Obacunone Attenuates Liver Fibrosis with Enhancing Anti-Oxidant Effects of GPx-4 and Inhibition of EMT
Abstract
:1. Introduction
2. Results
2.1. Oba Inhibited TGF-β-Induced Lx-2 Activation
2.2. Oba Inhibited TGF-β/Smad Signals, EMT Process and Exerted Anti-Inflammatory Effect
2.3. Anti-Fibrosis Effects of Oba Was Dependent on the Enhanced Antioxidant Capacity by Activating GPx-4
2.4. Oba Attenuates CCl4-Induced Mouse Liver Fibrosis
2.5. Oba Enhanced the Expression of GPx-4, Decreased Inflammation, EMT-Related Protein Expressions and Reduced the Lipid Oxidation Levels in CCl4-Induced Liver Fibrosis
3. Discussion
4. Materials and Methods
4.1. Chemicals and Reagents
4.2. Cell Cultures and Experimental Design
4.3. Animals and Experimental Design
4.4. Western Blotting
4.5. Real-Time qPCR Analysis
4.6. Immunofluorescence Staining and Immunohistochemical Staining (IHC)
4.7. Biochemical Analyses
4.8. ROS Analyses
4.9. Histological Assays
4.10. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Wang, W.; Huang, X.; Fan, X.; Yan, J.; Luan, J. Progress in evaluating the status of hepatitis C infection based on the functional changes of hepatic stellate cells (Review). Mol. Med. Rep. 2020, 22, 4116–4124. [Google Scholar] [CrossRef] [PubMed]
- Lee, Y.A.; Wallace, M.C.; Friedman, S.L. Pathobiology of liver fibrosis: A translational success story. Gut 2015, 64, 830–841. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Walraven, M.; Hinz, B. Therapeutic approaches to control tissue repair and fibrosis: Extracellular matrix as a game changer. Matrix Biol. 2018, 71–72, 205–224. [Google Scholar] [CrossRef] [PubMed]
- Seki, E.; Schwabe, R.F. Hepatic inflammation and fibrosis: Functional links and key pathways. Hepatology 2015, 61, 1066–1079. [Google Scholar] [CrossRef]
- Fontana, A.; Constam, D.B.; Frei, K.; Malipiero, U.; Pfister, H.W. Modulation of the immune response by transforming growth factor beta. Int. Arch. Allergy Immunol. 1992, 99, 1–7. [Google Scholar] [CrossRef]
- Siegel, P.M.; Massague, J. Cytostatic and apoptotic actions of TGF-beta in homeostasis and cancer. Nat. Rev. Cancer 2003, 3, 807–821. [Google Scholar] [CrossRef]
- Ahmadi, A.; Najafi, M.; Farhood, B.; Mortezaee, K. Transforming growth factor-beta signaling: Tumorigenesis and targeting for cancer therapy. J. Cell. Physiol. 2019, 234, 12173–12187. [Google Scholar] [CrossRef]
- Ansa-Addo, E.A.; Zhang, Y.; Yang, Y.; Hussey, G.S.; Howley, B.V.; Salem, M.; Riesenberg, B.; Sun, S.; Rockey, D.C.; Karvar, S.; et al. Membrane-organizing protein moesin controls Treg differentiation and antitumor immunity via TGF-beta signaling. J. Clin. Investig. 2017, 127, 1321–1337. [Google Scholar] [CrossRef] [Green Version]
- Kalluri, R.; Weinberg, R.A. The basics of epithelial-mesenchymal transition. J. Clin. Investig. 2009, 119, 1420–1428. [Google Scholar] [CrossRef] [Green Version]
- Lu, C.; Yang, Z.; Yu, D.; Lin, J.; Cai, W. RUNX1 regulates TGF-beta induced migration and EMT in colorectal cancer. Pathol. Res. Pract. 2020, 216, 153142. [Google Scholar] [CrossRef]
- Annaldas, S.; Saifi, M.A.; Khurana, A.; Godugu, C. Nimbolide ameliorates unilateral ureteral obstruction-induced renal fibrosis by inhibition of TGF-beta and EMT/Slug signalling. Mol. Immunol. 2019, 112, 247–255. [Google Scholar] [CrossRef] [PubMed]
- Luangmonkong, T.; Suriguga, S.; Mutsaers, H.A.M.; Groothuis, G.M.M.; Olinga, P.; Boersema, M. Targeting Oxidative Stress for the Treatment of Liver Fibrosis. Rev. Physiol. Biochem. Pharmacol. 2018, 175, 71–102. [Google Scholar]
- Wan, S.; Luo, F.; Huang, C.; Liu, C.; Luo, Q.; Zhu, X. Ursolic acid reverses liver fibrosis by inhibiting interactive NOX4/ROS and RhoA/ROCK1 signalling pathways. Aging 2020, 12, 10614–10632. [Google Scholar] [CrossRef]
- Gong, Y.; Yang, Y. Activation of Nrf2/AREs-mediated antioxidant signalling, and suppression of profibrotic TGF-beta1/Smad3 pathway: A promising therapeutic strategy for hepatic fibrosis—A review. Life Sci. 2020, 256, 117909. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.; Peng, X.; Zhang, M.; Jia, Y.; Yu, B.; Tian, J. Revisiting Tumors and the Cardiovascular System: Mechanistic Intersections and Divergences in Ferroptosis. Oxid. Med. Cell. Longev. 2020, 2020, 9738143. [Google Scholar] [CrossRef] [PubMed]
- Aleksunes, L.M.; Manautou, J.E. Emerging role of Nrf2 in protecting against hepatic and gastrointestinal disease. Toxicol. Pathol. 2007, 35, 459–473. [Google Scholar] [CrossRef] [PubMed]
- Tsubouchi, K.; Araya, J.; Yoshida, M.; Sakamoto, T.; Koumura, T.; Minagawa, S.; Hara, H.; Hosaka, Y.; Ichikawa, A.; Saito, N.; et al. Involvement of GPx4-Regulated Lipid Peroxidation in Idiopathic Pulmonary Fibrosis Pathogenesis. J. Immunol. 2019, 203, 2076–2087. [Google Scholar] [CrossRef]
- Wang, Y.; Li, C.; Gu, J.; Chen, C.; Duanmu, J.; Miao, J.; Yao, W.; Tao, J.; Tu, M.; Xiong, B.; et al. Celastrol exerts anti-inflammatory effect in liver fibrosis via activation of AMPK-SIRT3 signalling. J. Cell. Mol. Med. 2020, 24, 941–953. [Google Scholar] [CrossRef] [Green Version]
- Ahmad, A.; Ahmad, R. Resveratrol mitigate structural changes and hepatic stellate cell activation in N’-nitrosodimethylamine-induced liver fibrosis via restraining oxidative damage. Chem. Biol. Interact. 2014, 221, 1–12. [Google Scholar] [CrossRef]
- Smeuninx, B.; Boslem, E.; Febbraio, M.A. Current and Future Treatments in the Fight Against Non-Alcoholic Fatty Liver Disease. Cancers 2020, 12, 1714. [Google Scholar] [CrossRef]
- Yu, Y.; Jiang, L.; Wang, H.; Shen, Z.; Cheng, Q.; Zhang, P.; Wang, J.; Wu, Q.; Fang, X.; Duan, L.; et al. Hepatic transferrin plays a role in systemic iron homeostasis and liver ferroptosis. Blood 2020, 136, 726–739. [Google Scholar] [CrossRef] [PubMed]
- Salah, M.M.; Ashour, A.A.; Abdelghany, T.M.; Abdel-Aziz, A.H.; Salama, S.A. Pirfenidone alleviates concanavalin A-induced liver fibrosis in mice. Life Sci. 2019, 239, 116982. [Google Scholar] [CrossRef] [PubMed]
- Poo, J.L.; Torre, A.; Aguilar-Ramirez, J.R.; Cruz, M.; Mejia-Cuan, L.; Cerda, E.; Velázquez, A.; Patiño, A.; Ramírez-Castillo, C.; Cisneros, L.; et al. Benefits of prolonged-release pirfenidone plus standard of care treatment in patients with advanced liver fibrosis: PROMETEO study. Hepatol. Int. 2020, 14, 817–827. [Google Scholar] [CrossRef] [PubMed]
- Luo, X.; Yue, B.; Yu, Z.; Ren, Y.; Zhang, J.; Ren, J.; Wang, Z.; Dou, W. Obacunone Protects Against Ulcerative Colitis in Mice by Modulating Gut Microbiota, Attenuating TLR4/NF-kappaB Signaling Cascades, and Improving Disrupted Epithelial Barriers. Front. Microbiol. 2020, 11, 497. [Google Scholar] [CrossRef]
- Gao, Y.; Hou, R.; Liu, F.; Liu, H.; Fei, Q.; Han, Y.; Cai, R.; Peng, C.; Qi, Y. Obacunone causes sustained expression of MKP-1 thus inactivating p38 MAPK to suppress pro-inflammatory mediators through intracellular MIF. J. Cell. Biochem. 2018, 119, 837–849. [Google Scholar] [CrossRef] [PubMed]
- Zhou, J.; Wang, T.; Wang, H.; Jiang, Y.; Peng, S. Obacunone attenuates high glucose-induced oxidative damage in NRK-52E cells by inhibiting the activity of GSK-3beta. Biochem. Biophys. Res. Commun. 2019, 513, 226–233. [Google Scholar] [CrossRef]
- Murthy, K.N.; Jayaprakasha, G.K.; Patil, B.S. Cytotoxicity of obacunone and obacunone glucoside in human prostate cancer cells involves Akt-mediated programmed cell death. Toxicology 2015, 329, 88–97. [Google Scholar] [CrossRef]
- Xu, S.; Chen, W.; Xie, Q.; Xu, Y. Obacunone activates the Nrf2-dependent antioxidant responses. Protein Cell 2016, 7, 684–688. [Google Scholar] [CrossRef] [Green Version]
- Shin, D.; Kim, E.H.; Lee, J.; Roh, J.L. Nrf2 inhibition reverses resistance to GPX4 inhibitor-induced ferroptosis in head and neck cancer. Free Radic. Biol. Med. 2018, 129, 454–462. [Google Scholar] [CrossRef]
- Guan, Y.; Tan, Y.; Liu, W.; Yang, J.; Wang, D.; Pan, D.; Sun, Y.; Zheng, C. NF-E2-Related Factor 2 Suppresses Intestinal Fibrosis by Inhibiting Reactive Oxygen Species-Dependent TGF-beta1/SMADs Pathway. Dig. Dis. Sci. 2018, 63, 366–380. [Google Scholar] [CrossRef]
- Wang, Z.; Chen, Z.; Li, B.; Zhang, B.; Du, Y.; Liu, Y.; He, Y.; Chen, X. Curcumin attenuates renal interstitial fibrosis of obstructive nephropathy by suppressing epithelial-mesenchymal transition through inhibition of the TLR4/NF-kB and PI3K/AKT signalling pathways. Pharm. Biol. 2020, 58, 828–837. [Google Scholar] [CrossRef] [PubMed]
- Toppo, S.; Flohe, L.; Ursini, F.; Vanin, S.; Maiorino, M. Catalytic mechanisms and specificities of glutathione peroxidases: Variations of a basic scheme. Biochim. Biophys. Acta 2009, 1790, 1486–1500. [Google Scholar] [CrossRef] [PubMed]
- Kim, H.J.; Lee, Y.; Fang, S.; Kim, W.; Kim, H.J.; Kim, J.W. GPx7 ameliorates non-alcoholic steatohepatitis by regulating oxidative stress. BMB Rep. 2020, 53, 317–322. [Google Scholar] [CrossRef] [PubMed]
- Ousingsawat, J.; Schreiber, R.; Kunzelmann, K. TMEM16F/Anoctamin 6 in Ferroptotic Cell Death. Cancers 2019, 11, 625. [Google Scholar] [CrossRef] [Green Version]
- Weber, L.W.; Boll, M.; Stampfl, A. Hepatotoxicity and mechanism of action of haloalkanes: Carbon tetrachloride as a toxicological model. Crit. Rev. Toxicol. 2003, 33, 105–136. [Google Scholar] [CrossRef]
Gene | Forward Primer (5′-3′) | Reverse Primer (5′-3′) |
---|---|---|
α-SMA | CCGACCGAATGCAGAAGGA | ACAGAGTATTTGCGCTCCGAA |
Collagen-1 | CCCGGGTTTCAGAGACAACTTC | TCCACATGCTTTATTCCAGCAATC |
Vimentin | CGGGAGAAATTGCAGGAGGA | AAGGTCAAGACGTGCCAGAG |
IL-6 | GAGTAGTGAGGAACAAGCCAGAG | CTACATTTGCCGAAGAGCC |
CTGF β-Actin | CTG GCG GCT TAC CGA CTG GAGGCACTCTTCCAGCCTTC | GGC TCT GCT TCT CTA GCC TG GGATGTCCACGTCACACTTC |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Bai, Y.; Wang, W.; Wang, L.; Ma, L.; Zhai, D.; Wang, F.; Shi, R.; Liu, C.; Xu, Q.; Chen, G.; et al. Obacunone Attenuates Liver Fibrosis with Enhancing Anti-Oxidant Effects of GPx-4 and Inhibition of EMT. Molecules 2021, 26, 318. https://doi.org/10.3390/molecules26020318
Bai Y, Wang W, Wang L, Ma L, Zhai D, Wang F, Shi R, Liu C, Xu Q, Chen G, et al. Obacunone Attenuates Liver Fibrosis with Enhancing Anti-Oxidant Effects of GPx-4 and Inhibition of EMT. Molecules. 2021; 26(2):318. https://doi.org/10.3390/molecules26020318
Chicago/Turabian StyleBai, Yongquan, Wenwen Wang, Li Wang, Lirong Ma, Dongsheng Zhai, Furong Wang, Rui Shi, Chaoyang Liu, Qing Xu, Guo Chen, and et al. 2021. "Obacunone Attenuates Liver Fibrosis with Enhancing Anti-Oxidant Effects of GPx-4 and Inhibition of EMT" Molecules 26, no. 2: 318. https://doi.org/10.3390/molecules26020318