Antioxidant and Anti-Inflammatory Activity on LPS-Stimulated RAW 264.7 Macrophage Cells of White Mulberry (Morus alba L.) Leaf Extracts
Abstract
:1. Introduction
2. Results
2.1. Potential Bioactive Compounds and Antioxidant Activity of White Mulberry Leaf Extracts
2.2. Effects of White Mulberry Leaf Extract, Resveratrol, and Oxyresveratrol on Cell Viability
2.3. Effects of White Mulberry Leaf Extract, Resveratrol, and Oxyresveratrol on LPS-Stimulated Nitric Oxide Production
2.4. Effects of White Mulberry Leaf Extract, Resveratrol, and Oxyresveratrol on the mRNA Expression of iNOS and COX-2 in LPS-Stimulated RAW 264.7 Cells
2.5. Effects of White Mulberry Leaf Extract, Resveratrol, and Oxyresveratrol on the mRNA Expression of TNF-α and IL-6 in LPS-Stimulated RAW 264.7 Cells
2.6. Effects of White Mulberry Leaf Extract, Resveratrol, and Oxyresveratrol on the Protein Expression of iNOS and COX-2 in LPS-Stimulated RAW 264.7 Cells
3. Discussion
4. Materials and Methods
4.1. Reagents and Chemicals
4.2. Materials
4.3. Preparation of Extracts
4.4. Bioactive Compounds in White Mulberry Leaf Extract
4.4.1. Determination of Total Phenolic Content
4.4.2. Determination of Total Flavonoid Content
4.4.3. DPPH Radical Scavenging Assay
4.4.4. ABTS Radical Cation Decolorization Assay
4.4.5. Ferric Reducing Antioxidant Power (FRAP) Assay
4.4.6. Analysis of Resveratrol and Oxyresveratrol in Mulberry Leaf Extracts by HPLC
4.5. Anti-Inflammatory Activity
4.5.1. Cell Culture
4.5.2. Cell Viability Assay
4.5.3. Nitrite Determination
4.5.4. RNA Extraction and cDNA Synthesis
4.5.5. Real-Time Quantitative PCR Amplification
4.5.6. Western Blotting Analysis
4.6. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Acknowledgments
Conflicts of Interest
Sample Availability
References
- Libby, P. Inflammatory mechanisms: The molecular basis of inflammation and disease. Nutr. Rev. 2007, 65, S140–S146. [Google Scholar] [CrossRef]
- Chen, L.; Deng, H.; Cui, H.; Fang, J.; Zuo, Z.; Deng, J.; Li, Y.; Wang, X.; Zhao, L. Inflammatory responses and inflammation-associated diseases in organs. Oncotarget 2018, 9, 7204. [Google Scholar] [CrossRef]
- Kwon, O.K.; Lee, M.Y.; Yuk, J.E.; Oh, S.R.; Chin, Y.W.; Lee, H.K.; Ahn, K.S. Anti-inflammatory effects of methanol extracts of the root of Lilium lancifolium on LPS-stimulated Raw264. 7 cells. J. Ethnopharmacol. 2010, 130, 28–34. [Google Scholar] [CrossRef]
- Yao, Y.D.; Shen, X.Y.; Machado, J.; Luo, J.F.; Dai, Y.; Lio, C.K.; Yu, Y.; Xie, Y.; Luo, P.; Liu, J.X.; et al. Nardochinoid B inhibited the activation of RAW264. 7 macrophages stimulated by lipopolysaccharide through activating the Nrf2/HO-1 pathway. Molecules 2019, 24, 2482. [Google Scholar] [CrossRef]
- Cai, C.; Chen, Y.; Zhong, S.; Ji, B.; Wang, J.; Bai, X.; Shi, G. Anti-inflammatory activity of N-butanol extract from Ipomoea stolonifera in vivo and in vitro. PLoS ONE 2014, 9, e95931. [Google Scholar] [CrossRef]
- Azab, A.; Nassar, A.; Azab, A.N. Anti-inflammatory activity of natural products. Molecules 2016, 21, 1321. [Google Scholar] [CrossRef]
- Gabay, C. Interleukin-6 and chronic inflammation. Arthritis Res. Ther. 2006, 8, S3. [Google Scholar] [CrossRef]
- Yang, G.; Ham, I.; Choi, H.Y. Anti-inflammatory effect of prunetin via the suppression of NF-κB pathway. Food Chem. Toxicol. 2013, 58, 124–132. [Google Scholar] [CrossRef]
- Zhang, H.; Ma, Z.F.; Luo, X.; Li, X. Effects of mulberry fruit (Morus alba L.) consumption on health outcomes: A mini-review. Antioxidants 2018, 7, 69. [Google Scholar] [CrossRef]
- Thabti, I.; Elfalleh, W.; Tlili, N.; Ziadi, M.; Campos, M.G.; Ferchichi, A. Phenols, flavonoids, and antioxidant and antibacterial activity of leaves and stem bark of Morus species. Int. J. Food Prop. 2014, 17, 842–854. [Google Scholar] [CrossRef]
- Deng, H.; He, X.; Xu, Y.; Hu, X. Oxyresveratrol from mulberry as a dihydrate. Acta Crystallogr. Sect. E Struct. Rep. Online 2012, 68, o1318–o1319. [Google Scholar] [CrossRef]
- Zhou, J.; Li, S.X.; Wang, W.; Guo, X.Y.; Lu, X.Y.; Yan, X.P.; Wei, B.Y.; Cao, L. Variations in the levels of mulberroside A, oxyresveratrol, and resveratrol in mulberries in different seasons and during growth. Sci. World J. 2013, 2013, 380692. [Google Scholar] [CrossRef]
- Perrone, D.; Fuggetta, M.P.; Ardito, F.; Cottarelli, A.; De Filippis, A.; Ravagnan, G.; Maria, S.D.; Lo Muzio, L. Resveratrol (3,5,4′-trihydroxystilbene) and its properties in oral diseases. Exp. Ther. Med. 2017, 14, 3–9. [Google Scholar] [CrossRef]
- Gülçin, İ. Antioxidant properties of resveratrol: A structure–activity insight. Innov. Food Sci. Emerg. Technol. 2010, 11, 210–218. [Google Scholar] [CrossRef]
- Gambini, J.; Inglés, M.; Olaso, G.; Lopez-Grueso, R.; Bonet-Costa, V.; Gimeno-Mallench, L.; Mas-Bargues, C.; Abdelaziz, K.M.; Gomez-Cabrera, M.C.; Vina, J.; et al. Properties of resveratrol: In vitro and in vivo studies about metabolism, bioavailability, and biological effects in animal models and humans. Oxid. Med. Cell. Longev. 2015, 2015, 837042. [Google Scholar] [CrossRef]
- de Sá Coutinho, D.; Pacheco, M.T.; Frozza, R.L.; Bernardi, A. Anti-inflammatory effects of resveratrol: Mechanistic insights. Int. J. Mol. Sci. 2018, 19, 1812. [Google Scholar] [CrossRef]
- Liu, F.C.; Tsai, Y.F.; Tsai, H.I.; Yu, H.P. Anti-inflammatory and organ-protective effects of resveratrol in trauma-hemorrhagic injury. Mediators Inflamm. 2015, 2015, 643763. [Google Scholar] [CrossRef]
- Li, J.; Feng, L.; Xing, Y.; Wang, Y.; Du, L.; Xu, C.; Cao, J.; Wang, Q.; Fan, S.; Liu, Q.; et al. Radioprotective and antioxidant effect of resveratrol in hippocampus by activating Sirt1. Int. J. Mol. Sci. 2014, 15, 5928–5939. [Google Scholar] [CrossRef]
- Zhang, J.; Chen, J.; Yang, J.; Xu, C.W.; Pu, P.; Ding, J.W.; Jiang, H. Resveratrol attenuates oxidative stress induced by balloon injury in the rat carotid artery through actions on the ERK1/2 and NF-kappa B pathway. Cell. Physiol. Biochem. 2013, 31, 230–241. [Google Scholar] [CrossRef]
- Zheng, Y.; Liu, Y.; Ge, J.; Wang, X.; Liu, L.; Bu, Z.; Liu, P. Resveratrol protects human lens epithelial cells against H2O2-induced oxidative stress by increasing catalase, SOD-1, and HO-1 expression. Mol. Vis. 2010, 16, 1467. [Google Scholar]
- Yu, H.P.; Hwang, T.L.; Hsieh, P.W.; Lau, Y.T. Role of estrogen receptor-dependent upregulation of P38 MAPK/heme oxygenase 1 in resveratrol-mediated attenuation of intestinal injury after trauma-hemorrhage. Shock 2011, 35, 517–523. [Google Scholar] [CrossRef]
- Chung, K.O.; Kim, B.Y.; Lee, M.H.; Kim, Y.R.; Chung, H.Y.; Park, J.H.; Moon, J.O. In-vitro and in-vivo anti-inflammatory effect of oxyresveratrol from Morus alba L. J. Pharm. Pharmacol. 2003, 55, 1695–1700. [Google Scholar] [CrossRef]
- Kasikorn, T.; Panyatip, P.; Yongram, C.; Dokkiang, O.; Sungthong, B.; Puthongking, P. The antioxidant activities, total phenolic, flavonoid and melatonin contents of five cultivars of mulberry leaves. J. Tradit. Thai Altern. Med. 2019, 17, 428–436. [Google Scholar]
- Tungmunnithum, D.; Thongboonyou, A.; Pholboon, A.; Yangsabai, A. Flavonoids and other phenolic compounds from medicinal plants for pharmaceutical and medical aspects: An overview. Medicines 2018, 5, 93. [Google Scholar] [CrossRef]
- Chen, H.; Pu, J.; Liu, D.; Yu, W.; Shao, Y.; Yang, G.; Xiang, Z.; He, N. Anti-inflammatory and antinociceptive properties of flavonoids from the fruits of black mulberry (Morus nigra L.). PLoS ONE 2016, 11, e0153080. [Google Scholar] [CrossRef]
- Kim, D.S.; Kang, Y.M.; Jin, W.Y.; Sung, Y.Y.; Choi, G.; Kim, H.K. Antioxidant activities and polyphenol content of Morus alba leaf extracts collected from varying regions. Biomed. Rep. 2014, 2, 675–680. [Google Scholar] [CrossRef]
- Tomczyk, M.; Miłek, M.; Sidor, E.; Kapusta, I.; Litwińczuk, W.; Puchalski, C.; Dżugan, M. The effect of adding the leaves and fruits of Morus alba to rape honey on its antioxidant properties, polyphenolic profile, and amylase activity. Molecules 2020, 25, 84. [Google Scholar] [CrossRef]
- Park, E.; Lee, S.M.; Eun Lee, J.; Kim, J.H. Anti-inflammatory activity of mulberry leaf extract through inhibition of NF-κB. J. Funct. Foods 2013, 5, 178–186. [Google Scholar] [CrossRef]
- Xie, Y.; Chen, J.; Xiao, A.; Liu, L. Antibacterial activity of polyphenols: Structure-activity relationship and influence of hyperglycemic condition. Molecules 2017, 22, 1913. [Google Scholar] [CrossRef]
- Lee, H.S.; Kim, D.H.; Hong, J.E.; Lee, J.Y.; Kim, E.J. Oxyresveratrol suppresses lipopolysaccharide-induced inflammatory responses in murine macrophages. Hum. Exp. Toxicol. 2015, 34, 808–818. [Google Scholar] [CrossRef]
- Pahwa, R.; Goyal, A.; Jialal, I. Chronic Inflammation. StatPearls. Available online: https://www.ncbi.nlm.nih.gov/books/NBK493173/ (accessed on 27 December 2022).
- Rao, P.; Knaus, E.E. Evolution of nonsteroidal anti-inflammatory drugs (NSAIDs): Cyclooxygenase (COX) inhibition and beyond. J. Pharm. Pharm. Sci. 2008, 11, 81s–110s. [Google Scholar] [CrossRef]
- Ghlichloo, I.; Gerriets, V. Nonsteroidal Anti-Inflammatory Drugs (NSAIDs). StatPearls. Available online: https://www.ncbi.nlm.nih.gov/books/NBK547742/ (accessed on 27 December 2022).
- Hwang, J.H.; Ma, J.N.; Park, J.H.; Jung, H.W.; Park, Y.K. Anti-inflammatory and antioxidant effects of MOK, a polyherbal extract, on lipopolysaccharide stimulated RAW 264.7 macrophages. Int. J. Mol. Med. 2019, 43, 26–36. [Google Scholar] [CrossRef]
- Li, C.; Yang, D.; Cao, X.; Wang, F.; Jiang, H.; Guo, H.; Du, L.; Guo, Q.; Yin, X. LFG-500, a newly synthesized flavonoid, attenuates lipopolysaccharide-induced acute lung injury and inflammation in mice. Biochem. Pharmacol. 2016, 113, 57–69. [Google Scholar] [CrossRef]
- Saijo, F.; Milsom, A.B.; Bryan, N.S.; Bauer, S.M.; Vowinkel, T.; Ivanovic, M.; Andry, C.; Granger, D.N.; Rodriguez, J.; Feelisch, M. On the dynamics of nitrite, nitrate and other biomarkers of nitric oxide production in inflammatory bowel disease. Nitric Oxide 2010, 22, 155–167. [Google Scholar] [CrossRef]
- Bajpai, V.K.; Alam, M.B.; Quan, K.T.; Ju, M.K.; Majumder, R.; Shukla, S.; Huh, Y.S.; Na, M.K.; Lee, S.H.; Han, Y.K. Attenuation of inflammatory responses by (+)-syringaresinol via MAP-Kinase-mediated suppression of NF-κB signaling in vitro and in vivo. Sci. Rep. 2018, 8, 9216. [Google Scholar] [CrossRef]
- Barot, M.; Patel, M.; Kwatra, D.; Mitra, A.K. Transporter–metabolism interplay in the eye. In Ocular Transporters and Receptors; Mitra, A.K., Ed.; Woodhead Publishing: Cambridge, UK, 2013; pp. 229–248. [Google Scholar]
- Leung, A.K.W.; Ramesh, N.; Vogel, C.; Unniappan, S. Nucleobindins and encoded peptides: From cell signaling to physiology. Adv. Protein Chem. Struct. Biol. 2019, 116, 91–133. [Google Scholar]
- Chen, Y.C.; Shen, S.C.; Lee, W.R.; Hou, W.C.; Yang, L.L.; Lee, T.J. Inhibition of nitric oxide synthase inhibitors and lipopolysaccharide induced inducible NOS and cyclooxygenase-2 gene expressions by rutin, quercetin, and quercetin pentaacetate in RAW 264.7 macrophages. J. Cell. Biochem. 2001, 82, 537–548. [Google Scholar] [CrossRef]
- Kim, D.; Kang, K.H. Anti-inflammatory and anti-bacterial potential of mulberry leaf extract on oral microorganisms. Int. J. Environ. Res. Public Health 2022, 19, 4984. [Google Scholar] [CrossRef]
- Lin, Z.; Gan, T.; Huang, Y.; Bao, L.; Liu, S.; Cui, X.; Wang, H.; Jiao, F.; Zhang, M.; Su, C.; et al. Anti-Inflammatory activity of mulberry leaf flavonoids in vitro and in vivo. Int. J. Mol. Sci. 2022, 23, 7694. [Google Scholar] [CrossRef]
- Hussein, S.Z.; Mohd Yusoff, K.; Makpol, S.; Mohd Yusof, Y.A. Gelam honey attenuates carrageenan-induced rat paw inflammation via NF-κB pathway. PLoS ONE 2013, 8, e72365. [Google Scholar] [CrossRef]
- Surh, Y.J.; Chun, K.S.; Cha, H.H.; Han, S.S.; Keum, Y.S.; Park, K.K.; Lee, S.S. Molecular mechanisms underlying chemopreventive activities of anti-inflammatory phytochemicals: Down-regulation of COX-2 and iNOS through suppression of NF-κB activation. Mutat. Res.—Fundam. Mol. Mech. Mutagen. 2001, 480, 243–268. [Google Scholar] [CrossRef]
- Švajger, U.; Jeras, M. Anti-inflammatory effects of resveratrol and its potential use in therapy of immune-mediated diseases. Int. Rev. Immunol. 2012, 31, 202–222. [Google Scholar] [CrossRef]
- Subbaramaiah, K.; Chung, W.J.; Michaluart, P.; Telang, N.; Tanabe, T.; Inoue, H.; Jang, M.; Pezzuto, J.M.; Dannenberg, A.J. Resveratrol inhibits cyclooxygenase-2 transcription and activity in phorbol ester-treated human mammary epithelial cells. J. Biol. Chem. 1998, 273, 21875–21882. [Google Scholar] [CrossRef]
- Tsai, S.H.; Lin-Shiau, S.Y.; Lin, J.K. Suppression of nitric oxide synthase and the down-regulation of the activation of NFκB in macrophages by resveratrol. Br. J. Pharmacol. 1999, 126, 673–680. [Google Scholar] [CrossRef]
- Cho, D.I.; Koo, N.Y.; Chung, W.J.; Kim, T.S.; Ryu, S.Y.; Im, S.Y.; Kim, K.M. Effects of resveratrol-related hydroxystilbenes on the nitric oxide production in macrophage cells: Structural requirements and mechanism of action. Life Sci. 2002, 71, 2071–2082. [Google Scholar] [CrossRef]
- Martinez, J.; Moreno, J.J. Effect of resveratrol, a natural polyphenolic compound, on reactive oxygen species and prostaglandin production. Biochem. Pharmacol. 2000, 59, 865–870. [Google Scholar] [CrossRef]
- Csiszar, A.; Smith, K.; Labinskyy, N.; Orosz, Z.; Rivera, A.; Ungvari, Z. Resveratrol attenuates TNF-α-induced activation of coronary arterial endothelial cells: Role of NF-κB inhibition. Am. J. Physiol. Heart Circ. Physiol. 2006, 291, H1694–H1699. [Google Scholar] [CrossRef]
- Phoolcharoen, W.; Sooampon, S.; Sritularak, B.; Likhitwitayawuid, K.; Kuvatanasuchati, J.; Pavasant, P. Anti-periodontal pathogen and anti-inflammatory activities of oxyresveratrol. Nat. Prod. Commun. 2013, 8, 1934578X1300800518. [Google Scholar] [CrossRef]
- Choi, E.M.; Hwang, J.K. Effects of Morus alba leaf extract on the production of nitric oxide, prostaglandin E2 and cytokines in RAW264. 7 macrophages. Fitoterapia 2005, 76, 608–613. [Google Scholar] [CrossRef]
- Zhang, L.; Ravipati, A.S.; Koyyalamudi, S.R.; Jeong, S.C.; Reddy, N.; Smith, P.T.; Bartlett, J.; Shanmugam, K.; Münch, G.; Wu, M.J. Antioxidant and anti-inflammatory activities of selected medicinal plants containing phenolic and flavonoid compounds. J. Agric. Food Chem. 2011, 59, 12361–12367. [Google Scholar] [CrossRef]
- Ambriz-Pérez, D.L.; Leyva-López, N.; Gutierrez-Grijalva, E.P.; Heredia, J.B. Phenolic compounds: Natural alternative in inflammation treatment. A Review. Cogent Food Agric. 2016, 2, 1131412. [Google Scholar]
- Rabeta, M.S.; Faraniza, R.N. Total phenolic content and ferric reducing antioxidant power of the leaves and fruits of Garcinia atrovirdis and Cynometra cauliflora. Int. Food Res. J. 2013, 20, 1691. [Google Scholar]
- Formagio, A.S.N.; Volobuff, C.R.F.; Santiago, M.; Cardoso, C.A.L.; Vieira, M.D.C.; Valdevina Pereira, Z. Evaluation of antioxidant activity, total flavonoids, tannins and phenolic compounds in Psychotria leaf extracts. Antioxidants 2014, 3, 745–757. [Google Scholar] [CrossRef]
- Hosseinian, F.S.; Li, W.; Beta, T. Measurement of anthocyanins and other phytochemicals in purple wheat. Food Chem. 2008, 109, 916–924. [Google Scholar] [CrossRef]
- Elfalleh, W.; Nasri, N.; Marzougui, N.; Thabti, I.; M’rabet, A.; Yahya, Y.; Lachiheb, B.; Guasmi, F.; Ferchichi, A. Physico-chemical properties and DPPH-ABTS scavenging activity of some local pomegranate (Punica granatum) ecotypes. Int. J. Food Sci. Nutr. 2009, 60, 197–210. [Google Scholar] [CrossRef]
- Ghosh, C.; Hong, B.; Batabyal, S.; Jeon, T.I.; Yang, S.H.; Hwang, S.G. Anti-inflammatory activity of the ethanol extract of Dictamnus dasycarpus leaf in lipopolysaccharide-activated macrophages. BMC Complement. Altern. Med. 2014, 14, 9216. [Google Scholar] [CrossRef]
- Cho, Y.S.; Lee, S.H.; Kim, S.K.; Ahn, C.B.; Je, J.Y. Aminoethyl-chitosan inhibits LPS-induced inflammatory mediators, iNOS and COX-2 expression in RAW264. 7 mouse macrophages. Process Biochem 2011, 46, 465–470. [Google Scholar] [CrossRef]
- Taddesse, Y.; Im, E.J.; Kwak, D.; Lee, Y.C.; Hyun, E.; Hong, M.; Jiao, P.; Jia, Q.; Goo, Y.K.; Hong, S.B.; et al. Stellera chamaejasme methanolic extract attenuates nitric oxide production and enhances heme oxygenase 1 expression in murine macrophages. Chiang Mai J. Sci. 2017, 44, 858–868. [Google Scholar]
- He, J.; Li, J.; Liu, H.; Yang, Z.; Zhou, F.; Wei, T.; Dong, T.; Xue, H.; Tang, L.; Liu, M. Scandoside exerts anti-inflammatory effect via suppressing NF-κB and MAPK signaling pathways in LPS-induced RAW 264.7 macrophages. Int. J. Mol. Sci. 2018, 19, 457. [Google Scholar] [CrossRef]
Cultivars | Total Phenolic Content (mg GAE/g Extract) | Total Flavonoid Content (mg QE/g Extract) |
---|---|---|
Sakon Nakhon | 49.68 ± 1.41 a | 0.90 ± 0.01 b |
Buriram | 27.27 ± 2.28 b | 1.46 ± 0.27 a |
Cultivars | DPPH | ABTS | FRAP (mg FeSO4/g Extract) | ||
---|---|---|---|---|---|
IC50 (mg/mL) | Antioxidant Activity (mg GAE/g Extract) | IC50 (mg/mL) | Antioxidant Activity (mg TEAC/g Extract) | ||
Sakon Nakhon | 0.78 ± 0.08 b | 4.38 ± 0.48 a | 4.89 ± 1.18 b | 4.53 ± 1.11 a | 92.78 ± 1.40 a |
Buriram | 1.67 ± 0.21 a | 2.33 ± 0.62 b | 15.08 ± 3.76 a | 1.47 ± 0.36 b | 69.30 ± 3.70 b |
Genes | Sense Primer Sequence 5′-3′ | Antisense Primer Sequence 5′-3′ | References |
---|---|---|---|
iNOS | TTCCAGAATCCCTGGACAAGC | TGGTCAAACTCTTGGGGTTCG | [60] |
COX-2 | AGAAGGAAATGGCTGCAGAA | GCTCGGCTTCCAGTATTGAG | [60] |
TNF-α | AGCCCCCAGTCTGTATCCTTC | CATTCGAGGCTCCAGTGAATTCG | [60] |
IL-6 | GCTGGAGTCACAGAAGGAGTG | GCATAACGCACTAGGTTTGCC | [61] |
β-actin | TGCTGTCCCTGTATGCCTCTG | GCTGTAGCCACGCTCGGTCA | [62] |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Suriyaprom, S.; Srisai, P.; Intachaisri, V.; Kaewkod, T.; Pekkoh, J.; Desvaux, M.; Tragoolpua, Y. Antioxidant and Anti-Inflammatory Activity on LPS-Stimulated RAW 264.7 Macrophage Cells of White Mulberry (Morus alba L.) Leaf Extracts. Molecules 2023, 28, 4395. https://doi.org/10.3390/molecules28114395
Suriyaprom S, Srisai P, Intachaisri V, Kaewkod T, Pekkoh J, Desvaux M, Tragoolpua Y. Antioxidant and Anti-Inflammatory Activity on LPS-Stimulated RAW 264.7 Macrophage Cells of White Mulberry (Morus alba L.) Leaf Extracts. Molecules. 2023; 28(11):4395. https://doi.org/10.3390/molecules28114395
Chicago/Turabian StyleSuriyaprom, Sureeporn, Pitchayuth Srisai, Varachaya Intachaisri, Thida Kaewkod, Jeeraporn Pekkoh, Mickaël Desvaux, and Yingmanee Tragoolpua. 2023. "Antioxidant and Anti-Inflammatory Activity on LPS-Stimulated RAW 264.7 Macrophage Cells of White Mulberry (Morus alba L.) Leaf Extracts" Molecules 28, no. 11: 4395. https://doi.org/10.3390/molecules28114395