Occurrence and Characteristics of Staphylococcus aureus Isolated from Dairy Products
1
Department of Microbiology, Institute of Experimental Biology, Faculty of Biology, Adam Mickiewicz University, Poznań, Uniwersytetu Poznańskiego 6, 61-614 Poznań, Poland
2
Faculty of Chemistry, Adam Mickiewicz University, Poznań, Uniwersytetu Poznańskiego 8, 61-614 Poznań, Poland
*
Author to whom correspondence should be addressed.
Molecules 2022, 27(14), 4649; https://doi.org/10.3390/molecules27144649
Submission received: 9 June 2022
/
Revised: 2 July 2022
/
Accepted: 20 July 2022
/
Published: 21 July 2022
(This article belongs to the Special Issue Improve Food Safety and Quality: Analysis and Methods)
Abstract
:Food, particularly milk and cheese, may be a reservoir of multi-drug resistant Staphylococcus aureus strains, which can be considered an important issue in terms of food safety. Furthermore, foods of animal origin can be a cause of staphylococcal food poisoning via the production of heat-stable enterotoxins (SE). For this reason, we investigated the prevalence of and characterized Staphylococcus aureus strains isolated from milk and fresh soft cheese obtained from farms located in Wielkopolskie and Zachodniopomorskie Provinces in Poland. Overall, 92% of S. aureus isolates were positive for at least one of the 18 enterotoxin genes identified, and 26% of the strains harbored 5 to 8 enterotoxin genes. Moreover, the S. aureus strains contained genes conferring resistance to antibiotics that are critically important in both human and veterinary medicine, i.e., β-lactams (mecA), aminoglycosides (aac(6′)/aph(2″), aph(3′)-IIIa, ant(4′)-Ia) and MLSB (erm(A), msr(A), lun(A)). The antimicrobial susceptibility of S. aureus to 16 antibiotics representing 11 different categories showed that 74% of the strains were resistant to at least 1 antibiotic. Moreover, 28% of the strains showed multidrug resistance; in particular, two methicillin-resistant S. aureus strains (MRSA) exhibited significant antibiotic resistance. In summary, our results show that dairy products are contaminated by S. aureus strains carrying genes encoding a variety of enterotoxins as well genes conferring resistance to antibiotics. Both MRSA strains and MSSA isolates showing multidrug resistance were present in foods of animal origin.
1. Introduction
Staphylococcus aureus is a well-known opportunistic pathogen widely distributed in a broad range of hosts, including humans and animals. Foods from animal origin, such as milk and cheese, are susceptible to contamination by these bacteria [1]. Staphylococcus aureus have the ability to cause staphylococcal food poisoning (SFP) via the production of heat–stable enterotoxins (SE) [2,3]. It should be emphasized that staphylococcal food poisoning (SFP), caused mainly by S. aureus and very occasionally by other Staphylococcus species, is one of the most common food-borne diseases worldwide [4]. S. aureus can carry multiple se genes and produce different SEs and SE-like toxins. The SEs (SEA to SEE; SEG to SEI; SEK; SEM to SET) and SE-like toxins (SElJ; SElL; SElU to SElZ) were reported to be associated with food borne disease outbreaks [5]. Enterotoxin function as superantigens, i.e., they have the ability to stimulate large populations of T cells that cause unregulated activation of the immune response. If this stimulation is sustained, massive amounts of cytokines are produced, leading to a variety of acute toxic shock symptoms. These symptoms occur within hours after consumption of contaminated food and patients experience vomiting, diarrhea and abdominal pain. The illness is self-limited and usually resolves within 12–24 h [6].
The wide use of antibiotics in veterinary medicine has led to the emergence of multidrug-resistant strains (MDR), especially methicillin-resistant S. aureus (MRSA). Methicillin-resistant staphylococci (MRS) have an additional penicillin binding protein (PBP2a, encoded by either mecA or mecC), which confers resistance to beta-lactam antibiotics. Moreover, S. aureus has the ability to acquire resistance to antibiotics easily, including those commonly used in medicine, i.e., aminoglycosides as well as macrolides, lincosamides and streptogramin B (MLSB). Importantly, the MLSB antibiotics are the preferred alternative to penicillins and cephalosporins in the treatment of staphylococcal infection. Moreover, erythromycin and clindamycin are recommended as second-line drugs for patients with β-lactam allergy. Resistance to MLSB is generally based on three mechanisms: ribosomal target modification mediated by erm genes, active efflux of antibiotics mediated by msr(A) and enzymatic drug inactivation mediated by lnu(A) [7]. Resistance to aminoglycosides is commonly related to drug inactivation by cellular aminoglycoside-modifying enzymes, especially the bifunctional enzyme AAC(6′)/APH(2″), encoded by aac(6′)/aph(2″), the APH(3′)-III enzyme encoded by aph(3′)-IIIa and the ANT(4′)-I enzyme encoded by ant(4′)-Ia. It is well known that the MRSA strains have been isolated from several food-producing animals, including pigs, cattle and chickens [5,8]. The probability of transferring these bacteria to milk and cheeses, particularly those made from raw milk, is high [9,10]. The consumption of these products may lead to asymptomatic colonization of the intestinal tract by resistant food-borne bacteria. Antimicrobial therapy during this colonization period may lead to the development of a severe clinical disease because the resistant food-borne pathogens may prevail over the sensitive antagonistic gut microbiota [8].
Milk and cheese are naturally susceptible to contamination by S. aureus, which can multiply and produce enterotoxins. Most studies have focused on the detection of genes encoding classical enterotoxins, whereas knowledge about the prevalence of newer enterotoxins is limited. Therefore, this study aimed to estimate the presence of 18 genes coding for enterotoxins in S. aureus. We also evaluated the occurrence of genes encoding resistance to antibiotics that are often used in human medicine, i.e., β-lactams (mecA), aminoglycosides (aac(6′)/aph(2″), aph(3′)-IIIa, ant(4′)-Ia) and MLSB (erm(A), erm(B), erm(C), lnu(A) msr(A)). We intended to estimate whether raw milk and cheese are sources of enterotoxigenic and multidrug-resistant S. aureus strains.
2. Result and Discussion
Although S. aureus has been well recognized for its ability to evoke staphylococcal food poisoning via the production of enterotoxins, only a limited number of reports have focused on the detection of newly described staphylococcal enterotoxins. In this study, all the S. aureus isolates were evaluated for the presence of 5 classical SE genes (sea, seb, sec, sed, see) and 13 newer SE genes (seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, ser and seu). They were found in 36 isolates (92%), which is a higher number than that found by Kou et al. [11]. However, in their study, Kou et al. tested only the five classical enterotoxins (sea, seb, sec, see and sed) in S. aureus isolates from retail raw milk from four regions in northern Xinjang, China. In our study, 18 enterotoxin genes (sea, seb, sec, sed, see, seg, seh, sei, selj, sek, sel, sem, sen, seo, sep, seq, ser, seu) and 26 different toxin gene profiles were detected among S. aureus isolates. Among them, the main profiles were sec, seg, sel, sei, sem, sen, seo and seu (10%, 4/39). Remarkably, 26% of the strains harbored five to eight enterotoxin genes (Table 1). The most frequent se gene detected was seo, followed by sek and slu. Various studies have reported different prevalence rates of the enterotoxin genes, which may be attributed to the type of food product and geographical distribution. For example, French studies have reported that sea genes were present in S. aureus from various food products most frequently [12]. Kou et al. [11] reported that the see gene was the most commonly detected SE in raw milk in China. In contrast, the see gene was not found in any of the S. aureus isolates analyzed in the present study.
Importantly, the multidrug resistance (MDR) phenotype (resistant to ≥3 subclasses of antimicrobial drugs) was observed in the S. aureus strains. The overall prevalence of MDR S. aureus isolates was 28%. All the MDR phenotypes included resistance to penicillin, i.e., an antibiotic that is widely used in veterinary medicine. Two isolates (5.1%) were verified as MRSA by the cefoxitin disc diffusion test and were positive for the mecA gene. Similarly, a low prevalence of MRSA in milk samples from dairy cows was reported in Germany [13]. MRSA isolates were not found in bulk tank milk collected from 91 different farms in Denmark [14]. In studies conducted in Croatia, Cvetnić et al. reported that methicillin resistance was detected in 10 (4.2%) S. aureus strains isolated from milk samples of cows suffering from subclinical mastitis [3]. A study from China reported a high MRSA prevalence (51.6 %) in raw milk samples [11]. In our study, the MRSA isolate MPU Sa 103 showed resistance to β-lactams, aminoglycosides and macrolides, while the other MRSA isolate, MPU Sa, 118 showed resistance to lincosamides, fluoroquinolones, tetracyclines, rifampicin and trimethoprim/sulfamethoxazole in addition to the antibiotic classes to which MPU Sa 103 was resistant, as shown in Table 2. As mentioned above, our results showed relatively high resistance to the β-lactams penicillin (59%) and ampicillin (36%). The observed high levels of resistance to penicillins were in consonance with previously published data demonstrating β-lactam resistance in staphylococci isolated from food products [15,16,17]. Approximately one-third of the strains displayed resistance to the aminoglycosides gentamycin (31%) and tobramycin (26%). Seven gentamycin-resistant and tobramycin-resistant isolates were found to carry the aminocyclitol-6′-acetyltransferase-aminocyclitol-2″-phosphotransferase (aac(6′)/aph(2″)) gene. The minocyclitol-3′-phosphotransferase (aph(3′)-IIIa) gene was detected in 28% of the strains, whereas the aminocyclitol-4′-adenylyltransferase (ant(4′)-Ia) gene was found in 10% of strains. Noteworthy, two pan-susceptible isolates (susceptible to all antibiotics) carried the ant(4′)-Ia gene. One isolate contained two AME genes, aph(3′)-IIIa and ant(4′)-Ia. Coexisting aac(6′)/aph (2″) and aph(3′)-IIIa) genes were detected in six strains. The examined strains harbored genes conferring resistance to MLSB. However, the prevalence of these resistance genes was generally low. Four strains carried the msr(A) gene, three isolates had the erm(B) gene and a single isolate had the lnu(A) gene. None of the isolates harbored erm(A) and erm(C) genes. The presence of macrolide resistance genes has been reported previously for S. aureus isolates from samples of milk obtained from dairy cows [18]. Erythromycin resistance was found in seven (18%) strains, whereas resistance to clindamycin was found in five strains (13%). These studies showed that the erythromycin resistance rate in S. aureus in Poland was lower than in other countries. Erythromycin resistance was detected in 74% of S. aureus from raw aquatic food in China, 46% of S. aureus from livestock animals in Italy and 47% of S. aureus from raw meat in the Czech Republic [15,19,20]. Additionally, a lower rate of tetracycline resistance (18%) was observed compared with previous reports from the Czech Republic, in which almost all MRSA strains isolated from samples of cow, sheep and goat milk showed resistance to tetracycline [21]. In our investigations, we detected five (13%) rifampicin-resistant strains and only one (2.5%) trimethoprim/sulfamethoxazole-resistant strain. Resistance to ciprofloxacin, levofloxacin and moxifloxacin was revealed in 23, 20 and 15% of the strains, respectively. Fortunately, none of the 39 isolates showed resistance to the critically important antimicrobial agent vancomycin. It is important to highlight a study conducted by Bhattacharyya et al. [22] that demonstrated the occurrence of vancomycin-resistant S. aureus isolated from bovine and caprine milk. In this study, no resistance to tigecycline and chloramphenicol was recorded. All the 39 isolates exhibited susceptibilities to vancomycin, tigecycline and chloramphenicol. Of the 39 S. aureus isolates, 10 were susceptible to all antibiotics, 7 were resistant to at least one antibiotic, and the other 22 isolates were resistant to two or more antibiotics. Interestingly, studies from Norway indicated that all S. aureus strains isolated from milk and cheese were sensitive to the 12 antibiotics tested [9]. In contrast, 80.6% of S. aureus strains isolated from milk in China were resistant to at least one antibiotic, which is close to our findings [11].
Taken together, our results show that milk and cheese are contaminated by S. aureus strains carrying genes encoding a variety of enterotoxins as well genes conferring resistance to antibiotics. Moreover, our findings show that the frequency of multidrug-resistant S. aureus strains in food is alarming and may represent a public health problem.
3. Material and Methods
3.1. Collection of Samples
Milk and cheese from farms located in the Wielkopolskie and Zachodniopomorskie Provinces were subjected to the analysis. The farms were semi-subsistence farms with three to seven dairy cows. The bulk milk and cheese made from raw milk was collected during one year. In total, 62 samples were analyzed. The samples were collected in sterile containers and transported immediately to the microbiological laboratory. The milk samples were centrifuged and a loop of sediment (10 μL) was streaked onto on Baird–Parker agar (Oxoid Ltd., Basingstoke, Hampshire, UK). Samples of curd were diluted 1:10 in sterile Ringer’s solution and homogenized in blender, and 100 μL of samples were placed on Baird–Parker agar (Oxoid Ltd.). Plates were incubated at 37 °C and examined after 24–48 h for bacterial growth.
3.2. Bacterial Isolation and Identification
Staphylococci colonies were subcultivated on brain–heart infusion agar. The strains were tested for bound coagulase by slide coagulase test on sterile microscope slides and free coagulase by tube coagulase test with rabbit plasma (Oxoid). Presumptive S. aureus were confirmed by API STAPH test strips (bioMerieux, Marcyl’Etoile, France). A total of 39 S. aureus strains were identified. Of these, 9 strains were isolated from cheese and 30 from milk. The bacterial strains used in the study were stored in brain–heart infusion agar (BHI, Oxoid) with 20% glycerol at −80 °C.
3.3. Susceptibility Testing
The antimicrobial susceptibility of the staphylococci was tested by using the agar disc diffusion method according to the CLSI standards for the following antimicrobial agents (µg/disc): ampicillin (25), cefoxitin (30), ciprofloxacin (5), clindamycin (2), chloramphenicol (30), erythromycin (15), gentamicin (10), levofloxacin (5), moxifloxacin (5), penicillin G (10), rifampicin (5), tetracycline (30), tigecycline (1,5), tobramycin (10), trimethoprim/sulfamethoxazole (1.25 + 23.75) and vancomycin (30).
3.4. Preparation of Total DNA for PCR and Detection of SE Genes and Antibiotic Resistance Genes
The total DNA was isolated and purified using the Genomic Mini DNA kit (A&A Biotechnology, Gdynia, Poland). The presence of se genes (sea, seb, sec, sed, see, seg, seh, sei, selj, sek, sel, sem, sen, seo, sep, seq, ser, selu) and antibiotic resistance genes mecA, aac(60)/aph(200), aph(30)-IIIa, ant(40)-Ia, erm(A), erm(B), erm(C), msr(A), lun(A) was assessed using PCR assays as described previously (Table 3) [23,24,25,26].
4. Conclusions
Contamination of food by pathogenic bacteria is a fundamental issue in the area of food safety since it can compromise human health. Our results show that raw milk and cheese are contaminated by S. aureus. These strains carry genes encoding a variety of enterotoxins that are responsible for staphylococcal food poisoning. Furthermore, S. aureus strains contain genes conferring resistance to antibiotics (i.e., β-lactams, aminoglycosides and MLSB), which are critically important in both human and veterinary medicine. Thus, the consumption of unpasteurized milk and other dairy products may lead to asymptomatic colonization of the intestinal tract by resistant food-borne bacteria.
Author Contributions
Conceptualization, E.S.; methodology, E.S. and M.W.; investigation, E.S., M.W., K.P. and B.Ł.; writing-original draft, E.S.; writing review, B.Ł. All authors have read and agreed to the published version of the manuscript.
Funding
This research was funded by Faculty of Biology, Adam Mickiewicz University, Poznań.
Institutional Review Board Statement
Not applicable.
Informed Consent Statement
Not applicable.
Data Availability Statement
Not applicable.
Conflicts of Interest
The authors declare no conflict of interest.
Sample Availability
Not applicable.
References
- Hornik, B.; Jakub Czarny, J.; Staninska-Pięta, J.; Wolko, Ł.; Cyplik, P.; Piotrowska-Cyplik, A. The raw milk microbiota from semi-subsistence farms characteristics by NGS analysis method. Molecules 2021, 19, 5029. [Google Scholar] [CrossRef]
- Fisher, E.L.; Otto, M.; Cheung, G.Y.C. Basis of virulence in enterotoxin-mediated staphylococcal food poisoning. Front. Microbiol. 2018, 9, 436. [Google Scholar]
- Cvetnić, L.; Samardžija, M.; Duvnjak, S.; Habrun, B.; Cvetnić, M.; Jaki Tkalec, V.; Ðuričić, D.; Benić, M. Multi Locus Sequence Typing and spa typing of Staphylococcus aureus isolated from the milk of cows with subclinical mastitis in Croatia. Microorganisms 2021, 9, 725. [Google Scholar] [CrossRef]
- Kadariya, J.; Smith, T.C.; Thapaliya, D. Staphylococcus aureus and Staphylococcal food-borne disease. BioMed Res. Int. 2014, 2014, 827965. [Google Scholar] [CrossRef] [Green Version]
- Hennekinne, J.A.; De Buyser, M.L.; Dragacci, S. Staphylococcus aureus and its food poisoning toxins: Characterization and outbreak investigation. FEMS Microbiol. Rev. 2012, 36, 815–836. [Google Scholar] [CrossRef] [Green Version]
- Pinchuk, I.V.; Beswick, E.J.; Reyes, V.E. Staphylococcal enterotoxins. Toxins 2010, 2, 2177–2197. [Google Scholar] [CrossRef] [Green Version]
- Leclercq, R. Mechanisms of resistance to macrolides and lincosamides: Nature of the resistance elements and their clinical implications. Clin. Infect. Dis. 2002, 34, 482–492. [Google Scholar] [CrossRef] [Green Version]
- Sergelidis, D.; Angelidis, A.S. Methicillin-resistant Staphylococcus aureus: A controversial food-borne pathogen. Lett. Appl. Microbiol. 2017, 64, 409–418. [Google Scholar] [CrossRef] [Green Version]
- Mehli, L.; Hoel, S.; Thomassen, G.M.B.; Jakobsen, A.N.; Karlsen, H. The prevalence, genetic diversity and antibiotic resistance of Staphylococcus aureus in milk, whey, and cheese from artisan farm Dairies. Int. Dairy J. 2017, 65, 20–27. [Google Scholar] [CrossRef] [Green Version]
- Locatelli, C.; Cremonesi, P.; Bertocchi, L.; Zanoni, M.G.; Barberio, A.; Drigo, I.; Varisco, G.; Castiglioni, B.; Bronzo, V.; Moroni, P. Short communication: Methicillin-resistant Staphylococcus aureus in bulk tank milk of dairy cows and effect of swine population density. J. Dairy Sci. 2016, 99, 2151–2156. [Google Scholar] [CrossRef] [Green Version]
- Kou, X.; Cai, H.; Huang, S.; Ni, Y.; Luo, B.; Qian, H.; Ji, H.; Wang, X. Prevalence and characteristics of Staphylococcus aureus isolated from retail raw milk in Northern Xinjiang, China. Front. Microbiol. 2021, 12, 705947. [Google Scholar] [CrossRef] [PubMed]
- Roussel, S.; Felix, B.; Vingadassalon, N.; Grout, J.; Hennekinne, J.-A.; Guillier, L.; Brisabois, A.; Auvray, F. Staphylococcus aureus strains associated with food poisoning outbreaks in France: Comparison of different molecular typing methods, including MLVA. Front. Microbiol. 2015, 6, 882. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Kadlec, K.; Entorf, M.; Peters, T. Occurrence and characteristics of livestock-associated methicillin-resistant Staphylococcus aureus in quarter milk samples from dairy cows in Germany. Front. Microbiol. 2019, 10, 1295. [Google Scholar] [CrossRef] [Green Version]
- Schnitt, A.; Tenhagen, B.-A. Risk factors for the occurrence of methicillin-resistant Staphylococcus aureus in dairy herds: An Update. Foodborne Pathog. Dis. 2020, 17, 585–596. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rong, D.; Wu, Q.; Xu, M.; Zhang, J.; Yu, S. Prevalence, virulence genes, antimicrobial susceptibility, and genetic diversity of Staphylococcus aureus from retail aquatic products in China. Front. Microbiol. 2017, 8, 217. [Google Scholar] [CrossRef] [Green Version]
- Li, H.; Andersen, P.S.; Stegger, M.; Sieber, R.N.; Ingmer, H.; Staubrand, N.; Dalsgaard, A.; Leisner, J.J. Antimicrobial resistance and virulence gene profiles of methicillin-resistant and -susceptible Staphylococcus aureus from food products in Denmark. Front. Microbiol. 2019, 10, 2681. [Google Scholar] [CrossRef]
- Rodríguez-López, P.; Filipello, V.; Di Ciccio, P.A.; Pitozzi, A.; Ghidini, S.; Scali, F.; Ianieri, A.; Zanardi, E.; Losio, M.N.; Simon, A.C.; et al. Assessment of the antibiotic resistance profile, genetic heterogeneity and biofilm production of methicillin-resistant Staphylococcus aureus (MRSA) isolated from the Italian swine production chain. Foods 2020, 19, 1141. [Google Scholar] [CrossRef]
- Li, L.; Feng, W.; Zhang, Z.; Xue, H.; Zhao, X. Macrolide-lincosamide-streptogramin resistance phenotypes and genotypes of coagulase-positive Staphylococcus aureus and coagulase-negative staphylococcal isolates from bovine mastitis. BMC Vet. Res. 2015, 11, 168. [Google Scholar] [CrossRef] [Green Version]
- Pirolo, M.; Gioffrè, A.; Visaggio, D.; Gherardi, M.; Pavia, G.; Samele, P.; Ciambrone, L.; Di Natale, R.; Spatari, G.; Casalinuovo, F.; et al. Prevalence, molecular epidemiology, and antimicrobial resistance of methicillin-resistant Staphylococcus aureus from swine in southern Italy. BMC Microbiol. 2019, 19, 51. [Google Scholar] [CrossRef]
- Tegegne, H.A.; Koláčková, I.; Florianová, M.; Gelbíčcová, T.; Madec, J.Y.; Haenni, M.; Karpíšková, R. Detection and molecular characterisation of methicillin-resistant Staphylococcus aureus isolated from raw meat in the retail market. J. Glob. Antimicrob. Resist. 2021, 26, 233–238. [Google Scholar] [CrossRef]
- Tegegne, H.A.; Florianová, M.; Gelbíčcová, T.; Karpíšková, R.; Koláčková, I. Detection and molecular characterization of methicillin-resistant Staphylococcus aureus isolated from bulk tank milk of cows, sheep, and goats. Foodborne Pathog. Dis. 2019, 16, 68–73. [Google Scholar] [CrossRef] [PubMed]
- Bhattacharyya, D.; Banerjee, J.; Bandyopadhyay, S.; Mondal, B.; Nanda, P.K.; Samanta, I.; Mahanti, A.; Das, A.K.; Das, G.; Dandapat, P.; et al. First report on vancomycin-resistant Staphylococcus aureus in bovine and caprine milk. Microb. Drug Resist. 2016, 22, 675–681. [Google Scholar] [CrossRef] [PubMed]
- Park, J.; Fox, L.; Seo, K.; McGuire, M.; Park, Y.; Rurangirwa, F.; Sischo, W.; Bohach, G. Detection of classical and newly described staphylococcal superantigen genes in coagulase-negative staphylococci isolated from bovine intramammary infections. Vet. Microbiol. 2011, 147, 149–154. [Google Scholar] [CrossRef] [Green Version]
- Zhang, K.; McClure, J.; Elsayed, S.; Louie, T.; Clony, J.M. Novel PCR assay for characterization and concomitant subtyping of staphylococcal cassette chromosome mec types I to V in methicillin-resistant Staphylococcus aureus. J. Clin. Microbiol. 2005, 43, 5026–5033. [Google Scholar] [CrossRef] [Green Version]
- Ardic, N.; Sareyyupoglu, B.; Ozyurt, M.; Haznedaroglu, T.; Ilga, U. Investigation of aminoglycoside modifying enzyme genes in methicillin-resistant staphylococci. Microbiol. Res. 2006, 161, 49–54. [Google Scholar] [CrossRef] [PubMed]
- Le Bouter, A.; Leclercq, R.; Cattoir, V. Molecular basis of resistance to macrolides, lincosamides and streptogramins in Staphylococcus saprophyticus clinical isolates. Int. J. Antimicrob. Agents 2011, 37, 118–123. [Google Scholar] [CrossRef] [PubMed] [Green Version]
Table 1.
Toxin gene profiles.
| Toxin Gene Profiles | Number of Isolates | Origin of Isolates (No) * |
|---|---|---|
| sec, seg, sel, sei, sem, sen, seo, seu | 4 | milk (3) cheese (1) |
| seb, seh, sek, seu, seq | 2 | milk (1) cheese (1) |
| sek, seu | 2 | milk (1) cheese (1) |
| seb, seh, sek, seq | 2 | milk (1) cheese (1) |
| sec, seg, sei, sel, sen, seo | 2 | milk (1) cheese (1) |
| sea, seh | 2 | milk |
| sek, seo | 2 | milk |
| seo | 2 | milk (1) cheese (1) |
| sec, sei, sem, seo, sen, sel, seu, ser | 1 | milk |
| seh, seg, sei, sek, seo, ser, sen, seu | 1 | milk |
| sec, seg, sei, sel, sem, sen, seu | 1 | milk |
| sec, sed, sei, seg, selj, seo, sem | 1 | milk |
| seg, sei, sem, seo, ser, sen, seu | 1 | milk |
| seb, sek, ser, seu, seq | 1 | milk |
| sed, seg, sei, seo, sem | 1 | milk |
| seg, sen, seo, seu | 1 | milk |
| sec, seg, sei, seo | 1 | chesse |
| seb, seg, seh, sei | 1 | milk |
| seg, ser, sen, seu | 1 | milk |
| sea, seo, sek | 1 | cheese |
| sea, sek, seq | 1 | milk |
| sep, sek, seo | 1 | cheese |
| seb, sek, seq | 1 | milk |
| seo, sek | 1 | milk |
| sek, seq | 1 | milk |
| sep | 1 | milk |
(No) * Number indicating the origin of Staphylococcus aureus strains.
Table 2.
Antimicrobial resistance and prevalence of antibiotic resistance genes among Staphylococcus aureus.
Table 2.
Antimicrobial resistance and prevalence of antibiotic resistance genes among Staphylococcus aureus.
| Antibiotic Profiles | Number of Antibiotics | Total Number of Isolates | Presence of mecA Gene (No.) * | Presence of aac(6′)/ Aph(2″) Gene (No.) | Presence of ap(3′)-IIIa Gene (No.) | Presence of Ant(4′)-Ia Gene (No.) | Presence of msr(A) Gene (No.) | Presence of erm(A) Gene (No.) | Presence of erm(B) Gene (No.) | Presence of erm(C) Gene (No.) | Presence of lnu(A) Gene (No.) |
|---|---|---|---|---|---|---|---|---|---|---|---|
| P | 1 | 4 | 0 | 0 | 0 | 0 | 1 | 0 | 1 | 0 | 0 |
| CN | 1 | 1 | 0 | 0 | 0 | 1 | 0 | 0 | 0 | 0 | 0 |
| TE | 1 | 1 | 0 | 0 | 1 | 0 | 0 | 0 | 1 | 0 | 0 |
| RD | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| P, E | 2 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| AMP, P | 2 | 5 | 0 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 |
| P, E, DA | 3 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 1 |
| CN, TOB, DA | 3 | 1 | 0 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CIP, LEV, MXF | 3 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| AMP, P, E | 3 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| AMP, P, CN, TOB | 4 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| CIP, LEV, MXF, CN | 4 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 |
| P, CIP, LEV, E, RD | 5 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 |
| AMP, FOX, P, TOB, E | 5 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
| P, CIP, LEV, CN, TOB | 5 | 1 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| P, CIP, LEV, MXF, CN, TOB, TE | 7 | 1 | 0 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 |
| AMP, P, CIP, LEV, MXF, CN, E | 7 | 1 | 0 | 0 | 1 | 0 | 1 | 0 | 0 | 0 | 0 |
| AMP, P, CN, TOB, DA, TE, RD | 7 | 2 | 0 | 2 | 2 | 0 | 0 | 0 | 1 | 0 | 0 |
| AMP, P, CIP, LEV, MXF, CN, TOB, TE | 8 | 2 | 0 | 2 | 2 | 0 | 0 | 0 | 0 | 0 | 0 |
| AMP, FOX, P, CIP, CN, TOB, E, DA, TE, RD, SXT | 11 | 1 | 1 | 0 | 0 | 0 | 0 | 0 | 0 | 0 | 0 |
* Number indicating the prevalence of antibiotic resistance genes in Staphylococcus aureus strains. AMP, ampicillin; CIP, ciprofloxacin; CN, gentamycin; DA, clindamycin; E, erythromycin; FOX, cefoxitin; LEV, levofloxacin; MXF, moxifloxacin; P, penicillin; RA, rifampicin; SXT, sulfamethoxazole/trimethoprim; TE, tetracycline; TOB, tobramycin.
Table 3.
Primers used in this study.
| Gene | Primer | Oligonucleotide Sequence (5′ to 3′) | Reference |
|---|---|---|---|
| sea | SEA-F SEA-R | CAGCATACTATATTGTTTAAAGGC CCTCTGAACCTTCCCATC | [23] |
| seb | SEB-F SEB-R | GTATGGTGGTGTAACTGAGCA TCAATCTTCACATCTTTAGAATCA | [23] |
| sec | SEC-F SEC-R | CTCAAGAACTAGACATAAAAGCTAGG TCAAAATCGGATTAACATTATCC | [23] |
| sed | SED-F SED-R | CTAGTTTGGTAATATCTCCTTTAAACG TTAATGCTATATCTTATAGGGTAAACATC | [23] |
| see | SEE-F SEE-R | CAGTACCTATAGATAAAGTTAAAACAAGC TAACTTACCGTGGACCCTTC | [23] |
| seg | SEG-F SEG-R | AAGTAGACATTTTTGGCGTTCC AGAACCATCAAACTCGTATAGC | [23] |
| seh | SEH-F SEH-R | GTCTATATGGAGGTACAACACT GACCTTTACTTATTTCGCTGTC | [23] |
| sei | SEI-F SEI-R | GGTGATATTGGTGTAGGTAAC ATCCATATTCTTTGCCTTTACCAG | [23] |
| sej | SEJ-F SEJ-R | ATAGCATCAGAACTGTTGTTCCG CTTTCTGAATTTTACCACCAAAGG | [23] |
| sek | SEK-F SEK-R | TAGGTGTCTCTAATAATGCCA TAGATATTCGTTAGTAGCTG | [23] |
| sel | SEL-F SEL-R | TAACGGCGATGTAGGTCCAGG CATCTATTTCTTGTGCGGTAAC | [23] |
| sem | SEM-F SEM-R | GGATAATTCGACAGTAACAG TCCTGCATTAAATCCAGAAC | [23] |
| sen | SEN-F SEN-R | CATCATGCTTATACGGAGGAG CCCACTGAACCTTTTACGTT | [23] |
| seo | SEO-F SEO-R | TGTGTAAGAAGTCAAGTGTAG TCTTTAGAAATCGCTGATGA | [23] |
| sep | SEP-F SEP-R | TGATTTATTAGTAGACCTTGG ATAACCAACCGAATCACCAG | [23] |
| seq | SEQ-F SEQ-R | TCAAGGAGTTAGTTCTGGAAATT GCTTACCATTGACCCAGAGA | [23] |
| ser | SER-F SER-R | GGATAAAGCGGTAATAGCAG GTATTCCAAACACATCTAAC | [23] |
| sel | SEU-F SEU-R | ATCAGAAACAAACATTAAAGCCCA TGACCATTTCCTTCGATAAACTTTAT | [23] |
| mecA | MecA-F MecA-R | GTGAAGATATACCAAGTGATT ATGCGCTATAGATTGAAAGGAT | [24] |
| aac(6′)/aph(2″) | AAC(6′)/APH(2″)-F AAC(6′)/APH(2″)-R | GAAGTACGCAGAAGAGA ACA TGG CAA GCT CTA | [25] |
| aph(3′)-IIIa | APH(3′)-IIIa-F APH(3v)-IIIa-R | AAATACCGCTGCGTA CATACTCTTCCGAGCAA | [25] |
| ant(4′)-Ia | ANT(4′)-Ia-F ANT(4′)-Ia-R | AATCGGTAGAAGCCCAA GCACCTGCCATT GCTA | [25] |
| erm(A) | ermA-F ermA-R | TCTAAAAAGCATGTAAAAGAAA CGATACTTTTTGTAGTCCTTC | [26] |
| erm(B) | ermB-F ermB-R | CCGTTTACGAAATTGGAACAGGTAAAGGGC GAATCGAGACTTGAGTGTGC | [26] |
| erm(C) | ermC-F ermC-R | GCTAATATTGTTTAAATCGTCAATTCC GGATCAGGAAAAGGACATTTTAC | [26] |
| msr(A) | msrA-F msrA-R | TGCTGACACAATTTGGGAT GAGCAGCCTTCTCAACC | [26] |
| lnu(A) | linA-F linA-R | GGTGGCTGGGGGGTAGATGTATTAACTGG GCTTCTTTTGAAATACATGGTATTTTTCGA | [26] |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
MDPI and ACS Style
Szczuka, E.; Porada, K.; Wesołowska, M.; Łęska, B. Occurrence and Characteristics of Staphylococcus aureus Isolated from Dairy Products. Molecules 2022, 27, 4649. https://doi.org/10.3390/molecules27144649
AMA Style
Szczuka E, Porada K, Wesołowska M, Łęska B. Occurrence and Characteristics of Staphylococcus aureus Isolated from Dairy Products. Molecules. 2022; 27(14):4649. https://doi.org/10.3390/molecules27144649
Chicago/Turabian StyleSzczuka, Ewa, Karolina Porada, Maria Wesołowska, and Bogusława Łęska. 2022. "Occurrence and Characteristics of Staphylococcus aureus Isolated from Dairy Products" Molecules 27, no. 14: 4649. https://doi.org/10.3390/molecules27144649
