The Anti-Cancer Effect of Linusorb B3 from Flaxseed Oil through the Promotion of Apoptosis, Inhibition of Actin Polymerization, and Suppression of Src Activity in Glioblastoma Cells
Abstract
:1. Introduction
2. Results and Discussion
2.1. Cytotoxic and Anti-Proliferative Effect of LOB3 in Cancer Cells
2.2. Cytotoxic Effect of LOB3 on C6 Cells by Apoptosis
2.3. Anti-Migratory Effect of LOB3 in C6 Cells
2.4. Inhibitory Effect of LOB3 on Actin Polymerization in C6 Cells through the Targeting of Src and STAT3
3. Materials and Methods
3.1. Materials
3.2. Preparation of Peritoneal Macrophages
3.3. Cell Culture
3.4. Cell Proliferation and Viability Assay
3.5. Cell Death Assays and Flow Cytometry Analysis
3.6. Semi-Quantitative RT-PCR
3.7. Western Blot Analysis
3.8. In Vitro Cell Migration Assay
3.9. Confocal Microscopy
3.10. In Vitro Actin Polymerization and Depolymerization Assays
3.11. Statistical Analysis
4. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
References
- Agnihotri, S.; Burrell, K.E.; Wolf, A.; Jalali, S.; Hawkins, C.; Rutka, J.T.; Zadeh, G. Glioblastoma, a brief review of history, molecular genetics, animal models and novel therapeutic strategies. Arch. Immunol. Ther. Exp. 2013, 61, 25–41. [Google Scholar] [CrossRef] [PubMed]
- Rock, K.; McArdle, O.; Forde, P.; Dunne, M.; Fitzpatrick, D.; O’Neill, B.; Faul, C. A clinical review of treatment outcomes in glioblastoma multiforme—The validation in a non-trial population of the results of a randomised Phase III clinical trial: Has a more radical approach improved survival? Br. J. Radiol. 2012, 85, e729–733. [Google Scholar] [CrossRef] [PubMed]
- Grech, N.; Dalli, T.; Mizzi, S.; Meilak, L.; Calleja, N.; Zrinzo, A. Rising Incidence of Glioblastoma Multiforme in a Well-Defined Population. Cureus 2020, 12, e8195. [Google Scholar] [CrossRef] [PubMed]
- Gallego, O. Nonsurgical treatment of recurrent glioblastoma. Curr. Oncol. 2015, 22, e273–281. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Khosla, D. Concurrent therapy to enhance radiotherapeutic outcomes in glioblastoma. Ann. Transl. Med. 2016, 4, 54. [Google Scholar] [CrossRef] [PubMed]
- Hirsch, S.; Roggia, C.; Biskup, S.; Bender, B.; Gepfner-Tuma, I.; Eckert, F.; Zips, D.; Malek, N.P.; Wilhelm, H.; Renovanz, M.; et al. Depatux-M and temozolomide in advanced high-grade glioma. Neuro Oncol. Adv. 2020, 2, vdaa063. [Google Scholar] [CrossRef] [PubMed]
- Bahadur, S.; Sahu, A.K.; Baghel, P.; Saha, S. Current promising treatment strategy for glioblastoma multiform: A review. Oncol. Rev. 2019, 13, 417. [Google Scholar] [CrossRef] [Green Version]
- Litak, J.; Mazurek, M.; Grochowski, C.; Kamieniak, P.; Rolinski, J. PD-L1/PD-1 Axis in Glioblastoma Multiforme. Int. J. Mol. Sci. 2019, 20, 5347. [Google Scholar] [CrossRef] [Green Version]
- Caccese, M.; Indraccolo, S.; Zagonel, V.; Lombardi, G. PD-1/PD-L1 immune-checkpoint inhibitors in glioblastoma: A concise review. Crit. Rev. Oncol. Hematol. 2019, 135, 128–134. [Google Scholar] [CrossRef]
- Wang, X.; Guo, G.; Guan, H.; Yu, Y.; Lu, J.; Yu, J. Challenges and potential of PD-1/PD-L1 checkpoint blockade immunotherapy for glioblastoma. J. Exp. Clin. Cancer Res. 2019, 38, 87. [Google Scholar] [CrossRef] [Green Version]
- Parikh, M.; Maddaford, T.G.; Austria, J.A.; Aliani, M.; Netticadan, T.; Pierce, G.N. Dietary Flaxseed as a Strategy for Improving Human Health. Nutrients 2019, 11, 1171. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saleem, M.H.; Fahad, S.; Khan, S.U.; Din, M.; Ullah, A.; Sabagh, A.E.; Hossain, A.; Llanes, A.; Liu, L. Copper-induced oxidative stress, initiation of antioxidants and phytoremediation potential of flax (Linum usitatissimum L.) seedlings grown under the mixing of two different soils of China. Environ. Sci. Pollut. Res. Int. 2020, 27, 5211–5221. [Google Scholar] [CrossRef] [PubMed]
- Saleem, M.H.; Ali, S.; Hussain, S.; Kamran, M.; Chattha, M.S.; Ahmad, S.; Aqeel, M.; Rizwan, M.; Aljarba, N.H.; Alkahtani, S.; et al. Flax (Linum usitatissimum L.): A Potential Candidate for Phytoremediation? Biological and Economical Points of View. Plants 2020, 9, 496. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sharma, J.; Singh, R.; Goyal, P.K. Chemomodulatory Potential of Flaxseed Oil Against DMBA/Croton Oil-Induced Skin Carcinogenesis in Mice. Integr. Cancer Ther. 2016, 15, 358–367. [Google Scholar] [CrossRef] [Green Version]
- Zhang, X.; Wang, H.; Yin, P.; Fan, H.; Sun, L.; Liu, Y. Flaxseed oil ameliorates alcoholic liver disease via anti-inflammation and modulating gut microbiota in mice. Lipids Health Dis. 2017, 16, 44. [Google Scholar] [CrossRef] [Green Version]
- Zhu, H.; Wang, H.; Wang, S.; Tu, Z.; Zhang, L.; Wang, X.; Hou, Y.; Wang, C.; Chen, J.; Liu, Y. Flaxseed Oil Attenuates Intestinal Damage and Inflammation by Regulating Necroptosis and TLR4/NOD Signaling Pathways Following Lipopolysaccharide Challenge in a Piglet Model. Mol. Nutr. Food Res. 2018, 62, e1700814. [Google Scholar] [CrossRef]
- Bashir, S.; Sharma, Y.; Jairajpuri, D.; Rashid, F.; Nematullah, M.; Khan, F. Alteration of adipose tissue immune cell milieu towards the suppression of inflammation in high fat diet fed mice by flaxseed oil supplementation. PLoS ONE 2019, 14, e0223070. [Google Scholar] [CrossRef]
- De Silva, S.F.; Alcorn, J. Flaxseed Lignans as Important Dietary Polyphenols for Cancer Prevention and Treatment: Chemistry, Pharmacokinetics, and Molecular Targets. Pharmaceuticals 2019, 12, 68. [Google Scholar] [CrossRef] [Green Version]
- Parikh, M.; Pierce, G.N. Dietary flaxseed: What we know and don’t know about its effects on cardiovascular disease. Can. J. Physiol. Pharmacol. 2019, 97, 75–81. [Google Scholar] [CrossRef]
- Ratan, Z.A.; Jeong, D.; Sung, N.Y.; Shim, Y.Y.; Reaney, M.J.T.; Yi, Y.S.; Cho, J.Y. LOMIX, a Mixture of Flaxseed Linusorbs, Exerts Anti-Inflammatory Effects through Src and Syk in the NF-kappaB Pathway. Biomolecules 2020, 10, 859. [Google Scholar] [CrossRef]
- Watanabe, Y.; Ohata, K.; Fukanoki, A.; Fujimoto, N.; Matsumoto, M.; Nessa, N.; Toba, H.; Kobara, M.; Nakata, T. Antihypertensive and Renoprotective Effects of Dietary Flaxseed and its Mechanism of Action in Deoxycorticosterone Acetate-Salt Hypertensive Rats. Pharmacology 2020, 105, 54–62. [Google Scholar] [CrossRef] [PubMed]
- Zhu, L.; Sha, L.; Li, K.; Wang, Z.; Wang, T.; Li, Y.; Liu, P.; Dong, X.; Dong, Y.; Zhang, X.; et al. Dietary flaxseed oil rich in omega-3 suppresses severity of type 2 diabetes mellitus via anti-inflammation and modulating gut microbiota in rats. Lipids Health Dis. 2020, 19, 20. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saleem, M.H.; Kamran, M.; Zhou, Y.; Parveen, A.; Rehman, M.; Ahmar, S.; Malik, Z.; Mustafa, A.; Ahmad Anjum, R.M.; Wang, B.; et al. Appraising growth, oxidative stress and copper phytoextraction potential of flax (Linum usitatissimum L.) grown in soil differentially spiked with copper. J. Environ. Manag. 2020, 257, 109994. [Google Scholar] [CrossRef] [PubMed]
- Imran, M.; Sun, X.; Hussain, S.; Ali, U.; Rana, M.S.; Rasul, F.; Saleem, M.H.; Moussa, M.G.; Bhantana, P.; Afzal, J.; et al. Molybdenum-Induced Effects on Nitrogen Metabolism Enzymes and Elemental Profile of Winter Wheat (Triticum aestivum L.) Under Different Nitrogen Sources. Int. J. Mol. Sci. 2019, 2, 3009. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kajla, P.; Sharma, A.; Sood, D.R. Flaxseed-a potential functional food source. J. Food Sci. Technol. 2015, 52, 1857–1871. [Google Scholar] [CrossRef] [PubMed]
- Bruhl, L.; Matthaus, B.; Fehling, E.; Wiege, B.; Lehmann, B.; Luftmann, H.; Bergander, K.; Quiroga, K.; Scheipers, A.; Frank, O.; et al. Identification of bitter off-taste compounds in the stored cold pressed linseed oil. J. Agric. Food Chem. 2007, 55, 7864–7868. [Google Scholar] [CrossRef] [PubMed]
- Burnett, P.G.; Jadhav, P.D.; Okinyo-Owiti, D.P.; Poth, A.G.; Reaney, M.J. Glycine-containing flaxseed orbitides. J. Nat. Prod. 2015, 78, 681–688. [Google Scholar] [CrossRef]
- Burnett, P.G.; Olivia, C.M.; Okinyo-Owiti, D.P.; Reaney, M.J. Orbitide Composition of the Flax Core Collection (FCC). J. Agric. Food Chem. 2016, 64, 5197–5206. [Google Scholar] [CrossRef]
- Okinyo-Owiti, D.P.; Dong, Q.; Ling, B.; Jadhav, P.D.; Bauer, R.; Maley, J.M.; Reaney, M.J.T.; Yang, J.; Sammynaiken, R. Evaluating the cytotoxicity of flaxseed orbitides for potential cancer treatment. Toxicol. Rep. 2015, 2, 1014–1018. [Google Scholar] [CrossRef] [Green Version]
- Okinyo-Owiti, D.P.; Young, L.; Burnett, P.G.; Reaney, M.J. New flaxseed orbitides: Detection, sequencing, and (15)N incorporation. Biopolymers 2014, 102, 168–175. [Google Scholar] [CrossRef]
- Sharav, O.; Shim, Y.Y.; Okinyo-Owiti, D.P.; Sammynaiken, R.; Reaney, M.J. Effect of cyclolinopeptides on the oxidative stability of flaxseed oil. J. Agric. Food Chem. 2014, 62, 88–96. [Google Scholar] [CrossRef] [PubMed]
- Drygala, P.; Olejnik, J.; Mazur, A.; Kierus, K.; Jankowski, S.; Zimecki, M.; Zabrocki, J. Synthesis and immunosuppressive activity of cyclolinopeptide A analogues containing homophenylalanine. Eur. J. Med. Chem. 2009, 44, 3731–3738. [Google Scholar] [CrossRef] [PubMed]
- Bell, A.; McSteen, P.M.; Cebrat, M.; Picur, B.; Siemion, I.Z. Antimalarial activity of cyclolinopeptide A and its analogues. Acta Pol. Pharm. 2000, 57, 134–136. [Google Scholar] [PubMed]
- Yang, J.; Jadhav, P.D.; Reaney, M.J.T.; Sammynaiken, R.; Yang, J. A novel formulation significantly increases the cytotoxicity of flaxseed orbitides (linusorbs) LOB3 and LOB2 towards human breast cancer MDA-MB-231 cells. Die Pharm. 2019, 74, 520–522. [Google Scholar] [CrossRef]
- Shim, Y.Y.; Young, L.W.; Arnison, P.G.; Gilding, E.; Reaney, M.J. Proposed systematic nomenclature for orbitides. J. Nat. Prod. 2015, 78, 645–652. [Google Scholar] [CrossRef] [PubMed]
- Zou, X.G.; Li, J.; Sun, P.L.; Fan, Y.W.; Yang, J.Y.; Deng, Z.Y. Orbitides isolated from flaxseed induce apoptosis against SGC-7901 adenocarcinoma cells. Int. J. Food Sci. Nutr. 2020, 71, 929–939. [Google Scholar] [CrossRef] [PubMed]
- Ostrom, Q.T.; Cioffi, G.; Gittleman, H.; Patil, N.; Waite, K.; Kruchko, C.; Barnholtz-Sloan, J.S. CBTRUS Statistical Report: Primary Brain and Other Central Nervous System Tumors Diagnosed in the United States in 2012–2016. Neuro Oncol. 2019, 21, v1–v100. [Google Scholar] [CrossRef]
- Heilos, D.; Rodriguez-Carrasco, Y.; Englinger, B.; Timelthaler, G.; van Schoonhoven, S.; Sulyok, M.; Boecker, S.; Sussmuth, R.D.; Heffeter, P.; Lemmens-Gruber, R.; et al. The Natural Fungal Metabolite Beauvericin Exerts Anticancer Activity In Vivo: A Pre-Clinical Pilot Study. Toxins 2017, 9, 258. [Google Scholar] [CrossRef] [Green Version]
- Cao, X.H.; Wang, A.H.; Wang, C.L.; Mao, D.Z.; Lu, M.F.; Cui, Y.Q.; Jiao, R.Z. Surfactin induces apoptosis in human breast cancer MCF-7 cells through a ROS/JNK-mediated mitochondrial/caspase pathway. Chem. Biol. Interact. 2010, 183, 357–362. [Google Scholar] [CrossRef]
- Taniguchi, Y.; Yamamoto, N.; Hayashi, K.; Takeuchi, A.; Miwa, S.; Igarashi, K.; Higuchi, T.; Abe, K.; Yonezawa, H.; Araki, Y.; et al. Anti-tumor Effects of Cyclolinopeptide on Giant-cell Tumor of the Bone. Anticancer Res. 2019, 39, 6145–6153. [Google Scholar] [CrossRef]
- Elmore, S. Apoptosis: A review of programmed cell death. Toxicol. Pathol. 2007, 35, 495–516. [Google Scholar] [CrossRef] [PubMed]
- He, B.; Lu, N.; Zhou, Z. Cellular and nuclear degradation during apoptosis. Curr. Opin. Cell Biol. 2009, 21, 900–912. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, C.L.; Liu, C.; Niu, L.L.; Wang, L.R.; Hou, L.H.; Cao, X.H. Surfactin-induced apoptosis through ROS-ERS-Ca2+-ERK pathways in HepG2 cells. Cell Biochem. Biophys. 2013, 67, 1433–1439. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Saraste, A.; Pulkki, K. Morphologic and biochemical hallmarks of apoptosis. Cardiovasc. Res. 2000, 45, 528–537. [Google Scholar] [CrossRef]
- Zhang, J.H.; Xu, M. DNA fragmentation in apoptosis. Cell Res. 2000, 10, 205–211. [Google Scholar] [CrossRef] [PubMed]
- Belmokhtar, C.A.; Hillion, J.; Segal-Bendirdjian, E. Staurosporine induces apoptosis through both caspase-dependent and caspase-independent mechanisms. Oncogene 2001, 20, 3354–3362. [Google Scholar] [CrossRef] [Green Version]
- Cornelissen, M.; Philippe, J.; De Sitter, S.; De Ridder, L. Annexin V expression in apoptotic peripheral blood lymphocytes: An electron microscopic evaluation. Apoptosis Int. J. Program. Cell Death 2002, 7, 41–47. [Google Scholar] [CrossRef]
- Kale, J.; Osterlund, E.J.; Andrews, D.W. BCL-2 family proteins: Changing partners in the dance towards death. Cell Death Differ. 2018, 25, 65–80. [Google Scholar] [CrossRef] [Green Version]
- Janicke, R.U.; Sohn, D.; Schulze-Osthoff, K. The dark side of a tumor suppressor: Anti-apoptotic p53. Cell Death Differ. 2008, 15, 959–976. [Google Scholar] [CrossRef] [Green Version]
- Espinosa-Oliva, A.M.; Garcia-Revilla, J.; Alonso-Bellido, I.M.; Burguillos, M.A. Brainiac Caspases: Beyond the Wall of Apoptosis. Front. Cell. Neurosci. 2019, 13, 500. [Google Scholar] [CrossRef] [Green Version]
- McIlwain, D.R.; Berger, T.; Mak, T.W. Caspase functions in cell death and disease. Cold Spring Harb. Perspect. Biol. 2015, 7, a026716. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, S.Y.; Kim, J.H.; Lee, Y.J.; Lee, S.J.; Kim, Y. Surfactin suppresses TPA-induced breast cancer cell invasion through the inhibition of MMP-9 expression. Int. J. Oncol. 2013, 42, 287–296. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, H.; Condeelis, J. Regulation of the actin cytoskeleton in cancer cell migration and invasion. Biochim. Biophys. Acta 2007, 1773, 642–652. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Olson, M.F.; Sahai, E. The actin cytoskeleton in cancer cell motility. Clin. Exp. Metastasis 2009, 26, 273–287. [Google Scholar] [CrossRef] [Green Version]
- Izdebska, M.; Zielinska, W.; Grzanka, D.; Gagat, M. The Role of Actin Dynamics and Actin-Binding Proteins Expression in Epithelial-to-Mesenchymal Transition and Its Association with Cancer Progression and Evaluation of Possible Therapeutic Targets. BioMed Res. Int. 2018, 2018, 4578373. [Google Scholar] [CrossRef] [Green Version]
- Stehn, J.R.; Haass, N.K.; Bonello, T.; Desouza, M.; Kottyan, G.; Treutlein, H.; Zeng, J.; Nascimento, P.R.; Sequeira, V.B.; Butler, T.L.; et al. A novel class of anticancer compounds targets the actin cytoskeleton in tumor cells. Cancer Res. 2013, 73, 5169–5182. [Google Scholar] [CrossRef] [Green Version]
- Foerster, F.; Braig, S.; Moser, C.; Kubisch, R.; Busse, J.; Wagner, E.; Schmoeckel, E.; Mayr, D.; Schmitt, S.; Huettel, S.; et al. Targeting the actin cytoskeleton: Selective antitumor action via trapping PKCvarepsilon. Cell Death Dis. 2014, 5, e1398. [Google Scholar] [CrossRef] [Green Version]
- Gandalovicova, A.; Rosel, D.; Fernandes, M.; Vesely, P.; Heneberg, P.; Cermak, V.; Petruzelka, L.; Kumar, S.; Sanz-Moreno, V.; Brabek, J. Migrastatics-Anti-metastatic and Anti-invasion Drugs: Promises and Challenges. Trends Cancer 2017, 3, 391–406. [Google Scholar] [CrossRef] [Green Version]
- Xuan, B.; Ghosh, D.; Cheney, E.M.; Clifton, E.M.; Dawson, M.R. Dysregulation in Actin Cytoskeletal Organization Drives Increased Stiffness and Migratory Persistence in Polyploidal Giant Cancer Cells. Sci. Rep. 2018, 8, 11935. [Google Scholar] [CrossRef]
- Kim, M.Y.; Kim, J.H.; Cho, J.Y. Cytochalasin B modulates macrophage-mediated inflammatory responses. Biomol. Ther. 2014, 22, 295–300. [Google Scholar] [CrossRef] [Green Version]
- Craig, E.W.; Avasthi, P. Visualizing Filamentous Actin Using Phalloidin in Chlamydomonas reinhardtii. Bio-Protocol 2019, 9, e3274. [Google Scholar] [CrossRef] [PubMed]
- Cheng, Y.; Feng, Y.; Jansson, L.; Sato, Y.; Deguchi, M.; Kawamura, K.; Hsueh, A.J. Actin polymerization-enhancing drugs promote ovarian follicle growth mediated by the Hippo signaling effector YAP. FASEB J. Off. Publ. Fed. Am. Soc. Exp. Biol. 2015, 29, 2423–2430. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Dehm, S.M.; Bonham, K. SRC gene expression in human cancer: The role of transcriptional activation. Biochem. Cell Biol. Biochim. Biol. Cell. 2004, 82, 263–274. [Google Scholar] [CrossRef] [PubMed]
- Sen, B.; Johnson, F.M. Regulation of SRC family kinases in human cancers. J. Signal Transduct. 2011, 2011, 865819. [Google Scholar] [CrossRef] [Green Version]
- Sandilands, E.; Cans, C.; Fincham, V.J.; Brunton, V.G.; Mellor, H.; Prendergast, G.C.; Norman, J.C.; Superti-Furga, G.; Frame, M.C. RhoB and actin polymerization coordinate Src activation with endosome-mediated delivery to the membrane. Dev. Cell 2004, 7, 855–869. [Google Scholar] [CrossRef] [Green Version]
- Garcia, R.; Bowman, T.L.; Niu, G.; Yu, H.; Minton, S.; Muro-Cacho, C.A.; Cox, C.E.; Falcone, R.; Fairclough, R.; Parsons, S.; et al. Constitutive activation of Stat3 by the Src and JAK tyrosine kinases participates in growth regulation of human breast carcinoma cells. Oncogene 2001, 20, 2499–2513. [Google Scholar] [CrossRef] [Green Version]
- Bjorge, J.D.; Pang, A.S.; Funnell, M.; Chen, K.Y.; Diaz, R.; Magliocco, A.M.; Fujita, D.J. Simultaneous siRNA targeting of Src and downstream signaling molecules inhibit tumor formation and metastasis of a human model breast cancer cell line. PLoS ONE 2011, 6, e19309. [Google Scholar] [CrossRef] [Green Version]
- Harada, D.; Takigawa, N.; Kiura, K. The Role of STAT3 in Non-Small Cell Lung Cancer. Cancers 2014, 6, 708–722. [Google Scholar] [CrossRef]
- Mosmann, T. Rapid colorimetric assay for cellular growth and survival: Application to proliferation and cytotoxicity assays. J. Immunol. Methods 1983, 65, 55–63. [Google Scholar] [CrossRef]
- Lee, J.O.; Choi, E.; Shin, K.K.; Hong, Y.H.; Kim, H.G.; Jeong, D.; Hossain, M.A.; Kim, H.S.; Yi, Y.S.; Kim, D.; et al. Compound K, a ginsenoside metabolite, plays an antiinflammatory role in macrophages by targeting the AKT1-mediated signaling pathway. J. Ginseng Res. 2019, 43, 154–160. [Google Scholar] [CrossRef]
- Lee, J.O.; Kim, J.H.; Kim, S.; Kim, M.Y.; Hong, Y.H.; Kim, H.G.; Cho, J.Y. Gastroprotective effects of the nonsaponin fraction of Korean Red Ginseng through cyclooxygenase-1 upregulation. J. Ginseng Res. 2020, 44, 655–663. [Google Scholar] [CrossRef] [PubMed]
- Zhao, L.; Xu, G.; Zhou, J.; Xing, H.; Wang, S.; Wu, M.; Lu, Y.P.; Ma, D. The effect of RhoA on human umbilical vein endothelial cell migration and angiogenesis in vitro. Oncol. Rep. 2006, 15, 1147–1152. [Google Scholar] [CrossRef] [PubMed]
- Yi, Y.S.; Baek, K.S.; Cho, J.Y. L1 cell adhesion molecule induces melanoma cell motility by activation of mitogen-activated protein kinase pathways. Die Pharm. 2014, 69, 461–467. [Google Scholar]
Targets | Annealing Temp. | Cycle No. | Fragment Size (Base Pair) |
---|---|---|---|
Bcl-2 | 60 | 30 | 304 |
Bax | 60 | 30 | 240 |
p53 | 60 | 30 | 560 |
GAPDH | 60 | 25 | 350 |
Targets | Sequences (5′ to 3′) | |
---|---|---|
Bcl-2 | Forward | CACCCCTGGCATCTTCTCCTT |
Reverse | CACAATCCTCCCCCAGTTCACC | |
Bax | Forward | ATGGCTGGGGAGACACCTGAG |
Reverse | CTAGCAAAGTAGAAAAGGGCAAC | |
p53 | Forward | CTCTGTCATCTTCCGTCCCTTC |
Reverse | AGGACAGGCACAAACACGAAC | |
GAPDH | Forward | CACTCACGGCAAATTCAACGGCAC |
Reverse | GACTCCACGACATACTCAGCAC |
Sample Availability: Sample of the compound linusorb B3 (LOB3), is available from the authors. |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2020 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sung, N.Y.; Jeong, D.; Shim, Y.Y.; Ratan, Z.A.; Jang, Y.-J.; Reaney, M.J.T.; Lee, S.; Lee, B.-H.; Kim, J.-H.; Yi, Y.-S.; et al. The Anti-Cancer Effect of Linusorb B3 from Flaxseed Oil through the Promotion of Apoptosis, Inhibition of Actin Polymerization, and Suppression of Src Activity in Glioblastoma Cells. Molecules 2020, 25, 5881. https://doi.org/10.3390/molecules25245881
Sung NY, Jeong D, Shim YY, Ratan ZA, Jang Y-J, Reaney MJT, Lee S, Lee B-H, Kim J-H, Yi Y-S, et al. The Anti-Cancer Effect of Linusorb B3 from Flaxseed Oil through the Promotion of Apoptosis, Inhibition of Actin Polymerization, and Suppression of Src Activity in Glioblastoma Cells. Molecules. 2020; 25(24):5881. https://doi.org/10.3390/molecules25245881
Chicago/Turabian StyleSung, Nak Yoon, Deok Jeong, Youn Young Shim, Zubair Ahmed Ratan, Young-Jin Jang, Martin J. T. Reaney, Sarah Lee, Byoung-Hee Lee, Jong-Hoon Kim, Young-Su Yi, and et al. 2020. "The Anti-Cancer Effect of Linusorb B3 from Flaxseed Oil through the Promotion of Apoptosis, Inhibition of Actin Polymerization, and Suppression of Src Activity in Glioblastoma Cells" Molecules 25, no. 24: 5881. https://doi.org/10.3390/molecules25245881