Effect of Moringa oleifera Leaf Extract on Excision Wound Infections in Rats: Antioxidant, Antimicrobial, and Gene Expression Analysis
Abstract
:1. Introduction
2. Results
2.1. Phytochemical Analysis
2.2. Physicochemical Properties of the Extract
2.3. Antibacterial Activity
2.4. Wound Healing and Epithelization
2.5. Skin Irritation Study
2.6. Cytotoxicity and Gene Expression Studies on HaCaT Cells
3. Discussion
4. Materials and Methods
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
References
- Van de Velde, F.; Esposito, D.; Grace, M.H.; Pirovani, M.E.; Lila, M.A. Anti-Inflammatory and Wound Healing Properties of Polyphenolic Extracts from Strawberry and Blackberry Fruits. Food Res. Int. 2019, 121, 453–462. [Google Scholar] [CrossRef] [PubMed]
- Ekom, S.E.; Tamokou, J.D.D.; Kuete, V. Methanol Extract from the Seeds of Persea Americana Displays Antibacterial and Wound Healing Activities in Rat Model. J. Ethnopharmacol. 2022, 282, 114573. [Google Scholar] [CrossRef] [PubMed]
- Hemmati, A.A.; Larki-Harchegani, A.; Shabib, S.; Jalali, A.; Rezaei, A.; Housmand, G. Wound Healing Property of Milk in Full Thickness Wound Model of Rabbit. Int. J. Surg. 2018, 54, 133–140. [Google Scholar] [CrossRef] [PubMed]
- Arora, S.; Arora, S. Nutritional Significance and Therapeutic Potential of Moringa Oleifera: The Wonder Plant. J. Food Biochem. 2021, 45, e13933. [Google Scholar] [CrossRef]
- Stohs, S.J.; Hartman, M.J. Review of the Safety and Efficacy of Moringa Oleifera. Phyther. Res. 2015, 29, 796–804. [Google Scholar] [CrossRef]
- Azevedo, Í.M.; Araújo-Filho, I.; Teixeira, M.M.A.; Moreira, M.D.F.C.; Medeiros, A.C. Wound Healing of Diabetic Rats Treated with Moringa Oleifera Extract. Acta Cirúrgica Bras. 2018, 33, 799–805. [Google Scholar] [CrossRef]
- Rani, N.Z.A.; Husain, K.; Kumolosasi, E. Moringa Genus: A Review of Phytochemistry and Pharmacology. Front. Pharmacol. 2018, 9, 108. [Google Scholar] [CrossRef] [Green Version]
- Fayemi, O.E.; Ekennia, A.C.; Katata-Seru, L.; Ebokaiwe, A.P.; Ijomone, O.M.; Onwudiwe, D.C.; Ebenso, E.E. Antimicrobial and Wound Healing Properties of Polyacrylonitrile-Moringa Extract Nanofibers. ACS Omega 2018, 3, 4791–4797. [Google Scholar] [CrossRef]
- Kou, X.; Li, B.; Olayanju, J.B.; Drake, J.M.; Chen, N. Nutraceutical or Pharmacological Potential of Moringa Oleifera Lam. Nutrients 2018, 10, 343. [Google Scholar] [CrossRef] [Green Version]
- Aibuedefe, E.O.; Udogadi, N.S.; Hakeem, S.O. Characterisation of the Prevailing Multidrug Pseudomonas Aeruginosa Strains from Surgical Wound Using 16s RRNA Sequencing Technique. Malays. J. Med. Sci. 2021, 28, 37–49. [Google Scholar] [CrossRef]
- Peterson, E.; Kaur, P. Antibiotic Resistance Mechanisms in Bacteria: Relationships between Resistance Determinants of Antibiotic Producers, Environmental Bacteria, and Clinical Pathogens. Front. Microbiol. 2018, 9, 2928. [Google Scholar] [CrossRef] [PubMed]
- Sabat, A.J.; Pantano, D.; Akkerboom, V.; Bathoorn, E.; Friedrich, A.W. Pseudomonas Aeruginosa and Staphylococcus Aureus Virulence Factors as Biomarkers of Infection. Biol. Chem. 2021, 402, 1565–1573. [Google Scholar] [CrossRef] [PubMed]
- Serra, R.; Grande, R.; Butrico, L.; Rossi, A.; Settimio, U.F.; Caroleo, B.; Amato, B.; Gallelli, L.; De Franciscis, S. Chronic Wound Infections: The Role of Pseudomonas Aeruginosa and Staphylococcus Aureus. Expert Rev. Anti-Infect. Ther. 2015, 13, 605–613. [Google Scholar] [CrossRef]
- Falcone, M.; De Angelis, B.; Pea, F.; Scalise, A.; Stefani, S.; Tasinato, R.; Zanetti, O.; Dalla Paola, L. Challenges in the Management of Chronic Wound Infections. J. Glob. Antimicrob. Resist. 2021, 26, 140–147. [Google Scholar] [CrossRef] [PubMed]
- Tzaneva, V.; Mladenova, I.; Todorova, G.; Petkov, D. Antibiotic Treatment and Resistance in Chronic Wounds of Vascular Origin. Clujul Med. 2016, 89, 365. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Guan, H.; Dong, W.; Lu, Y.; Jiang, M.; Zhang, D.; Aobuliaximu, Y.; Dong, J.; Niu, Y.; Liu, Y.; Guan, B.; et al. Distribution and Antibiotic Resistance Patterns of Pathogenic Bacteria in Patients With Chronic Cutaneous Wounds in China. Front. Med. 2021, 8, 274. [Google Scholar] [CrossRef] [PubMed]
- Oliveira, A.; Simões, S.; Ascenso, A.; Reis, C.P. Therapeutic Advances in Wound Healing. J. Dermatolog. Treat. 2022, 33, 2–22. [Google Scholar] [CrossRef]
- Sharma, A.; Khanna, S.; Kaur, G.; Singh, I. Medicinal Plants and Their Components for Wound Healing Applications. Future J. Pharm. Sci. 2021, 7, 53. [Google Scholar] [CrossRef]
- Al-Ghanayem, A.A.; Alhussaini, M.S.; Asad, M.; Joseph, B. Moringa Oleifera Leaf Extract Promotes Healing of Infected Wounds in Diabetic Rats: Evidence of Antimicrobial, Antioxidant and Proliferative Properties. Pharmaceuticals 2022, 15, 528. [Google Scholar] [CrossRef]
- Guo, X.; Chen, X.; Li, L.; Shen, Z.; Wang, X.; Zheng, P.; Duan, F.; Ma, Y.; Bi, K. LC-MS Determination and Pharmacokinetic Study of Six Phenolic Components in Rat Plasma after Taking Traditional Chinese Medicinal-Preparation: Guanxinning Lyophilized Powder for Injection. J. Chromatogr. B Anal. Technol. Biomed. Life Sci. 2008, 873, 51–58. [Google Scholar] [CrossRef]
- Cheenpracha, S.; Park, E.J.; Yoshida, W.Y.; Barit, C.; Wall, M.; Pezzuto, J.M.; Chang, L.C. Potential Anti-Inflammatory Phenolic Glycosides from the Medicinal Plant Moringa Oleifera Fruits. Bioorg. Med. Chem. 2010, 18, 6598–6602. [Google Scholar] [CrossRef] [PubMed]
- Leone, A.; Fiorillo, G.; Criscuoli, F.; Ravasenghi, S.; Santagostini, L.; Fico, G.; Spadafranca, A.; Battezzati, A.; Schiraldi, A.; Pozzi, F.; et al. Nutritional Characterization and Phenolic Profiling of Moringa Oleifera Leaves Grown in Chad, Sahrawi Refugee Camps, and Haiti. Int. J. Mol. Sci. 2015, 16, 18923–18937. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Li, F.H.; Wang, H.Q.; Su, X.M.; Li, C.K.; Li, B.M.; Chen, R.Y.; Kang, J. [Constituents Isolated from n-Butanol Extract of Leaves of Moringa Oleifera]. Zhongguo Zhong Yao Za Zhi 2018, 43, 114–118. [Google Scholar] [CrossRef] [PubMed]
- Vongsak, B.; Sithisarn, P.; Gritsanapan, W. Simultaneous HPLC Quantitative Analysis of Active Compounds in Leaves of Moringa Oleifera Lam. J. Chromatogr. Sci. 2014, 52, 641–645. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhu, S.; Yan, H.; Niu, K.; Zhang, S. Simultaneous Determination of Seven Components from Hawthorn Leaves Flavonoids in Rat Plasma by LC-MS/MS. J. Chromatogr. Sci. 2015, 53, 909–914. [Google Scholar] [CrossRef] [Green Version]
- He, C.M.; Cheng, Z.H.; Chen, D.F. Qualitative and Quantitative Analysis of Flavonoids in Sophora Tonkinensis by LC/MS and HPLC. Chin. J. Nat. Med. 2013, 11, 690–698. [Google Scholar] [CrossRef] [PubMed]
- Rathi, B.S.; Bodhankar, S.L.; Baheti, A.M. Evaluation of Aqueous Leaves Extract of Moringa Oleifera Linn for Wound Healing in Albino Rats. Indian J. Exp. Biol. 2006, 44, 898–901. [Google Scholar] [PubMed]
- Eyarefe, O.D.; Idowu, A.; Afolabi, J.M. Healing Potentials of Oral Moringa Oleifera Leaves Extract and Tetracycline on Methicillin Resistant Staphylococcus Aureus Infected Wounds of Wistar Rats. Niger. J. Physiol. Sci. 2015, 30, 073–078. [Google Scholar]
- Bagheri, G.; Martorell, M.; Ramírez-Alarcón, K.; Salehi, B.; Sharifi-Rad, J. Phytochemical Screening of Moringa Oleifera Leaf Extracts and Their Antimicrobial Activities. Cell. Mol. Biol. 2020, 66, 20–26. [Google Scholar] [CrossRef]
- Milla, P.G.; Peñalver, R.; Nieto, G. Health Benefits of Uses and Applications of Moringa Oleifera in Bakery Products. Plants 2021, 10, 318. [Google Scholar] [CrossRef]
- Ajibade, T.O.; Arowolo, R.; Olayemi, F.O. Phytochemical Screening and Toxicity Studies on the Methanol Extract of the Seeds of Moringa Oleifera. J. Complement. Integr. Med. 2013, 10, 11–16. [Google Scholar] [CrossRef] [PubMed]
- Emulsifying Ointment BP-Summary of Product Characteristics (SmPC)-(Emc). Available online: https://www.medicines.org.uk/emc/product/4571/smpc#gref (accessed on 14 March 2022).
- Badia, J.M.; Casey, A.L.; Petrosillo, N.; Hudson, P.M.; Mitchell, S.A.; Crosby, C. Impact of Surgical Site Infection on Healthcare Costs and Patient Outcomes: A Systematic Review in Six European Countries. J. Hosp. Infect. 2017, 96, 1–15. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gil, J.; Pastar, I.; Houghten, R.A.; Padhee, S.; Higa, A.; Solis, M.; Valdez, J.; Head, C.R.; Michaels, H.; Lenhart, B.; et al. Novel Cyclic Lipopeptides Fusaricidin Analogs for Treating Wound Infections. Front. Microbiol. 2021, 12, 708904. [Google Scholar] [CrossRef] [PubMed]
- Trøstrup, H.; Laulund, A.S.B.; Moser, C. Insights into Host-Pathogen Interactions in Biofilm-Infected Wounds Reveal Possibilities for New Treatment Strategies. Antibiotics 2020, 9, 396. [Google Scholar] [CrossRef]
- Qadir, A.; Jahan, S.; Aqil, M.; Warsi, M.H.; Alhakamy, N.A.; Alfaleh, M.A.; Khan, N.; Ali, A. Phytochemical-Based Nano-Pharmacotherapeutics for Management of Burn Wound Healing. Gels 2021, 7, 209. [Google Scholar] [CrossRef] [PubMed]
- Jeya Rajkumar, R.S.; Muthukumar, N.M.S.A.; Mosae Selvakumar, P. Phytochemicals as a Potential Source for Anti-Microbial, Anti-Oxidant and Wound Healing—A Review. MOJ Bioorg. Org. Chem. 2018, 2, 61–70. [Google Scholar] [CrossRef]
- Wang, C.; Wang, M.; Xu, T.; Zhang, X.; Lin, C.; Gao, W.; Xu, H.; Lei, B.; Mao, C. Engineering Bioactive Self-Healing Antibacterial Exosomes Hydrogel for Promoting Chronic Diabetic Wound Healing and Complete Skin Regeneration. Theranostics 2019, 9, 65–76. [Google Scholar] [CrossRef] [PubMed]
- Zduńska, K.; Dana, A.; Kolodziejczak, A.; Rotsztejn, H. Antioxidant Properties of Ferulic Acid and Its Possible Application. Skin Pharmacol. Physiol. 2018, 31, 332–336. [Google Scholar] [CrossRef]
- Omodanisi, E.I.; Aboua, Y.G.; Oguntibeju, O.O.; Lamuela-Raventós, R.M. Assessment of the Anti-Hyperglycaemic, Anti-Inflammatory and Antioxidant Activities of the Methanol Extract of Moringa Oleifera in Diabetes-Induced Nephrotoxic Male Wistar Rats. Molecules 2017, 22, 439. [Google Scholar] [CrossRef]
- Wilgus, T.A.; Roy, S.; McDaniel, J.C. Neutrophils and Wound Repair: Positive Actions and Negative Reactions. Adv. Wound Care 2013, 2, 379–388. [Google Scholar] [CrossRef] [Green Version]
- Colombo, I.; Sangiovanni, E.; Maggio, R.; Mattozzi, C.; Zava, S.; Corbett, Y.; Fumagalli, M.; Carlino, C.; Corsetto, P.A.; Scaccabarozzi, D.; et al. HaCaT Cells as a Reliable in Vitro Differentiation Model to Dissect the Inflammatory/Repair Response of Human Keratinocytes. Mediat. Inflamm. 2017, 2017, 7435621. [Google Scholar] [CrossRef] [PubMed]
- Shibuya, M. Vascular Endothelial Growth Factor (VEGF) and Its Receptor (VEGFR) Signaling in Angiogenesis: A Crucial Target for Anti- and Pro-Angiogenic Therapies. Genes Cancer 2011, 2, 1097. [Google Scholar] [CrossRef]
- Tracy, L.E.; Minasian, R.A.; Caterson, E.J. Extracellular Matrix and Dermal Fibroblast Function in the Healing Wound. Adv. Wound Care 2016, 5, 119. [Google Scholar] [CrossRef]
- Chin, C.Y.; Ng, P.Y.; Ng, S.F. Moringa Oleifera Standardised Aqueous Leaf Extract-Loaded Hydrocolloid Film Dressing: In Vivo Dermal Safety and Wound Healing Evaluation in STZ/HFD Diabetic Rat Model. Drug Deliv. Transl. Res. 2019, 9, 453–468. [Google Scholar] [CrossRef] [PubMed]
- Mohd Fisall, U.F.; Ismail, N.Z.; Adebayo, I.A.; Arsad, H. Dichloromethane Fraction of Moringa Oleifera Leaf Methanolic Extract Selectively Inhibits Breast Cancer Cells (MCF7) by Induction of Apoptosis via Upregulation of Bax, P53 and Caspase 8 Expressions. Mol. Biol. Rep. 2021, 48, 4465–4475. [Google Scholar] [CrossRef] [PubMed]
- Mukherjee, P.K. Quality Control and Evaluation of Herbal Drugs: Evaluating Natural Products and Traditional Medicine; Elsevier: Amsterdam, The Netherlands, 2019; pp. 1–784. [Google Scholar] [CrossRef]
- Nayeem, N.; Asdaq, S.M.B.; Alamri, A.S.; Alsanie, W.F.; Alhomrani, M.; Mohzari, Y.; Alrashed, A.A.; Alotaibi, N.; Alharbi, M.A.; Aldhawyan, N.N.; et al. Wound Healing Potential of Dodonaea Viscosa Extract Formulation in Experimental Animals. J. King Saud Univ. Sci. 2021, 33, 101476. [Google Scholar] [CrossRef]
- Kolhe, S.S.; Shinde, K.; Jori, R.; Gadhave, M.V.; Jadhav, S.L.; Gaikwad, D.D. Evaluation of Polyherbal Ointment for Wound Healing Activity in Wistar Rats. J. Drug Deliv. Ther. 2018, 8, 26–31. [Google Scholar] [CrossRef]
- Anesthesia (Guideline)|Vertebrate Animal Research. Available online: https://animal.research.uiowa.edu/iacuc-guidelines-anesthesia (accessed on 13 February 2022).
- Elstner, E.F.; Heupel, A. Inhibition of Nitrite Formation from Hydroxylammoniumchloride: A Simple Assay for Superoxide Dismutase. Anal. Biochem. 1976, 70, 616–620. [Google Scholar] [CrossRef]
- Link, E.M. The Mechanism of PH-Dependent Hydrogen Peroxide Cytotoxicity in Vitro. Arch. Biochem. Biophys. 1988, 265, 362–372. [Google Scholar] [CrossRef]
No. | Retention Time (RT) (min) | Formula | Calculated Mass (Da) | Theoretical Mass (Da) | Mass Error (ppm) | MSE Fragmentation | Identification | Ref. |
---|---|---|---|---|---|---|---|---|
1 | 1.6 | C7H6O4 | 151.17 | 154.0266 | 3.2 | 153.0215[M − H]−, 135.0211[M-H-H2O]−, 89.0340[M-H-H2O-HCOOH]− | 3,4-Dihydroxy-benzoic acid | [20] |
2 | 1.8 | C7H12O6 | 191.1683 | 192.0634 | −1.10 | 191.0542[M − H]−, 173.0432[M-H-H2O]−, 145.0516[M-H-HCOOH]−, 137.0232[M-H-3H2O]−, 127.0401[M-H-H2O-HCOOH]− | Quinic acid | [21] |
3 | 3.1 | C9H8O3 | 163.19 | 164.0474 | 0.3 | 165.0544[M + H]+, 147.0444[M + H-H2O]+, 119.0483[M + H-HCOOH]+ | o-Coumaric acid | [22] |
4 | 6.6 | C17H20O9 | 369.26 | 368.1107 | −1.5 | 367.1029[M − H]−, 336.0902[M-H-OCH3 ]−, 295.1124[M-H-4H2O]−, 243.0591[M-H-CH3-C6H5O2]−, 189.0549[M-H-CH3-C9H7O3 ]−, 178.0346[M-H-C8H13O5] | Methyl-3-caffeoylquinate | [23] |
5 | 7.7 | C21H20O12 | 463.31 | 464.0955 | −3.4 | 463.0866[M − H]−, 318.0758[M-H-2H2O-C6H5O2]−, 178.0513[M-H-C15H9O6]−, 159.0379[M-H-Glu-C6H4O3]− | Isoquercetin | [24] |
6 | 7.9 | C21H20O12 | 464.0955 | 464.0949 | −1.3 | 465.1022[M + H]+, 285.0485[M + H-Glu]+, 231.0678[M + H-Glu-3H2O]+, 149.0150[M + H-Glu-C7H4O3]+, 152.0154[M + H-Glu-C8H5O2]+ | Hyperoside | [25] |
7 | 12.4 | C10H12O2 | 164.0837 | 164.0831 | −2.8 | 209.1118[M + HCOO]−, 122.0453[M-H-C3H5]−, 105.0495[M-H-OCH3-C2H3]− | Eugenol | [24] |
8 | 13.1 | C16H18O9 | 356.38 | 354.0951 | 0.1 | 353.0878[M − H]−, 253.1035[M-H-3H2O-HCOOH]−, 190.0182[M-H-3H2O-C6H5O2]−, 144.0302[M-H-H2O-C7H11O6]−, 125.0251[M-H-H2O-HCOOH-C9H8O3]− | Chlorogenic acid | [23] |
9 | 15.1 | C12H16O4 | 224.1038 | 224.1049 | −4.8 | 223.0965[M − H]−, 205.1027[M-H-H2O]−, 135.0421[M-H-C4H8O2]−, 123.0964[M-H-C4H4O3]−, 87.0295[M-H-C8H8O2] | 3-Butylidene-4,5,6,7 -tetrahydro-6,7-dihydroxy-1(3H)-isobenzofuranone | [26] |
10 | 15.3 | C12H14O4 | 222.0883 | 222.0892 | −3.9 | 221.0811[M − H]−, 160.0546[M-H-OC2H5]−, 119.0282[M-H-C3H5O2 -C2H5]−, | Diethyl phthalate | [23] |
11 | 20.9 | C18H30O2 | 278.2237 | 278.2246 | −3.0 | 277.2165[M − H]−, 182.1234[M-H-C7H11]−, 168.1230[M-H-C8H13]−, 110.0795[M-H-C11H17-H2O]− | Linolenic acid | [21] |
12 | 23.7 | C20H26O9 | 410.1573 | 410.1577 | −1.0 | 409.1504[M − H]−, 336.0817[M-H-C4H9O]−, 251.1394[M-H-2H2O-C7H6O2]−, 202.0639[M-H-C3H7-C9H7O3]−, 134.0437[M-H-C12H19O7]− | 5-O-Caffeoylquinic acid butyl ester | [20] |
13 | 26.9 | C18H34O2 | 282.2558 | 282.2559 | −0.4 | 283.2631[M + H]+, 97.1020[M + H-C5H11-C6H11O2]+, 86.1024[M + H-C12H21O2]+, 72.0876[M + H-C13H23O2]+ | Oleic acid | [21] |
14 | 39.2 | C9H16O4 | 188.1045 | 188.1049 | 2.1 | 187.0965[M − H]−, 141.1105[M-H-HCOOH]−, 123.0957[M-H-H2O-HCOOH]−, 112.0644[M-H-H2O-C3H5O]− | Azelaic acid | [20] |
LC Instrument | XEVO-TQD#QCA1232 |
Column | SUNFIRE C18, 250 × 2.1, 2.6 μm |
HPLC Conditions | |
A% | 0.0 H2O |
B% | 5.0 ACN |
C% | 0.0 MeOH |
D% | 95.0 0.1% Formic Acid in water |
Flow (mL/min) | 1.500 |
Stop Time (min) | 5.0 |
Column Temperature (°C) | 30.0 |
Min Pressure (Bar) | 0.0 |
Max Pressure (Bar) | 300.0 |
Gene | Forward | Reverse |
---|---|---|
GAPDH | 5′CGGAGTCAACGGATTTGGTCGTAT3′ | 5′AGTCTTCTCCATGGTGGTGAAGAC3′ |
TGF-β1 | 5′CTTCTCCACCAACTACTGCTTC3′ | 5′GGGTCCCAGGCAGAAGTT3′ |
VEGF | 5′CTGGCCTGCAGACATCAAAGTGAG3′ | 5′CTTCCCGTTCTCAGCTCCACAAAC3′ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Al-Ghanayem, A.A.; Alhussaini, M.S.; Asad, M.; Joseph, B. Effect of Moringa oleifera Leaf Extract on Excision Wound Infections in Rats: Antioxidant, Antimicrobial, and Gene Expression Analysis. Molecules 2022, 27, 4481. https://doi.org/10.3390/molecules27144481
Al-Ghanayem AA, Alhussaini MS, Asad M, Joseph B. Effect of Moringa oleifera Leaf Extract on Excision Wound Infections in Rats: Antioxidant, Antimicrobial, and Gene Expression Analysis. Molecules. 2022; 27(14):4481. https://doi.org/10.3390/molecules27144481
Chicago/Turabian StyleAl-Ghanayem, Abdullah A., Mohammed Sanad Alhussaini, Mohammed Asad, and Babu Joseph. 2022. "Effect of Moringa oleifera Leaf Extract on Excision Wound Infections in Rats: Antioxidant, Antimicrobial, and Gene Expression Analysis" Molecules 27, no. 14: 4481. https://doi.org/10.3390/molecules27144481