Acetyl-CoA Deficiency Is Involved in the Regulation of Iron Overload on Lipid Metabolism in Apolipoprotein E Knockout Mice
Abstract
1. Introduction
2. Materials and Methods
2.1. Animals and Treatment
2.2. Sample Collection and Histological Examination
2.3. Measurements of Metabolites
2.4. Mitochondrial Membrane Potential (MMP)
2.5. Isobaric Tags for Relative and Absolute Quantitation (iTRAQ)
2.6. Protein Identification and Quantification
2.7. Quantitative Real-Time PCR (qRT-PCR)
2.8. Western Blot Analysis
2.9. Statistical Analysis
3. Results
3.1. Dietary Iron Overload Alleviates HFD-Induced NAFLD in ApoE KO Mice
3.2. Excess Dietary Iron Reverses HFD-Induced Elevation in Hepatic Acetyl-CoA Level in ApoE KO Mice
3.3. The Proteins Related to Cholesterol Metabolism, Glycolysis, and the TCA Cycle Are Differentially Expressed between HFD + Fe-fed Mice and HFD-fed Mice
3.4. Excess Dietary Iron Induces Hepatic Mitochondrial Dysfunction and Oxidative Damage in ApoE KO Mice
4. Discussion
Supplementary Materials
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Sample Availability
References
- Younossi, Z.M.; Koenig, A.B.; Abdelatif, D.; Fazel, Y.; Henry, L.; Wymer, M. Global epidemiology of nonalcoholic fatty liver disease-Meta-analytic assessment of prevalence, incidence, and outcomes. Hepatology 2016, 64, 73–84. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Younossi, Z.; Tacke, F.; Arrese, M.; Chander Sharma, B.; Mostafa, I.; Bugianesi, E.; Wai-Sun Wong, V.; Yilmaz, Y.; George, J.; Fan, J.; et al. Global Perspectives on Nonalcoholic Fatty Liver Disease and Nonalcoholic Steatohepatitis. Hepatology 2019, 69, 2672–2682. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Golabi, P.; Fukui, N.; Paik, J.; Sayiner, M.; Mishra, A.; Younossi, Z.M. Mortality Risk Detected by Atherosclerotic Cardiovascular Disease Score in Patients with Nonalcoholic Fatty Liver Disease. Hepatol. Commun. 2019, 3, 1050–1060. [Google Scholar] [CrossRef] [Scilit]
- Perla, F.M.; Prelati, M.; Lavorato, M.; Visicchio, D.; Anania, C. The Role of Lipid and Lipoprotein Metabolism in Nonalcoholic Fatty Liver Disease. Children 2017, 4, 46. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhang, Q.Q.; Lu, L.G. Nonalcoholic Fatty Liver Disease: Dyslipidemia, Risk for Cardiovascular Complications, and Treatment Strategy. J. Clin. Transl. Hepatol. 2015, 3, 78–84. [Google Scholar] [CrossRef] [Scilit]
- Ipsen, D.H.; Lykkesfeldt, J.; Tveden-Nyborg, P. Molecular mechanisms of hepatic lipid accumulation in nonalcoholic fatty liver disease. Cell Mol. Life Sci. 2018, 75, 3313–3327. [Google Scholar] [CrossRef] [Scilit]
- Shi, L.; Tu, B.P. Acetyl-CoA and the regulation of metabolism: Mechanisms and consequences. Curr. Opin. Cell Biol. 2015, 33, 125–131. [Google Scholar] [CrossRef] [Scilit]
- Zhang, H.; Temel, R.E.; Martel, C. Cholesterol and lipoprotein metabolism: Early Career Committee contribution. Arterioscler. Thromb. Vasc. Biol. 2014, 34, 1791–1794. [Google Scholar] [CrossRef] [Scilit]
- Wakil, S.J.; Abu-Elheiga, L.A. Fatty acid metabolism: Target for metabolic syndrome. J. Lipid Res. 2009, 50, S138–S143. [Google Scholar] [CrossRef] [Scilit]
- Datz, C.; Muller, E.; Aigner, E. Iron overload and nonalcoholic fatty liver disease. Minerva Endocrinol. 2017, 42, 173–183. [Google Scholar] [CrossRef] [Scilit]
- Kanda, T.; Matsuoka, S.; Yamazaki, M.; Shibata, T.; Nirei, K.; Takahashi, H.; Kaneko, T.; Fujisawa, M.; Higuchi, T.; Nakamura, H.; et al. Apoptosis and nonalcoholic fatty liver diseases. World J. Gastroenterol 2018, 24, 2661–2672. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Handa, P.; Morgan-Stevenson, V.; Maliken, B.D.; Nelson, J.E.; Washington, S.; Westerman, M.; Yeh, M.M.; Kowdley, K.V. Iron overload results in hepatic oxidative stress, immune cell activation, and hepatocellular ballooning injury, leading to nonalcoholic steatohepatitis in genetically obese mice. Am. J. Physiol. Gastrointest. Liver Physiol. 2016, 310, G117–G127. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Maliken, B.D.; Nelson, J.E.; Klintworth, H.M.; Beauchamp, M.; Yeh, M.M.; Kowdley, K.V. Hepatic reticuloendothelial system cell iron deposition is associated with increased apoptosis in nonalcoholic fatty liver disease. Hepatology 2013, 57, 1806–1813. [Google Scholar] [CrossRef] [Scilit]
- Wenzel, B.J.; Stults, H.B.; Mayer, J. Hypoferraemia in obese adolescents. Lancet 1962, 2, 327–328. [Google Scholar] [CrossRef] [Scilit]
- Siddique, A.; Nelson, J.E.; Aouizerat, B.; Yeh, M.M.; Kowdley, K.V.; Network, N.C.R. Iron deficiency in patients with nonalcoholic Fatty liver disease is associated with obesity, female gender, and low serum hepcidin. Clin. Gastroenterol. Hepatol. 2014, 12, 1170–1178. [Google Scholar] [CrossRef] [Scilit]
- Bartholmey, S.J.; Sherman, A.R. Carnitine levels in iron-deficient rat pups. J. Nutr. 1985, 115, 138–145. [Google Scholar] [CrossRef] [Scilit]
- Davis, M.R.; Rendina, E.; Peterson, S.K.; Lucas, E.A.; Smith, B.J.; Clarke, S.L. Enhanced expression of lipogenic genes may contribute to hyperglycemia and alterations in plasma lipids in response to dietary iron deficiency. Genes Nutr. 2012, 7, 415–425. [Google Scholar] [CrossRef] [Scilit]
- Rockfield, S.; Chhabra, R.; Robertson, M.; Rehman, N.; Bisht, R.; Nanjundan, M. Links Between Iron and Lipids: Implications in Some Major Human Diseases. Pharmaceuticals 2018, 11, 113. [Google Scholar] [CrossRef] [Scilit]
- Xiao, L.; Luo, G.; Li, H.; Yao, P.; Tang, Y. Dietary iron overload mitigates atherosclerosis in high-fat diet-fed apolipoprotein E knockout mice: Role of dysregulated hepatic fatty acid metabolism. Biochim. Et Biophys. Acta. Mol. Cell Biol. Lipids 2021, 1866, 159004. [Google Scholar] [CrossRef] [Scilit]
- Robinet, P.; Milewicz, D.M.; Cassis, L.A.; Leeper, N.J.; Lu, H.S.; Smith, J.D. Consideration of Sex Differences in Design and Reporting of Experimental Arterial Pathology Studies-Statement from ATVB Council. Arterioscler. Thromb. Vasc. Biol. 2018, 38, 292–303. [Google Scholar] [CrossRef] [Scilit]
- Caligiuri, G.; Nicoletti, A.; Zhou, X.; Tornberg, I.; Hansson, G.K. Effects of sex and age on atherosclerosis and autoimmunity in apoE-deficient mice. Atherosclerosis 1999, 145, 301–308. [Google Scholar] [CrossRef] [Scilit]
- Surra, J.C.; Guillen, N.; Arbones-Mainar, J.M.; Barranquero, C.; Navarro, M.A.; Arnal, C.; Orman, I.; Segovia, J.C.; Osada, J. Sex as a profound modifier of atherosclerotic lesion development in apolipoprotein E-deficient mice with different genetic backgrounds. J. Atheroscler. Thromb. 2010, 17, 712–721. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Xiao, L.; Liu, L.; Guo, X.; Zhang, S.; Wang, J.; Zhou, F.; Liu, L.; Tang, Y.; Yao, P. Quercetin attenuates high fat diet-induced atherosclerosis in apolipoprotein E knockout mice: A critical role of NADPH oxidase. Food Chem. Toxicol. Int. J. Publ. Br. Ind. Biol. Res. Assoc. 2017, 105, 22–33. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Kleiner, D.E.; Brunt, E.M.; Van Natta, M.; Behling, C.; Contos, M.J.; Cummings, O.W.; Ferrell, L.D.; Liu, Y.C.; Torbenson, M.S.; Unalp-Arida, A.; et al. Design and validation of a histological scoring system for nonalcoholic fatty liver disease. Hepatology 2005, 41, 1313–1321. [Google Scholar] [CrossRef] [Scilit]
- McLachlan, S.; Lee, S.M.; Steele, T.M.; Hawthorne, P.L.; Zapala, M.A.; Eskin, E.; Schork, N.J.; Anderson, G.J.; Vulpe, C.D. In silico QTL mapping of basal liver iron levels in inbred mouse strains. Physiol. Genom. 2011, 43, 136–147. [Google Scholar] [CrossRef] [Scilit]
- Fouret, G.; Tolika, E.; Lecomte, J.; Bonafos, B.; Aoun, M.; Murphy, M.P.; Ferreri, C.; Chatgilialoglu, C.; Dubreucq, E.; Coudray, C.; et al. The mitochondrial-targeted antioxidant, MitoQ, increases liver mitochondrial cardiolipin content in obesogenic diet-fed rats. Biochim. Biophys. Acta 2015, 1847, 1025–1035. [Google Scholar] [CrossRef] [Scilit]
- Min, H.K.; Kapoor, A.; Fuchs, M.; Mirshahi, F.; Zhou, H.; Maher, J.; Kellum, J.; Warnick, R.; Contos, M.J.; Sanyal, A.J. Increased hepatic synthesis and dysregulation of cholesterol metabolism is associated with the severity of nonalcoholic fatty liver disease. Cell. Metab. 2012, 15, 665–674. [Google Scholar] [CrossRef] [Scilit]
- Huff, T.; Boyd, B.; Jialal, I. Physiology Cholesterol; StatPearls: Treasure Island, FL, USA, 2022. [Google Scholar]
- Gesto, D.S.; Pereira, C.M.S.; Cerqueira, N.; Sousa, S.F. An Atomic-Level Perspective of HMG-CoA-Reductase: The Target Enzyme to Treat Hypercholesterolemia. Molecules 2020, 25, 3891. [Google Scholar] [CrossRef] [Scilit]
- Repa, J.J.; Berge, K.E.; Pomajzl, C.; Richardson, J.A.; Hobbs, H.; Mangelsdorf, D.J. Regulation of ATP-binding cassette sterol transporters ABCG5 and ABCG8 by the liver X receptors alpha and beta. J. Biol. Chem. 2002, 277, 18793–18800. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Zhong, H.; Yin, H. Role of lipid peroxidation derived 4-hydroxynonenal (4-HNE) in cancer: Focusing on mitochondria. Redox. Biol. 2015, 4, 193–199. [Google Scholar] [CrossRef] [Scilit]
- Kitamura, N.; Yokoyama, Y.; Taoka, H.; Nagano, U.; Hosoda, S.; Taworntawat, T.; Nakamura, A.; Ogawa, Y.; Tsubota, K.; Watanabe, M. Iron supplementation regulates the progression of high fat diet induced obesity and hepatic steatosis via mitochondrial signaling pathways. Sci. Rep. 2021, 11, 10753. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Altamura, S.; Mudder, K.; Schlotterer, A.; Fleming, T.; Heidenreich, E.; Qiu, R.; Hammes, H.P.; Nawroth, P.; Muckenthaler, M.U. Iron aggravates hepatic insulin resistance in the absence of inflammation in a novel db/db mouse model with iron overload. Mol. Metab. 2021, 51, 101235. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Choi, J.S.; Koh, I.U.; Lee, H.J.; Kim, W.H.; Song, J. Effects of excess dietary iron and fat on glucose and lipid metabolism. J. Nutr. Biochem. 2013, 24, 1634–1644. [Google Scholar] [CrossRef] [Scilit] [PubMed]
- Du, T.; Sun, X.; Yuan, G.; Zhou, X.; Lu, H.; Lin, X.; Yu, X. Lipid phenotypes in patients with nonalcoholic fatty liver disease. Metabolism 2016, 65, 1391–1398. [Google Scholar] [CrossRef] [Scilit]
- Turbino-Ribeiro, S.M.; Silva, M.E.; Chianca, D.A., Jr.; De Paula, H.; Cardoso, L.M.; Colombari, E.; Pedrosa, M.L. Iron overload in hypercholesterolemic rats affects iron homeostasis and serum lipids but not blood pressure. J. Nutr 2003, 133, 15–20. [Google Scholar] [CrossRef] [Scilit]
- Dabbagh, A.J.; Shwaery, G.T.; Keaney, J.F., Jr.; Frei, B. Effect of iron overload and iron deficiency on atherosclerosis in the hypercholesterolemic rabbit. Arterioscler. Thromb. Vasc. Biol. 1997, 17, 2638–2645. [Google Scholar] [CrossRef] [Scilit]
- Graham, R.M.; Chua, A.C.; Carter, K.W.; Delima, R.D.; Johnstone, D.; Herbison, C.E.; Firth, M.J.; O’Leary, R.; Milward, E.A.; Olynyk, J.K.; et al. Hepatic iron loading in mice increases cholesterol biosynthesis. Hepatology 2010, 52, 462–471. [Google Scholar] [CrossRef] [Scilit]
- Jing, X.; Du, T.; Li, T.; Yang, X.; Wang, G.; Liu, X.; Jiang, Z.; Cui, X. The detrimental effect of iron on OA chondrocytes: Importance of pro-inflammatory cytokines induced iron influx and oxidative stress. J. Cell. Mol. Med. 2021, 25, 5671–5680. [Google Scholar] [CrossRef] [Scilit]
- Lee, H.J.; Choi, J.S.; Lee, H.J.; Kim, W.H.; Park, S.I.; Song, J. Effect of excess iron on oxidative stress and gluconeogenesis through hepcidin during mitochondrial dysfunction. J. Nutr. Biochem. 2015, 26, 1414–1423. [Google Scholar] [CrossRef] [Scilit]




| Gene | Forward Primer 5′–3′ | Reverse Primer 5′–3′ |
|---|---|---|
| Gck | CTGGATGGCTCCGTGTACAAG | CTCCCAGTCATCACGGTCTG |
| Gapdh | ATACGGCTACAGCAACAGGG | GCTTTGCACATGCCCGGAGCC |
| Pklr | TGGGAAAACTGGGTGGGATGGATG | GAAGGAAGCAGCCGGGGATTTGAC |
| Dld | CAGCTCCTTCCTTGTCAACAGA | TTGAACAGAATGGAATAACCGTG |
| Idh3a | CATCAAGCTCATCACCGAAGAAG | TACAGTTCTCCGCAACTTCCCT |
| Fh | ATATTGGAGGTGCTACGGAACG | TCCAGTCTGCCAAACCACCA |
| Mdh2 | ATTGCCTCAAAGGTTGTGATGTG | GGATGGTGGAGTTCACTGGGTT |
| Hmgcr | TGTGGTTTGTGAAGCCGTCAT | TCAACCATAGCTTCCGTAGTTGTC |
| Hmgcs1 | GGGCCAAACGCTCCTCTAAT | AGTCATAGGCATGCTGCATGTG |
| Hmgcs2 | TGCAGGAAACTTCGCTCACA | AAATAGACCTCCAGGGCAAGGA |
| Sqle | ATAAGAAATGCGGGGATGTCAC | ATATCCGAGAAGGCAGCGAAC |
| TNF-α | GCATGATCCGCGACGTGGAA | AGATCCATGCCGTTGGCCAG |
| CRP | ATGGAGAAGCTACTCTGGTGC | ACACACAGTAAAGGTGTTCAGTG |
| IL-6 | TAGTCCTTCCTACCCCAATTTCC | TTGGTCCTTAGCCACTCCTTC |
| IL-1β | AAACAAAGAAGGCTGGAA | GGTGGCTAAGAACACTGGA |
| β-actin | TTCGTTGCCGGTCCACACCC | GCTTTGCACATGCCGGAGCC |
| Parameters | Groups | ||
|---|---|---|---|
| ND | HFD | HFD + Fe | |
| Serum iron (mg/L) | 193.55 ± 4.65 | 213.21 ± 6.57 | 345.70 ± 10.92 ▲▲★★ |
| Serum TC (mmol/L) | 11.62 ± 0.85 | 20.28 ± 0.67 ▲▲ | 14.63 ± 0.36 ▲★ |
| Serum LDL-C (mmol/L) | 4.95 ± 0.17 | 11.27 ± 0.52 ▲▲ | 3.20 ± 0.42 ★★ |
| Serum AST (U/L) | 35.57 ± 5.19 | 90.19 ± 10.86 ▲▲ | 121.40 ± 12.06 ▲▲★★ |
| Serum ALT (U/L) | 31.88 ± 4.05 | 60.21 ± 6.05 ▲▲ | 83.97 ± 10.11 ▲▲★ |
| Hepatic TC (mmol/L) | 1.34 ± 0.11 | 2.94 ± 0.17 ▲▲ | 1.76 ± 0.18 ★★ |
| Liver iron (μg/g protein) | 234.08 ± 35.25 | 446.15 ± 20.18 ▲▲ | 1125.23 ± 46.04 ▲▲★★ |
| Serum hepcidin (ng/mL) | 53.62 ± 4.11 | 60.13 ± 5.03 | 191.37 ± 11.64 ▲▲★★ |
Publisher’s Note: MDPI stays neutral with regard to jurisdictional claims in published maps and institutional affiliations. |
© 2022 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Luo, G.; Xiang, L.; Xiao, L. Acetyl-CoA Deficiency Is Involved in the Regulation of Iron Overload on Lipid Metabolism in Apolipoprotein E Knockout Mice. Molecules 2022, 27, 4966. https://doi.org/10.3390/molecules27154966
Luo G, Xiang L, Xiao L. Acetyl-CoA Deficiency Is Involved in the Regulation of Iron Overload on Lipid Metabolism in Apolipoprotein E Knockout Mice. Molecules. 2022; 27(15):4966. https://doi.org/10.3390/molecules27154966
Chicago/Turabian StyleLuo, Gang, Lu Xiang, and Lin Xiao. 2022. "Acetyl-CoA Deficiency Is Involved in the Regulation of Iron Overload on Lipid Metabolism in Apolipoprotein E Knockout Mice" Molecules 27, no. 15: 4966. https://doi.org/10.3390/molecules27154966
APA StyleLuo, G., Xiang, L., & Xiao, L. (2022). Acetyl-CoA Deficiency Is Involved in the Regulation of Iron Overload on Lipid Metabolism in Apolipoprotein E Knockout Mice. Molecules, 27(15), 4966. https://doi.org/10.3390/molecules27154966

