RA-XII Suppresses the Development and Growth of Liver Cancer by Inhibition of Lipogenesis via SCAP-dependent SREBP Supression
Abstract
:1. Introduction
2. Results
2.1. RA-XII Induces Cell Death and Cell Cycle Arrest in Liver Cancer Cells
2.2. RA-XII Inhibits the Lipid Synthesis in HepG2 Cells
2.3. SREBP-1 Suppression Is Involved in RA-XII-Induced Cell Death and Cell Cycle Arrest in HepG2 Cells
2.4. SCAP-dependent SREBP-1 Suppression Is Involved in RA-XII-induced Cell Death in HepG2 Cells
2.5. RA-XII Exerts Anti-tumor and Lipogenesis Inhibition Effects on Xenograft Mouse Model
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Cell Culture
4.3. Cell Viability Assay
4.4. Cell Cycle Analysis
4.5. Western Blot Analysis
4.6. Preparation of Cell Membrane Fractions and Nuclear Extracts
4.7. Quantitative PCR
4.8. Oil Red O Staining
4.9. Measurement of TC, TG, LDL and HDL
4.10. SCAP and SREBP Knockdown in HepG2 Cells by siRNA
4.11. Xenograft Mouse Model
4.12. Statistical Analysis
5. Conclusions
Supplementary Materials
Author Contributions
Funding
Conflicts of Interest
References
- Farazi, P.A.; DePinho, R.A. Hepatocellular carcinoma pathogenesis: From genes to environment. Nat. Rev. Cancer 2006, 6, 674–687. [Google Scholar] [CrossRef]
- Siegel, R.L.; Miller, K.D.; Jemal, A. Cancer statistics, 2017. CA-Cancer J. Clin. 2015, 60, 277–300. [Google Scholar] [CrossRef] [PubMed]
- Fu, J.; Wang, H. Precision diagnosis and treatment of liver cancer in China. Cancer Lett. 2018, 412, 283–288. [Google Scholar] [CrossRef] [PubMed]
- Cairns, R.A.; Harris, I.S.; Mak, T.W. Regulation of cancer cell metabolism. Nat. Rev. Cancer 2011, 11, 85–95. [Google Scholar] [CrossRef]
- Ricoult, S.J.; Yecies, J.L.; Ben-Sahra, I.; Manning, B.D. Oncogenic PI3K and K-Ras stimulate de novo lipid synthesis through mTORC1 and SREBP. Oncogene 2016, 35, 1250–1260. [Google Scholar] [CrossRef] [PubMed]
- Zaytseva, Y.Y.; Rychahou, P.G.; Gulhati, P.; Elliott, V.A.; Mustain, W.C.; O’Connor, K.; Morris, A.J.; Sunkara, M.; Weiss, H.L.; Lee, E.Y.; et al. Inhibition of fatty acid synthase attenuates CD44-associated signaling and reduces metastasis in colorectal cancer. Cancer Res. 2012, 72, 1504–1517. [Google Scholar] [CrossRef]
- Swierczynski, J.; Hebanowska, A.; Sledzinski, T. Role of abnormal lipid metabolism in development, progression, diagnosis and therapy of pancreatic cancer. World J. Gastroenterol. 2014, 20, 2279–2303. [Google Scholar] [CrossRef]
- Li, N.; Zhou, Z.S.; Shen, Y.; Xu, J.; Miao, H.H.; Xiong, Y.; Xu, F.; Li, B.L.; Luo, J.; Song, B.L. Inhibition of the sterol regulatory element-binding protein pathway suppresses hepatocellular carcinoma by repressing inflammation in mice. Hepatology 2017, 65, 1936–1947. [Google Scholar] [CrossRef] [PubMed]
- Loubiere, C.; Goiran, T.; Laurent, K.; Djabari, Z.; Tanti, J.F.; Bost, F. Metformin-induced energy deficiency leads to the inhibition of lipogenesis in prostate cancer cells. Oncotarget 2015, 6, 15652–15661. [Google Scholar] [CrossRef] [PubMed]
- Ma, J.; Duan, W.; Han, S.; Lei, J.; Xu, Q.; Chen, X.; Jiang, Z.; Nan, L.; Li, J.; Chen, K.; et al. Ginkgolic acid suppresses the development of pancreatic cancer by inhibiting pathways driving lipogenesis. Oncotarget 2015, 6, 20993–21003. [Google Scholar] [CrossRef] [PubMed]
- Dasgupta, S.; Putluri, N.; Long, W.; Zhang, B.; Wang, J.; Kaushik, A.K.; Arnold, J.M.; Bhowmik, S.K.; Stashi, E.; Brennan, C.A.; et al. Coactivator SRC-2-dependent metabolic reprogramming mediates prostate cancer survival and metastasis. J. Clin. Invest. 2015, 125, 1174–1188. [Google Scholar] [CrossRef]
- Adams, C.M.; Reitz, J.; De Brabander, J.K.; Feramisco, J.D.; Li, L.; Brown, M.S.; Goldstein, J.L. Cholesterol and 25-hydroxycholesterol inhibit activation of SREBPs by different mechanisms, both involving SCAP and Insigs. J. Biol. Chem. 2004, 279, 52772–52780. [Google Scholar] [CrossRef] [PubMed]
- Sun, L.P.; Seemann, J.; Goldstein, J.L.; Brown, M.S. Sterol-regulated transport of SREBPs from endoplasmic reticulum to Golgi: Insig renders sorting signal in Scap inaccessible to COPII proteins. Proc. Natl. Acad. Sci. USA 2007, 104, 6519–6526. [Google Scholar] [CrossRef]
- Yang, T.; Espenshade, P.J.; Wright, M.E.; Yabe, D.; Gong, Y.; Aebersold, R.; Goldstein, J.L.; Brown, M.S. Crucial step in cholesterol homeostasis: Sterols promote binding of SCAP to INSIG-1, a membrane protein that facilitates retention of SREBPs in ER. Cell 2002, 110, 489–500. [Google Scholar] [CrossRef]
- Tang, J.J.; Li, J.G.; Qi, W.; Qiu, W.W.; Li, P.S.; Li, B.L.; Song, B.L. Inhibition of SREBP by a small molecule, betulin, improves hyperlipidemia and insulin resistance and reduces atherosclerotic plaques. Cell Metab. 2011, 13, 44–56. [Google Scholar] [CrossRef] [PubMed]
- Cheng, C.; Ru, P.; Geng, F.; Liu, J.; Yoo, J.Y.; Wu, X.; Cheng, X.; Euthine, V.; Hu, P.; Guo, J.Y.; et al. Glucose-mediated N-glycosylation of SCAP is essential for SREBP-1 activation and tumor growth. Cancer cell 2015, 28, 569–581. [Google Scholar] [CrossRef]
- Cragg, G.M.; Newman, D.J. Plants as a source of anti-cancer agents. J. Ethnopharmacol. 2005, 100, 72–79. [Google Scholar] [CrossRef] [PubMed]
- Newman, D.J.; Cragg, G.M. Natural products as sources of new drugs over the 30 years from 1981 to 2010. J. Nat. Prod. 2012, 75, 311–335. [Google Scholar] [CrossRef] [PubMed]
- Tan, N.H.; Zhou, J. Plant cyclopeptides. Chem. Rev. 2006, 106, 840–895. [Google Scholar] [CrossRef] [PubMed]
- Morita, H.; Yamamiya, T.; Takeya, K.; Itokawa, H. New antitumor bicyclic hexapeptides, RA-XI, -XII, -XIII and -XIV from Rubia cordifolia. Chem. Pharm. Bul. 1992, 40, 1352–1354. [Google Scholar] [CrossRef]
- Fan, J.T.; Su, J.; Peng, Y.M.; Li, Y.; Li, J.; Zhou, Y.B.; Zeng, G.Z.; Yan, H.; Tan, N.H. Rubiyunnanins C-H, cytotoxic cyclic hexapeptides from Rubia yunnanensis inhibiting nitric oxide production and NF-κB activation. Bioorg. Med. Chem. 2010, 18, 8226–8234. [Google Scholar] [CrossRef]
- Leung, H.W.; Zhao, S.M.; Yue, G.G.; Lee, J.K.; Fung, K.P.; Leung, P.C.; Tan, N.H.; Lau, C.B. RA-XII inhibits tumour growth and metastasis in breast tumour-bearing mice via reducing cell adhesion and invasion and promoting matrix degradation. Sci. Rep. 2015, 5, 16985. [Google Scholar] [CrossRef]
- Song, L.; Wang, Z.; Wang, Y.; Guo, D.; Yang, J.; Chen, L.; Tan, N. Natural cyclopeptide RA-XII, a new autophagy inhibitor, suppresses protective autophagy for enhancing apoptosis through AMPK/mTOR/P70S6K pathways in HepG2 Cells. Molecules 2017, 22, 1934. [Google Scholar] [CrossRef]
- Schafer, K.A. The cell cycle: A review. Vet. Pathol. 1998, 35, 461–478. [Google Scholar] [CrossRef] [PubMed]
- Caldon, C.E.; Daly, R.J.; Sutherland, R.L.; Musgrove, E.A. Cell cycle control in breast cancer cells. J. Cell Biochem. 2006, 97, 261–274. [Google Scholar] [CrossRef] [PubMed]
- Brauweiler, A.; Lorick, K.L.; Lee, J.P.; Tsai, Y.C.; Chan, D.; Weissman, A.M.; Drabkin, H.A.; Gemmill, R.M. RING-dependent tumor suppression and G2/M arrest induced by the TRC8 hereditary kidney cancer gene. Oncogene 2007, 26, 2263–2271. [Google Scholar] [CrossRef] [PubMed]
- Gholkar, A.A.; Cheung, K.; Williams, K.J.; Lo, Y.C.; Hamideh, S.A.; Nnebe, C.; Khuu, C.; Bensinger, S.J.; Torres, J.Z. Fatostatin inhibits cancer cell proliferation by affecting mitotic microtubule spindle assembly and cell division. J. Biol. Chem. 2016, 291, 17001–17008. [Google Scholar] [CrossRef] [PubMed]
- Hanahan, D.; Weinberg, R.A. Hallmarks of cancer: The next generation. Cell 2011, 144, 646–674. [Google Scholar] [CrossRef] [PubMed]
- Schulze, A.; Harris, A.L. How cancer metabolism is tuned for proliferation and vulnerable to disruption. Nature 2012, 491, 364–373. [Google Scholar] [CrossRef]
- Mashima, T.; Seimiya, H.; Tsuruo, T. De novo fatty-acid synthesis and related pathways as molecular targets for cancer therapy. Br. J. Cancer 2009, 100, 1369–1372. [Google Scholar] [CrossRef]
- Long, Q.Q.; Yi, Y.X.; Qiu, J.; Xu, C.J.; Huang, P.L. Fatty acid synthase (FASN) levels in serum of colorectal cancer patients: Correlation with clinical outcomes. Tumour Biol. 2014, 35, 3855–3859. [Google Scholar] [CrossRef]
- Roongta, U.V.; Pabalan, J.G.; Wang, X.; Ryseck, R.P.; Fargnoli, J.; Henley, B.J.; Yang, W.P.; Zhu, J.; Madireddi, M.T.; Lawrence, R.M.; et al. Cancer cell dependence on unsaturated fatty acids implicates stearoyl-CoA desaturase as a target for cancer therapy. Mol. Cancer Res. 2011, 9, 1551–1561. [Google Scholar] [CrossRef]
- Mashima, T.; Sato, S.; Okabe, S.; Miyata, S.; Matsuura, M.; Sugimoto, Y.; Tsuruo, T.; Seimiya, H. Acyl-CoA synthetase as a cancer survival factor: Its inhibition enhances the efficacy of etoposide. Cancer Sci. 2009, 100, 1556–1562. [Google Scholar] [CrossRef]
- Igal, R.A. Stearoyl-CoA desaturase-1: A novel key player in the mechanisms of cell proliferation, programmed cell death and transformation to cancer. Carcinogenesis 2010, 31, 1509–1515. [Google Scholar] [CrossRef]
- Horton, J.D.; Goldstein, J.L.; Brown, M.S. SREBPs: Activators of the complete program of cholesterol and fatty acid synthesis in the liver. J. Clin. Invest. 2002, 109, 1125–1131. [Google Scholar] [CrossRef]
- Fritz, V.; Benfodda, Z.; Rodier, G.; Henriquet, C.; Iborra, F.; Avancès, C.; Allory, Y.; de la Taille, A.; Culine, S.; Blancou, H.; et al. Abrogation of de novo lipogenesis by stearoyl-CoA desaturase 1 inhibition interferes with oncogenic signaling and blocks prostate cancer progression in mice. Mol. Cancer Ther. 2010, 9, 1740–1754. [Google Scholar] [CrossRef]
- Menendez, J.A.; Vellon, L.; Mehmi, I.; Oza, B.P.; Ropero, S.; Colomer, R.; Lupu, R. Inhibition of fatty acid synthase (FAS) suppresses HER2/neu (erbB-2) oncogene overexpression in cancer cells. Proc. Natl. Acad. Sci. USA 2004, 101, 10715–10720. [Google Scholar] [CrossRef] [PubMed]
- Hilvo, M.; Denkert, C.; Lehtinen, L.; Muller, B.; Brockmoller, S.; Seppanen-Laakso, T.; Budczies, J.; Bucher, E.; Yetukuri, L.; Castillo, S.; et al. Novel theranostic opportunities offered by characterization of altered membrane lipid metabolism in breast cancer progression. Cancer Res. 2011, 71, 3236–3245. [Google Scholar] [CrossRef] [PubMed]
- Griffiths, B.; Lewis, C.A.; Bensaad, K.; Ros, S.; Zhang, Q.; Ferber, E.C.; Konisti, S.; Peck, B.; Miess, H.; East, P.; et al. Sterol regulatory element binding protein-dependent regulation of lipid synthesis supports cell survival and tumor growth. Cancer Metab. 2013, 1, 3. [Google Scholar] [CrossRef] [PubMed]
- Ni, T.; He, Z.; Dai, Y.; Yao, J.; Guo, Q.; Wei, L. Oroxylin A suppresses the development and growth of colorectal cancer through reprogram of HIF1α-modulated fatty acid metabolism. Cell Death Dis. 2017, 8, e2865. [Google Scholar] [CrossRef] [PubMed]
- Mehlem, A.; Hagberg, C.E.; Muhl, L.; Eriksson, U.; Falkevall, A. Imaging of neutral lipids by oil red O for analyzing the metabolic status in health and disease. Nat. Protoc. 2013, 8, 1149–1154. [Google Scholar] [CrossRef] [PubMed]
Sample Availability: Samples of the compound RA-XII are available from the authors. |
Gene | Sense (5′-3′) | Anti-sense (5′-3′) |
---|---|---|
FASN | CGCCGAGTACAATGTCAACAA | AGTGGGGAGATGAGGGGAGT |
SCD | CGACGTGGCTTTTTCTTCTC | GGGGGCTAATGTTCTTGTCA |
GAPDH | AATCCCATCACCATCTTCCAG | ATGAGTCCTTCCACGATACCAA |
Gene | Sense Strand (5′-3′) |
---|---|
SREBP-1 siRNA | GCAACACAGCAACCAGAAATT |
NC siRNA | UUCUCCGAACGUGUCACGUTT |
SCAP siRNA | CCUACCUUGUGGUGGUUAUTT |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Guo, D.; Wang, Y.; Wang, J.; Song, L.; Wang, Z.; Mao, B.; Tan, N. RA-XII Suppresses the Development and Growth of Liver Cancer by Inhibition of Lipogenesis via SCAP-dependent SREBP Supression. Molecules 2019, 24, 1829. https://doi.org/10.3390/molecules24091829
Guo D, Wang Y, Wang J, Song L, Wang Z, Mao B, Tan N. RA-XII Suppresses the Development and Growth of Liver Cancer by Inhibition of Lipogenesis via SCAP-dependent SREBP Supression. Molecules. 2019; 24(9):1829. https://doi.org/10.3390/molecules24091829
Chicago/Turabian StyleGuo, Di, Yurong Wang, Jing Wang, Lihua Song, Zhe Wang, Bingyu Mao, and Ninghua Tan. 2019. "RA-XII Suppresses the Development and Growth of Liver Cancer by Inhibition of Lipogenesis via SCAP-dependent SREBP Supression" Molecules 24, no. 9: 1829. https://doi.org/10.3390/molecules24091829