Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models
Abstract
1. Introduction
2. Results
2.1. GO2KA1 Inhibits Adipocyte Differentiation
2.2. GO2KA1 Decreases the Expression of Adipocyte Differentiation Related Genes
2.3. GO2KA1 Alleviates HFD Induced Obesity in In Vivo Model
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Determination of Cell Viability
4.3. Oil Red O (ORO) Staining
4.4. Quantitative Real-Time PCR
4.5. In Vivo Experimental Design
4.6. Blood Analysis
4.7. Statistical Analysis
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Abbasi, F.; Brown, B.W.; Lamendola, C.; Mclaughlin, T.; Reaven, G.M. Relationship between obesity, insulin resistance, and coronary heart disease risk. J. Am. Coll. Cardiol. 2002, 40, 937–943. [Google Scholar] [CrossRef] [Scilit]
- Eckel, R.H.; Krauss, R.M. American Heart Association call to action: Obesity as a major risk factor for coronary heart disease. Circulation 1998, 97, 2099–2100. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Hall, J.E. Pathophysiology of obesity hypertension. Curr. Hypertens. Rep. 2000, 2, 139–147. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Low, S.; Chin, M.C.; Deurenberg-Yap, M. Review on epidemic of obesity. Ann. Acad. Med. Singap. 2009, 38, 57. [Google Scholar] [PubMed]
- Goldstein, D.J. Beneficial health effects of modest weight loss. Int. J. Obes. Relat. Metab. Disord. 1992, 16, 397–415. [Google Scholar] [PubMed]
- World Health Organization (WHO). Obesity and Overweight. Available online: https://www.who.int/news-room/fact-sheets/detail/obesity-and-overweight (accessed on 27 December 2020).
- Kamel, A.; Abuhegazy, H.; Ismaila, A.; Sherra, K.; Ramadan, M.; Mekky, A.; Nabawy, A.A. The prevalence of obesity in a sample of Egyptian psychiatric patients. Egypt. J. Psychiatry 2016, 37, 157. [Google Scholar] [CrossRef] [Scilit]
- Jo, J.; Gavrilova, O.; Pack, S.; Jou, W.; Mullen, S.; Sumner, A.E.; Cushman, S.W.; Periwal, V. Hypertrophy and/or Hyperplasia: Dynamics of Adipose Tissue Growth. PLoS Comput. Biol. 2009, 5, e1000324. [Google Scholar] [CrossRef] [Scilit]
- Spalding, K.L.; Arner, E.; Westermark, P.O.; Bernard, S.; Buchholz, B.A.; Bergmann, O.; Blomqvist, L.; Hoffstedt, J.; Näslund, E.; Britton, T.; et al. Dynamics of fat cell turnover in humans. Nature 2008, 453, 783–787. [Google Scholar] [CrossRef] [Scilit]
- Gawronska-Kozak, A.; Staszkiewicz, J.; Gimble, J.M.; Kirk-Ballard, H. Recruitment of fat cell precursors during long-term high fat diet in C57BL/6J mice is fat depot specific. Obesity 2014, 22, 1091–1102. [Google Scholar] [CrossRef] [Scilit]
- Caro, J.F.; Dohm, L.G.; Pories, W.J.; Sinha, M.K. Cellular alterations in liver, skeletal muscle, and adipose tissue responsible for insulin resistance in obesity and type II diabetes. Diabetes Metab. Rev. 1989, 5, 665–689. [Google Scholar] [CrossRef] [Scilit]
- Martin, R.J.; Ramsay, T.; Hausman, G.J. Adipocyte development. Pediatr. Ann. 1984, 13, 448–453. [Google Scholar] [PubMed]
- Ali, A.T.; Penny, C.B.; Paiker, J.E.; Niekerk, C.V.; Smit, A.; Ferris, W.F.; Crowther, N.J. Alkaline phosphatase is involved in the control of adipogenesis in the murine preadipocyte cell line, 3T3-L1. Clin. Chim. Acta. 2005, 354, 101–109. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Gregoire, F.M.; Smas, C.M.; Sul, H.S. Understanding adipocyte differentiation. Physiol. Rev. 1998, 78, 783–809. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tong, Q.; Hotamisligil, G.S. Molecular mechanisms of adipocyte differentiation. Rev. Endocr. Metab. Disord. 2001, 2, 349–355. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Ntambi, J.M.; Kim, Y.C. Adipocyte differentiation and gene expression. J. Nutr. 2000, 130, 3122S–3126S. [Google Scholar] [CrossRef] [Scilit]
- Jeon, G.; Choi, Y.; Lee, S.M.; Kim, Y.; Jeong, H.S.; Lee, J. Anti-obesity activity of methanol extract from hot pepper (Capsicum annuum L.) seeds in 3T3-L1 adipocyte. Food Sci. Biotech. 2010, 19, 1123–1127. [Google Scholar] [CrossRef] [Scilit]
- Klop, B.; Elte, J.W.F.; Cabezas, M.C. Dyslipidemia in obesity: Mechanisms and potential targets. Nutrients 2013, 5, 1218–1240. [Google Scholar] [CrossRef] [Scilit]
- Stern, J.H.; Rutkowski, J.M.; Scherer, P.E. Adiponectin, leptin, and fatty acids in the maintenance of metabolic homeostasis through adipose tissue crosstalk. Cell Metab. 2016, 23, 770–784. [Google Scholar] [CrossRef] [Scilit]
- Matsuzawa, Y. Adiponectin: A key player in obesity related disorders. Curr. Pharm. Des. 2010, 16, 1896–1901. [Google Scholar] [CrossRef] [Scilit]
- Chu, S.H.; Lee, M.K.; Ahn, K.Y.; Im, J.A.; Park, M.S.; Lee, D.C.; Jeon, J.Y.; Lee, J.W. Chemerin and Adiponectin Contribute Reciprocally to Metabolic Syndrome. PLoS ONE 2012, 7, e34710. [Google Scholar] [CrossRef] [Scilit]
- Huang, R.; Mendis, E.; Kim, S.K. Improvement of ACE inhibitory activity of chitooligosaccharides (COS) by carboxyl modification. Bioorg. Med. Chem. 2005, 13, 3649–3655. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, M.S.; You, H.J.; You, M.K.; Kim, N.S. Inhibitory Effect of Water-Soluble Chitosan on TNF-α and IL-8 Secretion from HMC-1 Cells. Immunopharm. Immunotoxicol. 2004, 26, 401–409. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xie, W.; Xu, P.; Liu, Q. Antioxidant activity of water-soluble chitosan derivatives. Bioorg. Med. Chem. Lett. 2001, 11, 1699–1701. [Google Scholar] [CrossRef] [Scilit]
- Jo, S.H.; Ha, K.S.; Moon, K.S.; Kim, J.G.; Oh, C.G.; Kim, Y.C.; Apostolidis, E.; Kwon, Y.I. Molecular weight dependent glucose lowering effect of low molecular weight chitosan oligosaccharide (GO2KA1) on postprandial blood glucose level in SD rats model. Int. J. Mol. Sci. 2013, 14, 14214–14224. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kim, J.G.; Jo, S.H.; Ha, K.S.; Kim, S.C.; Kim, Y.C.; Apostolidis, E.; Kwon, Y.I. Effect of long-term supplementation of low molecular weight chitosan oligosaccharide (GO2KA1) on fasting blood glucose and HbA1c in db/db mice model and elucidation of mechanism of action. BMC Complement. Altern. Med. 2014, 14, 272. [Google Scholar] [CrossRef] [Scilit]
- Jo, S.H.; Ha, K.S.; Lee, J.W.; Kim, Y.C.; Apostolidis, E.; Kwon, Y.I. The reduction effect of low molecular weight chitosan oligosaccharide (GO2KA1) on postprandial blood glucose levels in healthy individuals. Food Sci. Biotechnol. 2014, 23, 971–973. [Google Scholar] [CrossRef] [Scilit]
- Kim, H.J.; Ahn, H.Y.; Kwak, J.H.; Shin, D.Y.; Kwon, Y.-I.; Oh, C.-G.; Lee, J.H. The effect of chitosan oligosaccharide (GO2KA1) supplementation on blood glucose control in subjects with prediabetes. Food Funct. 2014, 5, 2662–2669. [Google Scholar] [CrossRef] [Scilit]
- Yu, S.Y.; Kwon, Y.I.; Lee, C.; Apostolidis, E.; Kim, Y.C. Antidiabetic effect of chitosan oligosaccharide (GO2KA1) is mediated via inhibition of intestinal alpha-glucosidase and glucose transporters and PPARγ expression. BioFactors 2017, 43, 90–99. [Google Scholar] [CrossRef] [Scilit]
- Wang, D.; Han, J.; Yu, Y.; Li, X.; Wang, Y.; Tian, H.; Guo, S.; Jin, S.; Luo, T.; Qin, S. Chitosan oligosaccharide decreases very-low-density lipoprotein triglyceride and increases high-density lipoprotein cholesterol in high-fat-diet-fed rats. Exp. Biol. Med. 2011, 236, 1064–1069. [Google Scholar] [CrossRef] [Scilit]
- Otto, T.C.; Lane, M.D. Adipose development: From stem cell to adipocyte. Crit. Rev. Biochem. Mol. Biol. 2005, 40, 229–242. [Google Scholar] [CrossRef] [Scilit]
- Alessi, M.C.; Lijnen, H.R.; Pastelica, D.; Juhan-Vague, I. Adipose tissue and atherothrombosis. Pathophysiol. Haemost. Thromb. 2003, 33, 290–297. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Tang, Q.Q.; Otto, T.C.; Lane, M.D. CCAAT/enhancer-binding protein beta is required for mitotic clonal expansion during adipogenesis. Proc. Natl. Acad. Sci. USA 2003, 100, 850–855. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Farmer, S.R. Transcriptional control of adipocyte formation. Cell Metab. 2006, 4, 263–273. [Google Scholar] [CrossRef] [Scilit] [PubMed]





| Control | GO2KA1 | |
|---|---|---|
| Initial body weight (g) | 187.8 ± 8.13 | 187.2 ± 7.84 |
| Body weight (g) | 398.7 ± 23.4 | 372.0 ± 10.1 * |
| Body weight gaining (g) | 211.67 ± 20.18 | 185.89 ± 8.89 * |
| Triglyceride (mg/dL) | 66.0 ± 18.2 | 40.0 ± 4.6 ** |
| Total Cholesterol (mg/dL) | 98.2 ± 19.4 | 79.2 ± 12.5 * |
| HDL (mg/dL) | 17.6 ± 5.7 | 56.3 ± 10.9 *** |
| LDL (mg/dL) | 53.1 ± 11.7 | 22.3 ± 13.1 *** |
| AST (GOT, IU/L) | 46.4 ± 21.7 | 28.7 ± 2.1 * |
| ALT (GPT, IU/L) | 55.9 ± 7.6 | 43.8 ± 5.2 ** |
| Adiponectin (μg/mL) | 14.3 ± 2.3 | 21.4 ± 3.5 ** |
| Genes | Primer Sequences | |
|---|---|---|
| Accession Number | Forward (5′-3′) | Reverse (5′-3′) |
| GAPDH | CGTCCCGTAGACAAAATGGT | TTGATGGCAACAATCTCCAC |
| NM_008084 | ||
| PPARγ | GAAAGACAACGGACAAATCACC | GGGGGTGATATGTTTGAACTTG |
| NM_011146 | ||
| C/EBPα | TTGTTTGGCTTTATCTCGGC | CCAAGAAGTCGGTGGACAAG |
| NM_007678 | ||
| FABP4 | AGCCTTTCTCACCTGGAAGA | TTGTGGCAAAGCCCATC |
| NM_024406 | ||
| FAS | TGATGTGGAACACAGCAAGG | GGCTGTGGTGACTCTTAGTGATAA |
| NM_007988 | ||
| LPL | GGACGGTAACGGGAATGTATGA | TGACATTGGAGTCAGGTTCTCTCT |
| NM_008509 | ||
| High Fat Diets (g/kg) | |
|---|---|
| Corn starch | 321 |
| Sucrose | 100 |
| Casein | 200 |
| Corn oil | 100 |
| Lard | 200 |
| Cellulose | 30 |
| DL-methionine | 2 |
| Vitamin mix (1) | 10 |
| Mineral mix (2) | 35 |
| Choline bitartrate | 2 |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Lee, J.-Y.; Kim, T.Y.; Kang, H.; Oh, J.; Park, J.W.; Kim, S.-C.; Kim, M.; Apostolidis, E.; Kim, Y.-C.; Kwon, Y.-I. Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models. Molecules 2021, 26, 331. https://doi.org/10.3390/molecules26020331
Lee J-Y, Kim TY, Kang H, Oh J, Park JW, Kim S-C, Kim M, Apostolidis E, Kim Y-C, Kwon Y-I. Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models. Molecules. 2021; 26(2):331. https://doi.org/10.3390/molecules26020331
Chicago/Turabian StyleLee, Jung-Yun, Tae Yang Kim, Hanna Kang, Jungbae Oh, Joo Woong Park, Se-Chan Kim, Minjoo Kim, Emmanouil Apostolidis, Young-Cheul Kim, and Young-In Kwon. 2021. "Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models" Molecules 26, no. 2: 331. https://doi.org/10.3390/molecules26020331
APA StyleLee, J.-Y., Kim, T. Y., Kang, H., Oh, J., Park, J. W., Kim, S.-C., Kim, M., Apostolidis, E., Kim, Y.-C., & Kwon, Y.-I. (2021). Anti-Obesity and Anti-Adipogenic Effects of Chitosan Oligosaccharide (GO2KA1) in SD Rats and in 3T3-L1 Preadipocytes Models. Molecules, 26(2), 331. https://doi.org/10.3390/molecules26020331

