita, S.; Grima-Pettenati, J.; Goffner, D. Lignins and lignocellulosics: A better control of synthesis for new and improved uses. Trends Plant Sci. 2003, 8, 576–581. [Google Scholar] [CrossRef]
- Boerjan, W.; Ralph, J.; Baucher, M. Lignin biosynthesis. Annu. Rev. Plant Biol. 2003, 54, 519–546. [Google Scholar] [CrossRef]
- Peter, G.; Neale, D. Molecular basis for the evolution of xylem lignification. Curr. Opin. Plant Biol. 2004, 7, 737–742. [Google Scholar] [CrossRef]
- Dauwe, R.; Morreel, K.; Goeminne, G.; Gielen, B.; Rohde, A.; Van Beeumen, J.; Ralph, J.; Boudet, A.M.; Kopka, J.; Rochange, S.F.; et al. Molecular phenotyping of lignin-modified tobacco reveals associated changes in cell-wall metabolism, primary metabolism, stress metabolism and photorespiration. Plant J. 2007, 52, 263–285. [Google Scholar] [CrossRef]
- Wang, Y.; Zhang, X.; Yang, S.; Yuan, Y. Lignin involvement in programmed changes in peach-fruit texture indicated by metabolite and transcriptome analyses. J. Agric. Food Chem. 2018, 66, 12627–12640. [Google Scholar] [CrossRef]
- Ge, H.; Zhang, J.; Zhang, Y.J.; Li, X.; Yin, X.R.; Grierson, D.; Chen, K.S. EjNAC3 transcriptionally regulates chilling-induced lignification of loquat fruit via physical interaction with an atypical CAD-like gene. J. Exp. Bot. 2017, 68, 5129–5136. [Google Scholar] [CrossRef]
- Lu, G.L.; Li, Z.J.; Zhang, X.F.; Wang, R.; Yang, S.L. Expression analysis of lignin associated genes in hard end pear (Pyrus pyrifolia Whangkeumbae) and its response to calcium chloride treatment conditions. Plant Growth Regul. 2015, 34, 251–262. [Google Scholar] [CrossRef]
- Uraki, Y.; Koda, K. Encyclopedia of Polymeric Nanomaterials; Springer: Berlin/Heidelberg, Germany, 2015; pp. 1073–1080. [Google Scholar]
- Liu, Q.; Luo, L.; Zheng, L. Lignins: Biosynthesis and biological functions in plants. Int. J. Mol. Sci. 2018, 19, 335. [Google Scholar] [CrossRef]
- Vanholme, R.; Demedts, B.; Morreel, K.; Ralph, J.; Boerjan, W. Lignin biosynthesis and structure. Plant Physiol. 2019, 153, 895–905. [Google Scholar] [CrossRef]
- Alejandro, S.; Lee, Y.; Tohge, T.; Sudre, D.; Osorio, S.; Park, J.; Bovet, L.; Lee, Y.; Geldner, N.; Fernie, A.R.; et al. AtABCG29 is a monolignol transporter involved in lignin biosynthesis. Curr. Biol. 2012, 22, 1207–1212. [Google Scholar] [CrossRef]
- Liu, C.J.; Miao, Y.C.; Zhang, K.W. Sequestration and transport of lignin monomeric precursors. Molecules 2011, 16, 710–727. [Google Scholar] [CrossRef]
- Li, L.; Popko, J.L.; Umezawa, T. 5-Hydroxyconifery aldehyde modulates enzymatic methylation for syringyl monolingnol formation a new view of monolingnol biosythensis in angiosperms. J. Biol. Chem. 2000, 275, 6539–6545. [Google Scholar] [CrossRef]
- Campbell, M.M.; Sederoff, R.R. Variation in lignin content and composition (mechanisms of control and implications for the genetic improvement of plants). Plant Physiol. 1996, 110, 3–13. [Google Scholar] [CrossRef]
- Yang, S.L.; Zhang, X.N.; Lu, G.L.; Wang, C.R.; Wang, R. Regulation of gibberellin on gene expressions related with the lignin biosynthesis in ‘Wangkumbae’ pear (Pyrus pyrifolia Nakai) fruit. Plant Growth Regul. 2015, 76, 127–134. [Google Scholar] [CrossRef]
- Eudes, A.; Sathitsuksanoh, N.; Baidoo, E.E.; George, A.; Liang, Y.; Yang, F.; Singh, S.; Keasling, J.D.; Simmons, B.A.; Loque, D. Expression of a bacterial 3-dehydroshikimate dehydratase reduces lignin content and improves biomass saccharification efficiency. Plant Biotechnol. J. 2015, 13, 1241–1250. [Google Scholar] [CrossRef]
- Halpin, C.; Knight, M.E.; Foxon, G.A.; Campbell, M.M.; Boudet, A.M.; Boon, J.J.; Chabbert, B.; Tollier, M.T.; Schuch, W. Manipulation of lignin quality by downregulation of cinnamyl alcohol dehydrogenase. Plant J. 1994, 6, 339–350. [Google Scholar] [CrossRef]
- Hibino, T.; Takabe, K.; Kawazu, T.; Shibata, D.; Higuchi, T. Increase of cinnamaldehyde groups in lignin of transgenic tobacco plants carrying an antisense gene for cinnamyl alcohol dehydrogenase. Biosci. Biotechnol. Biochem. 1995, 59, 929–931. [Google Scholar] [CrossRef]
- Stewart, D.; Yahiaoui, N.; McDougall, G.J.; Myton, K.; Marque, C.; Boudet, A.M.; Haigh, J. Fourier-transform infrared and Raman spectroscopic evidence for the incorporation of cinnamaldehydes into the lignin of transgenic tobacco (Nicotiana tabacum L.) plants with reduced expression of cinnamyl alcohol dehydrogenase. Planta 1997, 201, 311–318. [Google Scholar] [CrossRef]
- Damiani, I.; Morreel, K.; Danoun, S.; Goeminne, G.; Yahiaoui, N.; Marque, C.; Kopka, J.; Messens, E.; Goffner, D.; Boerjan, W.; et al. Metabolite profling reveals a role for atypical cinnamyl alcohol dehydrogenase CAD1 in the synthesis of coniferyl alcohol in tobacco xylem. Plant Mol. Biol. 2005, 59, 753–769. [Google Scholar] [CrossRef]
- Baucher, M.; Chabbert, B.; Pilate, G.; Van, D.J.; Tollier, M.T.; Petit-Conil, M.; Cornu, D.; Monties, B.; Van, M.M.; Inzé, D.; et al. Red xylem and higher lignin extractability by down-regulating a cinnamyl alcohol dehydrogenase in poplar (Populus tremula x P. alba). Plant Physiol. 1996, 112, 1479–1490. [Google Scholar] [CrossRef]
- Eudes, A.; Pollet, B.; Sibout, R.; Do, C.T.; Séguin, A.; Lapierre, C.; Jouanin, L. Evidence for a role of AtCAD 1 in lignification of elongating stems of Arabidopsis thaliana. Planta 2006, 225, 23–39. [Google Scholar] [CrossRef]
- Halpin, C.; Holt, K.; Chojecki, J.; Oliver, D.; Chabbert, B.; Monties, B.; Edwards, K.; Barakate, A.; Foxon, G.A. Brown-midrib maize (bm1)—A mutation affecting the cinnamyl alcohol dehydrogenase gene. Plant J. 1998, 14, 545–553. [Google Scholar] [CrossRef]
- Baucher, M.; Bernard-Vailhé, M.A.; Chabbert, B.; Besle, J.M.; Opsomer, C.; Van, M.M.; Botterman, J. Down-regulation of cinnamyl alcohol dehydrogenase in transgenic alfalfa (Medicago sativa L.) and the impact on lignin composition and digestibility. Plant Mol. Biol. 1999, 39, 437–447. [Google Scholar] [CrossRef]
- Wang, Y.L.; Zhang, X.F.; Yang, S.L. Heterogenous expression of Pyrus pyrifolia PpCAD2 and PpEXP2 in tobacco impacts lignin accumulation in transgenic plants. Gene 2017, 637, 181–189. [Google Scholar] [CrossRef]
- Borejsza-Wysocka, E.; Norelli, J.L.; Aldwinckle, H.S.; Malnoy, M. Stable expression and phenotypic impact of attacin E transgene in orchard grown apple trees over a 12 year period. BMC Biotechnol. 2010, 10, 41. [Google Scholar] [CrossRef]
- Meissner, R.; Jacobson, Y.; Melamed, S.; Levyatuv, S.; Ashri, A.; Elkind, Y.; Levy, A.; Shalev, G. A new model system for tomato genetics. Plant J. 1997, 12, 1465–1472. [Google Scholar] [CrossRef]
- Meissner, R.; Chagué, V.; Zhu, Q.; Emmanuel, E.; Elkind, Y.; Levy, A.A. A high throughput system for transposon tagging and promoter trapping in tomato. Plant J. 2000, 22, 265–274. [Google Scholar] [CrossRef]
- Mathews, H.; Clendennen, S.K.; Caldwell, C.G.; Liu, X.L.; Connors, K.; Matheis, N.; Schuster, D.K.; Menasco, D.J.; Wagoner, W.; Lightner, J.; et al. Activation tagging in tomato identifies a transcriptional regulator of anthocyanin biosynthesis, modification, and transport. Plant Cell 2003, 15, 1689–1703. [Google Scholar] [CrossRef]
- Shibata, D. Genome sequencing and functional genomics approaches in tomato. J. Gen. Plant Pathol. 2005, 71, 1–7. [Google Scholar] [CrossRef]
- Aoki, K.; Yano, K.; Suzuki, A.; Kawamura, S.; Sakurai, N.; Suda, K.; Kurabayashi, A.; Suzuki, T.; Tsugane, T.; Watanabe, M.; et al. Large-scale analysis of full-length cDNAs from the tomato (Solanum lycopersicum) cultivar Micro-Tom, a reference system for the Solanaceae genomics. BMC Genom. 2010, 11, 210. [Google Scholar] [CrossRef]
- Giménez, E.; Pineda, B.; Capel, J.; Antón, M.T.; Atarés, A.; Pérez-Martín, F.; Garcia-Sogo, B.; Angosto, T.; Moreno, V.; Lozano, R. Functional analysis of the Arlequin mutant corroborates the essential role of the ARLEQUIN/TAGL1 gene during reproductive development of tomato. PLoS ONE 2010, 5, e14427. [Google Scholar] [CrossRef]
- Edmondson, R.N.; Andrews, J.; Adams, S.R.; Burton, K.S. Partial purification of tomato fruit peroxidase and its effect on the mechanical properties of tomato fruit skin. J. Exp. Bot. 2002, 53, 2393–2399. [Google Scholar]
- Quiroga, M. A tomato peroxidase involved in the synthesis of lignin and suberin. Plant Physiol. 2000, 122, 1119–1128. [Google Scholar] [CrossRef]
- Garceau, D.C.; Batson, M.K.; Pan, I.L. Variations on a theme in fruit development: The PLE lineage of MADS-box genes in tomato (TAGL1) and other species. Planta 2017, 246, 313–321. [Google Scholar] [CrossRef]
- Thevenina, J.; Polleta, B.; Letarneca, B.; Saulnierb, L.; Gissotc, L. The simultaneous repression of CCR and CAD, two enzymes of the lignin biosynthetic pathway, results in sterility and dwarfism in Arabidopsis Thaliana. Mol. Plant 2011, 4, 70–82. [Google Scholar] [CrossRef]
- Zhao, Q.; Tobimatsu, Y.; Zhou, R.; Pattathil, S.; Gallego-Giraldo, L.; Fu, C.; Jackson, L.A.; Hahn, M.G.; Kim, H.; Chen, F.; et al. Loss of function of cinnamyl alcohol dehydrogenase 1 leads to unconventional lignin and a temperature-sensitive growth defect in Medicago truncatula. Proc. Natl. Acad. Sci. USA 2013, 110, 13660–13665. [Google Scholar] [CrossRef]
- Li, X.J.; Yang, Y.; Yao, J.L.; Chen, G.X.; Li, X.H.; Zhang, Q.F.; Wu, C.Y. FLEXIBLE CULM 1 encoding a cinnamyl-alcohol dehydrogenase controls culm mechanical strength in rice. Plant Mol. Biol. 2009, 69, 685–697. [Google Scholar] [CrossRef]
- Bouvier d’Yvoire, M.; Bouchabke-Coussa, O.; Voorend, W.; Antelme, S.; Cézard, L.; Legée, F.; Lebris, P.; Legay, S.; Whitehead, C.; McQueen-Mason, S.J.; et al. Disrupting the cinnamyl alcohol dehydrogenase 1 gene (BdCAD1) leads to altered lignification and improved saccharification in Brachypodium distachyon. Plant J. 2012, 73, 496–508. [Google Scholar] [CrossRef]
- Zhang, L.; Wang, G.; Chang, J.; Liu, J.; Cai, J.; Rao, X.; Zhang, L.; Zhong, J.; Xie, J.; Zhu, S. Effects of 1-MCP and ethylene on expression of three CAD genes and lignification in stems of harvested Tsai Tai (Brassica chinensis). Food Chem. 2010, 123, 32–40. [Google Scholar] [CrossRef]
- Ma, D.; Xu, C.; Alejos-Gonzalez, F.; Wang, H.; Yang, J.; Judd, R.; Xie, D.Y. Overexpression of Artemisia annua cinnamyl alcohol dehydrogenase increases lignin and coumarin and reduces artemisinin and other sesquiterpenes. Front. Plant Sci. 2018, 9, 828. [Google Scholar] [CrossRef]
- Guo, M.; Zhang, Y.; Meng, Z.; Jiang, J. Optimization of factors affecting Agrobacterium-mediated transformation of Micro-Tom tomatoes. Genet. Mol. Res. 2012, 11, 661–671. [Google Scholar] [CrossRef]
- Murashige, T.; Skoog, F. A revised medium for rapid growth and bioassays with tobacco tissue cultures. Physiol. Plant. 1962, 15, 473–497. [Google Scholar] [CrossRef]
- Weigel, D.; Glazebrook, J. Transformation of Agrobacterium using the freeze-thaw method. Cold Spring Harb. Protoc. 2006, 2006, 1031–1036. [Google Scholar] [CrossRef]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT Method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef]
- Dyckmans, J.; Flessa, H.; Brinkmann, K.; Mai, C.; Polle, A. Carbon and nitrogen dynamics in acid detergent fibre lignins of beech (Fagus sylvatica L.) during the growth phase. Plant Cell Environ. 2002, 25, 469–478. [Google Scholar] [CrossRef]
- Cai, C.; Xu, C.; Li, X.; Ferguson, I.; Chen, K. Accumulation of lignin in relation to change in activities of lignification enzymes in loquat fruit flesh after harvest. Postharvest Biol. Technol. 2006, 40, 163–169. [Google Scholar] [CrossRef]
- González-Reyes, J.A.; Villalba, J.M.; Moyano, E.; Caballero, J.L.; Muñoz-Blanco, J. Cloning, expression and immunolocalization pattern of a cinnamyl alcohol dehydrogenase gene from strawberry (Fragaria x ananassa cv. Chandler). J. Exp. Bot. 2002, 53, 1723–1734. [Google Scholar]
Sample Availability: Not available. |
Gene Name | Gene ID | Primer Name | Primer Sequence (5’ to 3’) |
---|---|---|---|
PpCAD2 | KJ577637 | PpCAD2-F | TTTGGTTGAGAGAGTTGCCCAC |
PpCAD2-R | ATTCGACACCCAAGCTCTTCG | ||
SlActin | LOC101264618 | SlActin-F | CAGATGTGGATAACGAAGGCC |
SlActin-R | TCACAGTAGAAAGACCTGAACAA |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, M.; Cheng, C.; Zhang, X.; Zhou, S.; Li, L.; Yang, S. Overexpression of Pear (Pyrus pyrifolia) CAD2 in Tomato Affects Lignin Content. Molecules 2019, 24, 2595. https://doi.org/10.3390/molecules24142595
Li M, Cheng C, Zhang X, Zhou S, Li L, Yang S. Overexpression of Pear (Pyrus pyrifolia) CAD2 in Tomato Affects Lignin Content. Molecules. 2019; 24(14):2595. https://doi.org/10.3390/molecules24142595
Chicago/Turabian StyleLi, Mingtong, Chenxia Cheng, Xinfu Zhang, Suping Zhou, Lixia Li, and Shaolan Yang. 2019. "Overexpression of Pear (Pyrus pyrifolia) CAD2 in Tomato Affects Lignin Content" Molecules 24, no. 14: 2595. https://doi.org/10.3390/molecules24142595