Polyamines Upregulate Cephalosporin C Production and Expression of β-Lactam Biosynthetic Genes in High-Yielding Acremonium chrysogenum Strain
Abstract
:1. Introduction
2. Results
2.1. Effect of PAs on A. chrysogenum Strains on an Agarized Medium
2.1.1. Growth of A. chrysogenum WT and HY Strains on an Agarized Complex Medium
2.1.2. Effect of PAs on the Coloration of A. chrysogenum Strains on a CPA Medium
2.1.3. Effect of PAs on Germination and Size of A. chrysogenum Colonies on CPA Medium
2.2. Submerged Fermentation of A. chrysogenum HY Strain with Exogenous PAs
2.2.1. Optimization of Cultivation A. chrysogenum HY Strain with PA to Increase CPC Production
2.2.2. Effect of the Addition of 5 mM PAs on CPC Production, Biomass, and Specific CPC Yield during Submerged Fermentation of A. chrysogenum HY
2.3. Analysis of the CPC Production and Expression Level of the Corresponding Biosynthetic Genes in the A. chrysogenum HY Strain after the Addition of Exogenous PAs during Fermentation
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Strains of Microorganisms
4.3. Cultivation of A. chrysogenum Strains on Agarized Media with PAs
4.4. Submerged Fermentation of A. chrysogenum HY Strain with Exogenous PAs
4.5. Determination of Dry Biomass
4.6. HPLC Analysis of Beta-Lactams
4.7. Preparation of Total RNA and cDNA Synthesis and qPCR Analysis
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Singh, A.K.; Rana, H.K.; Pandey, A.K. Fungal-Derived Natural Product: Synthesis, Function, and Applications; Springer: New York, NY, US, 2019; pp. 229–248. [Google Scholar] [CrossRef]
- Zhgun, A.; Dumina, M.; Valiakhmetov, A.; Eldarov, M. The critical role of plasma membrane H+-ATPase activity in cephalosporin C biosynthesis of Acremonium chrysogenum. PLoS ONE 2020, 15, e0238452. [Google Scholar] [CrossRef]
- Zhgun, A.A.; Dumina, M.V.; Voinova, T.M.; Dzhavakhiya, V.V.; Eldarov, M.A. Role of acetyl-CoA Synthetase and LovE Regulator Protein of Polyketide Biosynthesis in Lovastatin Production by Wild-Type and Overproducing Aspergillus terreus Strains. Appl. Biochem. Microbiol. 2018, 54, 188–197. [Google Scholar] [CrossRef]
- Domratcheva, A.G.; Zhgun, A.A.; Novak, N.V.; Dzhavakhiya, V.V. The Influence of Chemical Mutagenesis on the Properties of the Cyclosporine a High-Producer Strain Tolypocladium inflatum VKM F-3630D. Appl. Biochem. Microbiol. 2018, 54, 53–57. [Google Scholar] [CrossRef]
- Cephalosporin Market Size, Share, Growth, Trends and Forecast 2021–2026. Available online: https://www.imarcgroup.com/cephalosporin-market (accessed on 8 October 2021).
- Rodriguez-Herrera, R.; Puc, L.E.C.; Sobrevilla, J.M.V.; Luque, D.; Cardona-Felix, C.S.; Aguilar-González, C.N.; Flores-Gallegos, A.C. Enzymes in the Pharmaceutical Industry for β-Lactam Antibiotic Production. In Enzymes in Food Biotechnology. Production, Applications, and Future Prospects; Kuddus, M., Ed.; Academic Press: Cambridge, MA, USA, 2019; pp. 627–643. [Google Scholar] [CrossRef]
- Toai, B.; Preuss, C.V. Cephalosporins; StatPearls: Treasure Island, FL, USA, 2021. [Google Scholar]
- Elander, R.P. Industrial production of β-lactam antibiotics. Appl. Microbiol. Biotechnol. 2003, 61, 385–392. [Google Scholar] [CrossRef] [PubMed]
- Liu, Y.; Gong, G.; Xie, L.; Yuan, N.; Zhu, C.; Zhu, B.; Hu, Y. Improvement of Cephalosporin C Production by Recombinant DNA Integration in Acremonium chrysogenum. Mol. Biotechnol. 2010, 44, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Martín, J.F.; Ullán, R.V.; García-Estrada, C. Regulation and compartmentalization of β-lactam biosynthesis. Microb. Biotechnol. 2010, 3, 285–299. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bartoshevich, Y.; Novak, M.; Domratcheva, A.; Skrybin, K. Method of Cephalosporin C Biosynthesis by Using New Acremonium chrysogenum Strain RNCM NO F-4081D. Patent RU 2426793, 20 August 2011. [Google Scholar]
- Dumina, M.V.; Zhgun, A.A.; Domracheva, A.G.; Novak, M.I.; El’darov, M.A. Chromosomal polymorphism of Acremonium chrysogenum strains producing cephalosporin C. Russ. J. Genet. 2012, 48, 778–784. [Google Scholar] [CrossRef]
- Dumina, M.V.; Zhgun, A.A.; Novak, M.I.; Domratcheva, A.G.; Petukhov, D.V.; Dzhavakhiya, V.V.; Eldarov, M.A.; Bartoshevitch, I.E. Comparative gene expression profiling reveals key changes in expression levels of cephalosporin C biosynthesis and transport genes between low and high-producing strains of Acremonium chrysogenum. World J. Microbiol. Biotechnol. 2014, 30, 2933–2941. [Google Scholar] [CrossRef]
- Zhgun, A.A.; Ivanova, M.A.; Domracheva, A.G.; Novak, M.I.; Elidarov, M.A.; Skryabin, K.G.; Bartoshevich, Y.E. Genetic transformation of the mycelium fungi Acremonium chrysogenum. Appl. Biochem. Microbiol. 2008, 44, 600–607. [Google Scholar] [CrossRef]
- Dumina, M.V.; Zhgun, A.A.; Kerpichnikov, I.V.; Domracheva, A.G.; Novak, M.I.; Valiachmetov, A.Y.; Knorre, D.A.; Severin, F.F.; Eldarov, M.A.; Bartoshevich, Y.E. Functional analysis of MFS protein CefT involved in the transport of beta-lactam antibiotics in Acremonium chrysogenum and Saccharomyces cerevisiae. Appl. Biochem. Microbiol. 2013, 49, 368–377. [Google Scholar] [CrossRef]
- Valiakhmetov, A.Y.; Trilisenko, L.V.; Vagabov, V.M.; Bartoshevich, Y.E.; Kulaev, I.S.; Novak, M.I.; Domracheva, A.G.; El’darov, M.A.; Skryabin, K.G. The concentration dynamics of inorganic polyphosphates during the cephalosporin C synthesis by Acremonium chrysogenum. Appl. Biochem. Microbiol. 2010, 46, 184–190. [Google Scholar] [CrossRef]
- Kalebina, T.S.; Selyakh, I.O.; Gorkovskii, A.A.; Bezsonov, E.E.; El’darov, M.A.; Novak, M.I.; Domracheva, A.G.; Bartoshevich, Y.E. Structure peculiarities of cell walls of Acremonium chrysogenum-an autotroph of cephalosporin C. Appl. Biochem. Microbiol. 2010, 46, 614–619. [Google Scholar] [CrossRef]
- Hyvönen, M.T.; Keinänen, T.A.; Nuraeva, G.K.; Yanvarev, D.V.; Khomutov, M.; Khurs, E.N.; Kochetkov, S.N.; Vepsäläinen, J.; Zhgun, A.A.; Khomutov, A.R. Hydroxylamine analogue of agmatine: Magic bullet for arginine decarboxylase. Biomolecules 2020, 10, 406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Valdés-Santiago, L.; Ruiz-Herrera, J. Stress and polyamine metabolism in fungi. Front. Chem. 2013, 1, 42. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ruiz-Herrera, J. Polyamines, DNA methylation, and fungal differentiation. Crit. Rev. Microbiol. 1994, 20, 143–150. [Google Scholar] [CrossRef]
- Guevara-Olvera, L.; Calvo-Mendez, C.; Ruiz-Herrera, J. The role of polyamine metabolism in dimorphism of Yarrowia lipolytica. J. Gen. Microbiol. 1993, 139, 485–493. [Google Scholar] [CrossRef] [Green Version]
- Dorighetto Cogo, A.J.; Dutra Ferreira, K.d.R.; Okorokov, L.A.; Ramos, A.C.; Façanha, A.R.; Okorokova-Façanha, A.L. Spermine modulates fungal morphogenesis and activates plasma membrane H+ -ATPase during yeast to hyphae transition. Biol. Open 2018, 7, bio029660. [Google Scholar] [CrossRef] [Green Version]
- Valdés-Santiago, L.; Cervantes-Chávez, J.A.; León-Ramírez, C.G.; Ruiz-Herrera, J. Polyamine Metabolism in Fungi with Emphasis on Phytopathogenic Species. J. Amino Acids 2012, 2012, 837932. [Google Scholar] [CrossRef] [Green Version]
- Nambeesan, S.; AbuQamar, S.; Laluk, K.; Mattoo, A.K.; Mickelbart, M.V.; Ferruzzi, M.G.; Mengiste, T.; Handa, A.K. Polyamines Attenuate Ethylene-Mediated Defense Responses to Abrogate Resistance to Botrytis cinerea in Tomato. Plant Physiol. 2012, 158, 1034. [Google Scholar] [CrossRef] [Green Version]
- Rocha, R.O.; Wilson, R.A. Essential, deadly, enigmatic: Polyamine metabolism and roles in fungal cells. Fungal Biol. Rev. 2019, 33, 47–57. [Google Scholar] [CrossRef]
- Valdés-Santiago, L.; Ruiz-Herrera, J. Polyamines in Fungi: Their Distribution, Metabolism, and Role in Cell Differentiation and Morphogenesis. Polyam. Fungi Their Distrib. Metab. Role Cell Differ. Morphog. 2015, 17, 1–186. [Google Scholar] [CrossRef]
- Martín, J.; García-Estrada, C.; Kosalková, K.; Ullán, R.V.; Albillos, S.M.; Martín, J.-F. The inducers 1,3-diaminopropane and spermidine produce a drastic increase in the expression of the penicillin biosynthetic genes for prolonged time, mediated by the LaeA regulator. Fungal Genet. Biol. 2012, 49, 1004–1013. [Google Scholar] [CrossRef]
- Zhgun, A.A.; Nuraeva, G.K.; Dumina, M.V.; Voinova, T.M.; Dzhavakhiya, V.V.; Eldarov, M.A. 1,3-Diaminopropane and Spermidine Upregulate Lovastatin Production and Expression of Lovastatin Biosynthetic Genes in Aspergillus terreus via LaeA Regulation. Appl. Biochem. Microbiol. 2019, 55, 243–254. [Google Scholar] [CrossRef]
- Martín, J.F. Key role of LaeA and velvet complex proteins on expression of β-lactam and PR-toxin genes in Penicillium chrysogenum: Cross-talk regulation of secondary metabolite pathways. J. Ind. Microbiol. Biotechnol. 2017, 44, 525–535. [Google Scholar] [CrossRef]
- Zhgun, A.A.; Nuraeva, G.K.; Eldarov, M.A. The Role of LaeA and LovE Regulators in Lovastatin Biosynthesis with Exogenous Polyamines in Aspergillus terreus. Appl. Biochem. Microbiol. 2019, 55, 639–648. [Google Scholar] [CrossRef]
- Strauss, J.; Reyes-Dominguez, Y. Regulation of secondary metabolism by chromatin structure and epigenetic codes. Fungal Genet. Biol. 2011, 48, 62–69. [Google Scholar] [CrossRef] [Green Version]
- Gerke, J.; Braus, G.H. Manipulation of fungal development as source of novel secondary metabolites for biotechnology. Appl. Microbiol. Biotechnol. 2014, 98, 8443. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ahmed, Y.; Gerke, J.; Park, H.; Bayram, Ö.; Neumann, P.; Ni, M.; Dickmanns, A.; Kim, S.; Yu, J.; Braus, G.; et al. The velvet family of fungal regulators contains a DNA-binding domain structurally similar to NF-κB. PLoS Biol. 2013, 11, e1001750. [Google Scholar] [CrossRef] [Green Version]
- Bayram, Ö.S.; Bayram, Ö.; Valerius, O.; Park, H.S.; Irniger, S.; Gerke, J.; Ni, M.; Han, K.-H.; Yu, J.-H.; Braus, G.H. LaeA Control of Velvet Family Regulatory Proteins for Light-Dependent Development and Fungal Cell-Type Specificity. PLoS Genet. 2010, 6, e1001226. [Google Scholar] [CrossRef] [Green Version]
- Calvo, A.M.; Lohmar, J.M.; Ibarra, B.; Satterlee, T. Velvet Regulation of Fungal Development. In Growth, Differentiation and Sexuality; Wendland, J., Ed.; Springer: New York, NY, USA, 2016; pp. 475–497. [Google Scholar] [CrossRef]
- Wang, R.; Leng, Y.; Shrestha, S.; Zhong, S. Coordinated and independent functions of velvet-complex genes in fungal development and virulence of the fungal cereal pathogen Cochliobolus sativus. Fungal Biol. 2016, 120, 948–960. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sarikaya-Bayram, Ö.; Palmer, J.M.; Keller, N.; Braus, G.H.; Bayram, Ö. One Juliet and four Romeos: VeA and its methyltransferases. Front. Microbiol. 2015, 6, 1. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lind, A.L.; Smith, T.D.; Saterlee, T.; Calvo, A.M.; Rokas, A. Regulation of secondary metabolism by the velvet complex is temperature-responsive in aspergillus. G3 Genes Genomes Genet. 2016, 6, 4023–4033. [Google Scholar] [CrossRef] [Green Version]
- Bayram, Ö.S.; Dettmann, A.; Karahoda, B.; Moloney, N.M.; Ormsby, T.; McGowan, J.; Cea-Sánchez, S.; Miralles-Durán, A.; Brancini, G.T.P.; Luque, E.M.; et al. Control of Development, Secondary Metabolism and Light-Dependent Carotenoid Biosynthesis by the Velvet Complex of Neurospora crassa. Genetics 2019, 212, 691–710. [Google Scholar] [CrossRef]
- Calvo, A.M.; Cary, J.W. Association of fungal secondary metabolism and sclerotial biology. Front. Microbiol. 2015, 6, 62. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Collemare, J.; Seidl, M.F. Chromatin-dependent regulation of secondary metabolite biosynthesis in fungi: Is the picture complete? FEMS Microbiol. Rev. 2019, 43, 591–607. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Keller, N.P. Fungal secondary metabolism: Regulation, function and drug discovery. Nat. Rev. Microbiol. 2019, 17, 167–180. [Google Scholar] [CrossRef] [PubMed]
- Chen, G.; Chu, J. Characterization of Two Polyketide Synthases Involved in Sorbicillinoid Biosynthesis by Acremonium chrysogenum Using the CRISPR/Cas9 System. Appl. Biochem. Biotechnol. 2019, 188, 1134–1144. [Google Scholar] [CrossRef]
- Zhgun, A.; Avdanina, D.; Shumikhin, K.; Simonenko, N.; Lyubavskaya, E.; Volkov, I.; Ivanov, V. Detection of potential biodeterioration risks for tempera painting in 16th century exhibits from State Tretyakov Gallery. PLoS ONE 2020, 15, e0230591. [Google Scholar] [CrossRef]
- Barrios-González, J.; Baños, J.G.; Covarrubias, A.A.; Garay-Arroyo, A. Lovastatin biosynthetic genes of Aspergillus terreus are expressed differentially in solid-state and in liquid submerged fermentation. Appl. Microbiol. Biotechnol. 2008, 79, 179–186. [Google Scholar] [CrossRef] [PubMed]
- Miranda, R.U.; Gómez-Quiroz, L.E.; Mejía, A.; Barrios-González, J. Oxidative state in idiophase links reactive oxygen species (ROS) and lovastatin biosynthesis: Differences and similarities in submerged- and solid-state fermentations. Fungal Biol. 2013, 117, 85–93. [Google Scholar] [CrossRef] [PubMed]
- Miranda, R.U.; Gómez-Quiroz, L.E.; Mendoza, M.; Pérez-Sánchez, A.; Fierro, F.; Barrios-González, J. Reactive oxygen species regulate lovastatin biosynthesis in Aspergillus terreus during submerged and solid-state fermentations. Fungal Biol. 2014, 118, 979–989. [Google Scholar] [CrossRef] [PubMed]
- Demain, A.L. Regulation of secondary metabolism in fungi. Pure Appl. Chem. 1986, 58, 219–226. [Google Scholar] [CrossRef]
- Terfehr, D.; Dahlmann, T.A.; Kück, U. Transcriptome analysis of the two unrelated fungal β-lactam producers Acremonium chrysogenum and Penicillium chrysogenum: Velvet-regulated genes are major targets during conventional strain improvement programs. BMC Genom. 2017, 18, 272. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Salo, O.V.; Ries, M.; Medema, M.H.; Lankhorst, P.P.; Vreeken, R.J.; Bovenberg, R.A.L.; Driessen, A.J.M. Genomic mutational analysis of the impact of the classical strain improvement program on β-lactam producing Penicillium chrysogenum. BMC Genom. 2015, 16, 937. [Google Scholar] [CrossRef] [Green Version]
- Zhgun, A.A.; Nuraeva, G.K.; Volkov, I.A. High-yielding lovastatin producer aspergillus terreus shows increased resistance to inhibitors of polyamine biosynthesis. Appl. Sci. 2020, 10, 8290. [Google Scholar] [CrossRef]
- Gutiérrez, S.; Velasco, J.; Marcos, A.T.; Fernández, F.J.; Fierro, F.; Barredo, J.L.; Díez, B.; Martín, J.F. Expression of the the cefG gene is limiting for cephalosporin biosynthesis in Acremonium chrysogenum. Appl. Microbiol. Biotechnol. 1997, 48, 606–614. [Google Scholar] [CrossRef] [PubMed]
- Newton, G.G.; Abraham, E.P. Isolation of cephalosporin C, a penicillin-like antibiotic containing D-alpha-aminoadipic acid. Biochem. J. 1956, 62, 651–658. [Google Scholar] [CrossRef]







| Primer | Gene | Product, Function | Oligonucleotide (Sequence 5 → 3) | Source Sequence |
|---|---|---|---|---|
| actq1 | act1 | γ-actin, a major component of the cytoskeleton | CCGGTTTCGCCGGTGATGATGCT | JN836733.1 [15] |
| actq2 | TGCTCAATGGGGTAGCGCAG | |||
| pcbABq3 | pcbAB | δ-(l-α-aminoadipyl)-l-systeinyl-d-valine synthetase | AGGCATCGTCAGGTTGGCCG | E05192.1 [13] |
| pcbABq4 | CCGGAGGGGCCATACCACAT | |||
| pcbCq1 | pcbC | isopenicillin N-synthase | CTAGGTCGCGACGAGGACTTCT | M33522.1 [13] |
| pcbCq2 | CACGTCGGACTGGTACAACACC | |||
| cefD1q1 | cefD1 | isopenicillin N-CoA synthetase | CCCCGGTGAGGAAGATGCGT | AJ507632.2 [13] |
| cefD1q2 | TCGATCTCCGCCTTGGACGC | |||
| cefD2q1 | cefD2 | isopenicillin N-CoA epimerase | ACAGGATGGAGAGGAGCACCTTG | |
| cefD2q2 | TCGTAGAGCTCGCGGGGCTA | |||
| cefEFq3 | cefEF | deacetoxycephalosporin C synthetase/hydroxylase | GTCGAGTGCGATCCCCTCCT | AJ404737.1 [2] |
| cefEFq4 | CGAATTCTCCGTCCACCTCG | |||
| cefGq3 | cefG | deacetylcephalosporin-C acetyltransferase | ATCTCAGTCTCCGAAGCGTCCTGG | M91649.1 [2] |
| cefGq4 | CGAGGATTTGTGACCGACATAAGTGG |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2021 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhgun, A.A.; Eldarov, M.A. Polyamines Upregulate Cephalosporin C Production and Expression of β-Lactam Biosynthetic Genes in High-Yielding Acremonium chrysogenum Strain. Molecules 2021, 26, 6636. https://doi.org/10.3390/molecules26216636
Zhgun AA, Eldarov MA. Polyamines Upregulate Cephalosporin C Production and Expression of β-Lactam Biosynthetic Genes in High-Yielding Acremonium chrysogenum Strain. Molecules. 2021; 26(21):6636. https://doi.org/10.3390/molecules26216636
Chicago/Turabian StyleZhgun, Alexander A., and Mikhail A. Eldarov. 2021. "Polyamines Upregulate Cephalosporin C Production and Expression of β-Lactam Biosynthetic Genes in High-Yielding Acremonium chrysogenum Strain" Molecules 26, no. 21: 6636. https://doi.org/10.3390/molecules26216636
APA StyleZhgun, A. A., & Eldarov, M. A. (2021). Polyamines Upregulate Cephalosporin C Production and Expression of β-Lactam Biosynthetic Genes in High-Yielding Acremonium chrysogenum Strain. Molecules, 26(21), 6636. https://doi.org/10.3390/molecules26216636

