A Highly Efficient Indirect P. pastoris Surface Display Method Based on the CL7/Im7 Ultra-High-Affinity System
Abstract
:1. Introduction
2. Results and Discussion
2.1. General Strategy
2.2. Plasmid Construction
2.3. Expression of CL7 Fusion Proteins
2.4. Flow Cytometry Analysis
2.5. Fluorescence Microscopy
2.6. Western Blotting and Blue Light Transmitter Analysis
2.7. Fluorometric Assay
2.8. Enzyme Activity Assays for the Free and Surface Displayed CL7-huArg I
3. Materials and Methods
3.1. Plasmids and Strains
3.2. Construction of CL7-sfGFP, CL7-mCherry and CL7-huArg I Expression Plasmids
3.3. Construction of the P. pastoris Surface Display Plasmids
3.4. Expression and Purification of CL7-mCherry, CL7-sfGFP and CL7-huArg I
3.5. Yeast Transformation, Cultivation and Induction
3.6. Flow Cytometry
3.7. Fluorescence Microscopy
3.8. Blue Light Transmitter Analysis
3.9. Western Blotting Analysis
3.10. Fluorometric Assay
3.11. Human Arginase I Activity Assay
4. Conclusions and Perspective
Author Contributions
Funding
Conflicts of Interest
References
- Sheehan, J.; Marasco, W.A. Phage and Yeast Display. Microbiol. Spectr. 2015, 3. [Google Scholar] [CrossRef]
- Wang, H.; Wang, Y.; Yang, R. Recent progress in Bacillus subtilis spore-surface display: Concept, progress, and future. Appl. Microbiol. Biotechnol. 2017, 101, 933–949. [Google Scholar] [CrossRef] [PubMed]
- Van Bloois, E.; Winter, R.T.; Kolmar, H.; Fraaije, M.W. Decorating microbes: Surface display of proteins on Escherichia coli. Trends Biotechnol. 2011, 29, 79–86. [Google Scholar] [CrossRef] [PubMed]
- King, D.J.; Bowers, P.M.; Kehry, M.R.; Horlick, R.A. Mammalian cell display and somatic hypermutation in vitro for human antibody discovery. Curr. Drug Dis. Technol. 2014, 11, 56–64. [Google Scholar] [CrossRef]
- Pepper, L.R.; Cho, Y.K.; Boder, E.T.; Shusta, E.V. A decade of yeast surface display technology: Where are we now? Comb. Chem. High Throughput Screen. 2008, 11, 127–134. [Google Scholar] [PubMed]
- Andreu, C.; Del Olmo, M.L. Yeast arming systems: Pros and cons of different protein anchors and other elements required for display. Appl. Microbiol. Biotechnol. 2018, 102, 2543–2561. [Google Scholar] [CrossRef] [PubMed]
- Lei, H.; Jin, S.; Karlsson, E.; Schultz-Cherry, S.; Ye, K. Yeast Surface-Displayed H5N1 Avian Influenza Vaccines. J. Immunol. Res. 2016, 2016, 4131324. [Google Scholar] [CrossRef] [PubMed]
- Schroter, C.; Krah, S.; Beck, J.; Konning, D.; Grzeschik, J.; Valldorf, B.; Zielonka, S.; Kolmar, H. Isolation of pH-Sensitive Antibody Fragments by Fluorescence-Activated Cell Sorting and Yeast Surface Display. Methods Mol. Biol. 2018, 1685, 311–331. [Google Scholar] [PubMed]
- Han, L.; Zhao, Y.; Cui, S.; Liang, B. Redesigning of Microbial Cell Surface and Its Application to Whole-Cell Biocatalysis and Biosensors. Appl. Biochem. Biotechnol. 2018, 185, 396–418. [Google Scholar] [CrossRef] [PubMed]
- Tanaka, T.; Masunari, S.; Ishii, J.; Wakamura, K.; Segawa, M.; Fukuda, H.; Kondo, A. Displaying non-natural, functional molecules on yeast surfaces via biotin-streptavidin interaction. J. Biotechnol. 2010, 145, 79–83. [Google Scholar] [CrossRef] [PubMed]
- Vassylyeva, M.N.; Klyuyev, S.; Vassylyev, A.D.; Wesson, H.; Zhang, Z.; Renfrow, M.B.; Wang, H.; Higgins, N.P.; Chow, L.T.; Vassylyev, D.G. Efficient, ultra-high-affinity chromatography in a one-step purification of complex proteins. Proc. Natl. Acad. Sci. USA 2017, 114, E5138–E5147. [Google Scholar] [CrossRef] [PubMed]
- Su, G.D.; Zhang, X.; Lin, Y. Surface display of active lipase in Pichia pastoris using Sed1 as an anchor protein. Biotechnol. Lett. 2010, 32, 1131–1136. [Google Scholar] [CrossRef] [PubMed]
- Zhang, Z.; Tang, R.; Zhu, D.; Wang, W.; Yi, L.; Ma, L. Non-peptide guided auto-secretion of recombinant proteins by super-folder green fluorescent protein in Escherichia coli. Sci. Rep. 2017, 7, 6990. [Google Scholar] [CrossRef] [PubMed]
- Liang, X.X.; Wang, B.B.; Sun, Y.F.; Lin, Y.; Han, S.Y.; Zheng, S.P.; Cui, T.B. Quantitative evaluation of Candia antarctica lipase B displayed on the cell surface of a Pichia pastoris based on an FS anchor system. Biotechnol. Lett. 2013, 35, 367–374. [Google Scholar] [CrossRef] [PubMed]
- Paus, E.J.; Willey, J.; Ridge, R.J.; Legg, C.R.; Finkelman, M.A.; Novitsky, T.J.; Ketchum, P.A. Production of recombinant endotoxin neutralizing protein in Pichia pastoris and methods for its purification. Protein Exp. Purif. 2002, 26, 202–210. [Google Scholar] [CrossRef]
- Chinard, F.P. Photometric estimation of proline and ornithine. J. Biol. Chem. 1952, 199, 91–95. [Google Scholar] [PubMed]
- Zhang, X.; Liu, J.; Yu, X.; Wang, F.; Yi, L.; Li, Z.; Liu, Y.; Ma, L. High-level expression of human arginase I in Pichia pastoris and its immobilization on chitosan to produce L-ornithine. BMC Biotechnol. 2015, 15, 66. [Google Scholar] [CrossRef] [PubMed]
- Shibasaki, S.; Ueda, M.; Iizuka, T.; Hirayama, M.; Ikeda, Y.; Kamasawa, N.; Osumi, M.; Tanaka, A. Quantitative evaluation of the enhanced green fluorescent protein displayed on the cell surface of Saccharomyces cerevisiae by fluorometric and confocal laser scanning microscopic analyses. Appl. Microbiol. Biotechnol. 2001, 55, 471–475. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compounds are available upon requested from the corresponding authors. |
Protein | Supernatant | 50 mM | 100 mM | 150 mM | 200 mM |
---|---|---|---|---|---|
CL7-sfGFP | 100% | 11.4% | 20.9% | 12.0% | 6.3% |
CL7-mCherry | 100% | 4.1% | 12.9% | 7.6% | 5.3% |
CL7-huArg I | 100% | * | 10.8% | 19.7% | 8.4% |
Cells | GS115/pPICZα-HA-SED1 | GS115/pPICZα-HA-Im7-SED1 | ||
---|---|---|---|---|
Protein Quantity (μg) | 0 | 120 | 60 | 100 |
Fluorescence Intensity/OD600 | 0.012 (± 0.0039) | 0.017 (± 0.0054) | 0.91 (± 0.063) | 0.88 (± 0.075) |
Primer | Sequence (5′→3′) |
---|---|
CL7F | gaaggagatatacatatgagcaaaagcaatgaaccgggtaaag |
CL7R | tccaccacctgaaccacctcctccgccttcaatatcaatgttgcgtttcg |
GS3CF | ggaggaggtggttcaggtggtggaggcagtttggaggttttgttccagggtccagctag |
sfGFPF | gaggttttgttccagggtccagctagcgtgagcaagggcgaggagctgttc |
sfGFPR | ggtggtggtggtggtgctcgagttccttgtacagctcgtccatgcc |
mCherryF | gaggttttgttccagggtccagctagcatggttagcaaaggggaggaggataac |
mCherryR | ggtggtggtggtggtgctcgagttccttgtacagctcgtccataccgc |
huArgIF | gaggttttgttccagggtccagctagcagtgctaagtccagaacgattggtattattg3′ |
huArgIR | ggtggtggtggtggtgctcgagctttggtgggttcaaatagtcaattggt |
Primer | Sequence (5′→3′) |
---|---|
SED1F | aggcggtagcggaggcggagggtcgcaattttccaacagtacatctgcttcttcc |
SED1R | gaaagctggcggccgccgcggtcattataagaataacatagcaacaccagccaaac |
ZαHAF | aaagagaggctgaagctgaattctacccatacgacgttccagactacgctggaggctct |
HA-MCSF | cgttccagactacgctggaggctctgctagccatatggttaacgggcc |
MCS-GSF | tgctagccatatggttaacgggcccggaggcggtagcggaggcggagggtc |
Im7F | ctacgctggaggctctgctagcatggaattgaagaactccatctccgact |
Im7R | ctccgctaccgcctccgggcccaccttgtttaaaacctggcttaccgttg |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Li, S.; Qiao, J.; Lin, S.; Liu, Y.; Ma, L. A Highly Efficient Indirect P. pastoris Surface Display Method Based on the CL7/Im7 Ultra-High-Affinity System. Molecules 2019, 24, 1483. https://doi.org/10.3390/molecules24081483
Li S, Qiao J, Lin S, Liu Y, Ma L. A Highly Efficient Indirect P. pastoris Surface Display Method Based on the CL7/Im7 Ultra-High-Affinity System. Molecules. 2019; 24(8):1483. https://doi.org/10.3390/molecules24081483
Chicago/Turabian StyleLi, Shuntang, Jie Qiao, Siyu Lin, Yi Liu, and Lixin Ma. 2019. "A Highly Efficient Indirect P. pastoris Surface Display Method Based on the CL7/Im7 Ultra-High-Affinity System" Molecules 24, no. 8: 1483. https://doi.org/10.3390/molecules24081483