Simultaneous Quantification of Ampicillin and Kanamycin in Water Samples Based on Lateral Flow Aptasensor Strip with an Internal Line
Abstract
:1. Introduction
2. Materials and Methods
2.1. Reagents and Materials
2.2. Preparation of Streptavidin–Biotinylated DNA Conjugate
2.3. Sample Preparation
2.4. Fabrication of LFA Strip
2.5. Data Analysis
3. Results and Discussion
3.1. Principle of Aptasensor-Based LFA for Simultaneous Detection of AMP and KAM Residues
3.2. The Internal Line for Dual Antibiotics Residue Analysis
3.3. Optimization of LFA Assay Parameters
3.4. Specificity
3.5. Real Sample Analysis
4. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Li, Z.; Li, M.; Zhang, Z.; Li, P.; Zang, Y.; Liu, X. Antibiotics in aquatic environments of China: A review and meta-analysis. Ecotox. Environ. Safe 2020, 199, 110668. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Ying, G.; Deng, W. Antibiotic Residues in Food: Extraction, Analysis, and Human Health Concerns. J. Agric. Food Chem. 2019, 62, 7569–7586. [Google Scholar] [CrossRef]
- Cao, J.; Lai, L.; Lai, B.; Yao, G.; Chen, X.; Song, L. Degradation of tetracycline by peroxymonosulfate activated with zero-valent iron: Performance, intermediates, toxicity and mechanism. Chem. Eng. J. 2019, 364, 45–56. [Google Scholar] [CrossRef]
- Zhu, L.; Santiago-Schübel, B.; Xiao, H.; Hollert, H.; Kueppers, S. Electrochemical oxidation of fluoroquinolone antibiotics: Mechanism, residual antibacterial activity and toxicity change. Water Res. 2016, 102, 52–62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Yamaki, M.; Berruga, M.I.; Althaus, R.L.; Molina, M.P.; Molina, A. Screening of antibiotic residues in Ewes’ milk destined to cheese by a commercial microbiological inhibition assay. Food Addit. Contam. A. 2006, 23, 660–667. [Google Scholar] [CrossRef]
- Colombo, R.; Papetti, A. Advances in the Analysis of Veterinary Drug Residues in Food Matrices by Capillary Electrophoresis Techniques. Molecules 2019, 24, 4617. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhang, Y.; Li, X.; Li, H.; Zhang, Q.; Gao, Y.; Li, X. Antibiotic residues in honey: A review on analytical methods by liquid chromatography tandem mass spectrometry. TrAC Trends Anal. Chem. 2019, 110, 344–356. [Google Scholar] [CrossRef]
- Shen, Z.; He, L.; Cao, Y.; Hong, F.; Zhang, K.; Hu, F.; Lin, J.; Wu, D.; Gao, N. Multiplexed electrochemical aptasensor for antibiotics detection using metallic-encoded apoferritin probes and double stirring bars-assisted target recycling for signal amplification. Talanta 2019, 197, 491–499. [Google Scholar] [CrossRef]
- Zeng, K.; Zhang, X.; Wei, D.; Huang, Z.; Cheng, S.; Chen, J. Chemiluminescence imaging immunoassay for multiple aminoglycoside antibiotics in cow milk. Int. J. Food Sci. Technol. 2020, 55, 119–126. [Google Scholar] [CrossRef]
- Zeng, R.; Zhang, L.; Su, L.; Luo, Z.; Zhou, Q.; Tang, D. Photoelectrochemical bioanalysis of antibiotics on rGO-Bi2WO6-Au based on branched hybridization chain reaction. Biosens. Bioelectron. 2019, 133, 100–106. [Google Scholar] [CrossRef]
- Cheng, S.; Liu, H.; Zhang, H.; Chu, G.; Guo, Y.; Sun, X. Ultrasensitive electrochemiluminescence aptasensor for kanamycin detection based on silver nanoparticle-catalyzed chemiluminescent reaction between luminol and hydrogen peroxide. Sens. Actuators B Chem. 2020, 304, 127367. [Google Scholar] [CrossRef]
- Wu, L.; Li, G.; Xu, X.; Zhu, L.; Huang, R.; Chen, X. Application of nano-ELISA in food analysis: Recent advances and challenges. TrAC Trends Anal. Chem. 2019, 113, 140–156. [Google Scholar] [CrossRef]
- Carrell, C.; Kava, A.; Nguyen, M.; Menger, R.; Munshi, Z.; Call, Z. Beyond the lateral flow assay: A review of paper-based microfluidics. Microelectron. Eng. 2019, 206, 45–54. [Google Scholar] [CrossRef]
- Jenks, J.D.; Mehta, S.R.; Taplitz, R.; Aslam, S.; Reed, S.L.; Hoenigl, M. Point-of-care diagnosis of invasive aspergillosis in non-neutropenic patients: Aspergillus Galactomannan Lateral Flow Assay versus Aspergillus-specific Lateral Flow Device test in bronchoalveolar lavage. Mycoses 2019, 62, 230–236. [Google Scholar] [CrossRef]
- Gao, Y.; Zhu, Z.; Xi, X.; Cao, T.; Wen, W.; Zhang, X.; Wang, S. An aptamer-based hook-effect-recognizable three-line lateral flow biosensor for rapid detection of thrombin. Biosens. Bioelectron. 2019, 133, 177–182. [Google Scholar] [CrossRef]
- He, D.; Wu, Z.; Cui, B.; Xu, E.; Jin, Z. Establishment of a dual mode immunochromatographic assay for Campylobacter jejuni detection. Food Chem. 2019, 289, 708–713. [Google Scholar] [CrossRef]
- Li, X.; Yang, T.; Song, Y.; Zhu, J.; Wang, D.; Li, W. Surface-enhanced Raman spectroscopy (SERS)-based immunochromatographic assay (ICA) for the simultaneous detection of two pyrethroid pesticides. Sens. Actuators B Chem. 2019, 283, 230–238. [Google Scholar] [CrossRef]
- Chen, Y.; Chen, Q.; Han, M.; Liu, J.; Zhao, P.; He, L.; Zhang, Y.; Niu, Y.; Yang, W.; Zhang, L. Near-infrared fluorescence-based multiplex lateral flow immunoassay for the simultaneous detection of four antibiotic residue families in milk. Biosens. Bioelectron. 2016, 79, 430–434. [Google Scholar] [CrossRef]
- Yan, S.; Foroughi, M.M.; Safaei, M.; Jahani, S.; Ebrahimpour, N.; Borhani, F.; Baravati, N.R.Z.; Aramesh-Boroujeni, Z.; Foong, L.K. A review: Recent advances in ultrasensitive and highly specific recognition aptasensors with various detection strategies. Int. J. Biol. Macromol. 2020, 155, 184–207. [Google Scholar] [CrossRef]
- Díaz-Fernández, A.; Lorenzo-Gómez, R.; Miranda-Castro, R.; de-los-Santos-Alvarez, N.; Lobo-Castanón, M.J. Electrochemical aptasensors for cancer diagnosis in biological fluids—A review. Anal. Chim. Acta 2020, 1124, 1–19. [Google Scholar] [CrossRef] [PubMed]
- He, L.; Shen, Z.; Cao, Y.; Li, T.; Wu, D.; Dong, Y.; Gan, N. A microfluidic chip based ratiometric aptasensor for antibiotic detection in foods using stir bar assisted sorptive extraction and rolling circle amplification. Analyst 2019, 144, 2755–2764. [Google Scholar] [CrossRef]
- Negahdary, M. Electrochemical aptasensors based on the gold nanostructures. Talanta 2020, 216, 120999. [Google Scholar] [CrossRef]
- Yu, J.; Tang, W.; Wang, F.; Zhang, F.; Wang, Q.; He, P. Simultaneous detection of streptomycin and kanamycin based on an all-solid-state potentiometric aptasensor array with a dual-internal calibration system. Sens. Actuators B Chem. 2020, 311, 127857. [Google Scholar] [CrossRef]
- Song, K.M.; Cho, M.; Jo, H.; Min, K.; Jeon, S.H.; Kim, T.; Han, M.S.; Ku, J.K.; Ban, C. Gold nanoparticle-based colorimetric detection of kanamycin using a DNA aptamer. Anal. Biochem. 2011, 415, 175–181. [Google Scholar] [CrossRef] [PubMed]
- Song, K.M.; Jeong, E.; Jeon, W.; Cho, M.; Ban, C. Aptasensor for ampicillin using gold nanoparticle based dual fluorescence-colorimetric methods. Anal. Bioanal. Chem. 2012, 402, 2153–2161. [Google Scholar] [CrossRef]
- Lin, X.; Su, J.; Lin, H.; Sun, X.; Liu, B.; Kumar-Kankala, R.; Zhou, S. Luminescent carbon nanodots based aptasensors for rapid detection of kanamycin residue. Talanta 2019, 202, 452–459. [Google Scholar] [CrossRef]
- Lin, H.; Fang, F.; Zang, J.; Su, J.; Tian, Q.; Kumar-Kankala, R.; Lin, X. A Fluorescent Sensor-Assisted Paper-Based Competitive Lateral Flow Immunoassay for the Rapid and Sensitive Detection of Ampicillin in Hospital Wastewater. Micromachines 2020, 11, 431. [Google Scholar] [CrossRef] [Green Version]
- Daprà, J.; Lauridsen, L.H.; Nielsen, A.T.; Rozlosnik, N. Comparative study on aptamers as recognition elements for antibiotics in a label-free all-polymer biosensor. Biosens. Bioelectron. 2013, 43, 315–320. [Google Scholar] [CrossRef]
- Oh, Y.K.; Joung, H.A.; Han, H.S.; Suk, H.J.; Kim, M.G. A three-line lateral flow assay strip for the measurement of C-reactive protein covering a broad physiological concentration range in human sera. Biosens. Bioelectron. 2014, 61, 285–289. [Google Scholar] [CrossRef] [PubMed]
- Kato, K.; Ikeda, H.; Miyakawa, S.; Futakawa, S.; Nonaka, Y.; Fujiwara, M.; Okudaira, S.; Kano, K.; Aoki, J.; Morita1, J.; et al. Structural basis for specific inhibition of Autotaxin by a DNA aptamer. Nat. Struct. Mol. Biol. 2016, 23, 395–401. [Google Scholar] [CrossRef] [PubMed]
- Jo, M.; Ahn, J.Y.; Lee, J.; Lee, S.; Hong, S.W.; Yoo, J.-W.; Kang, J.; Dua, P.; Lee, D.-K.; Hong, S.; et al. Development of single-stranded DNA aptamers for specific Bisphenol a detection. Oligonucleotides 2011, 21, 85–91. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kim, M.S.; Kweon, S.H.; Cho, S.; An, S.S.A.; Kim, M.I.; Doh, J.; Lee, J. Pt-Decorated Magnetic Nanozymes for Facile and Sensitive Point-of-Care Bioassay. ACS Appl. Mater. Interfaces 2017, 9, 35133–35140. [Google Scholar] [CrossRef] [PubMed]
- Anthony, E.T.; Ojemaye, M.O.; Okoh, O.O.; Okoh, A.I. A critical review on the occurrence of resistomes in the environment and their removal from wastewater using apposite treatment technologies: Limitations, successes and future improvement. Environ. Pollut. 2020, 263, 113791. [Google Scholar] [CrossRef] [PubMed]
- Kovalakova, P.; Cizmas, L.; McDonald, T.J.; Marsalek, B.; Feng, M.; Sharma, V.K. Occurrence and toxicity of antibiotics in the aquatic environment: A review. Chemosphere 2020, 251, 126351. [Google Scholar] [CrossRef] [PubMed]
Name | Sequence |
---|---|
Control capture DNA | 5′-GTCAGATGAATTCGTGTGAGAAAAA-bio-3′ |
AMP capture DNA | 5′-CCGCTATACAACCGCCCG-C6-bio-3′ |
KAM capture DNA | TGGGGGTTGAGGCTAAGCCGATT TTT-C6-bio-3′ |
Internal capture DNA | 5′-ATTCGTGTGAGAAAA CCAACCCGCCCTACCCA AAAGTCAGATGA-bio-3′ |
AMP HEX-labeled DNA | 5′-GCGGGCGGTTGTATAGCGGTTTTTTCTCACACGAAT TCATCTGAC-HEX-3′ |
KAM HEX-labeled DNA | 5′-TCGGCTTAGCCTCAACCCCATTTTTTAATTCA TCTGAC-HEX-3′ |
Internal HEX-labeled DNA | 5′-GGGTAGGGCGGGTTGGG-C6-Hex-3′ |
Sample | AMP (ng/L) | KAM (ng/L) | Spiked [AMP] (ng/L) | Recovery of Spiked AMP (%) | RSD (%) | Spiked [AMP] (ng/L) | Recovery of Spiked AMP (%) | RSD (%) | Spiked [KAM] (ng/L) | Recovery of Spiked KAM (%) | RSD (%) | Spiked [KAM] (ng/L) | Recovery of Spiked KAM (%) | RSD (%) |
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Hospital wastewater 1 | <LOQ | <LOQ | 0.5 | 93.21 | 2.32 | 200 | 95.51 | 1.32 | 1.0 | 95.81 | 3.28 | 200 | 95.18 | 1.21 |
Hospital wastewater 2 | <LOQ | ND | 0.5 | 93.65 | 3.89 | 200 | 95.65 | 2.12 | 1.0 | 95.65 | 3.59 | 200 | 95.21 | 2.42 |
Chicken farm wastewater | <LOQ | ND | 0.5 | 94.34 | 2.58 | 200 | 96.37 | 2.25 | 1.0 | 95.33 | 3.36 | 200 | 96.51 | 2.35 |
Tap water 1 | ND | ND | 0.5 | 96.53 | 3.35 | 200 | 99.53 | 3.27 | 1.0 | 98.63 | 2.21 | 200 | 99.78 | 1.10 |
Aquaculture water | ND | ND | 0.5 | 97.66 | 3.08 | 200 | 99.66 | 1.01 | 1.0 | 98.95 | 2.34 | 200 | 99.59 | 1.33 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lin, J.; Shi, A.; Zheng, Z.; Huang, L.; Wang, Y.; Lin, H.; Lin, X. Simultaneous Quantification of Ampicillin and Kanamycin in Water Samples Based on Lateral Flow Aptasensor Strip with an Internal Line. Molecules 2021, 26, 3806. https://doi.org/10.3390/molecules26133806
Lin J, Shi A, Zheng Z, Huang L, Wang Y, Lin H, Lin X. Simultaneous Quantification of Ampicillin and Kanamycin in Water Samples Based on Lateral Flow Aptasensor Strip with an Internal Line. Molecules. 2021; 26(13):3806. https://doi.org/10.3390/molecules26133806
Chicago/Turabian StyleLin, Jinbiao, Ang Shi, Ziwu Zheng, Long Huang, Yixin Wang, Honggui Lin, and Xuexia Lin. 2021. "Simultaneous Quantification of Ampicillin and Kanamycin in Water Samples Based on Lateral Flow Aptasensor Strip with an Internal Line" Molecules 26, no. 13: 3806. https://doi.org/10.3390/molecules26133806