Network Analysis and Experimental Verification of the Mechanisms of Hydroxysafflor Yellow A in Ischemic Stroke Following Atherosclerosis
Abstract
:1. Introduction
2. Results
2.1. Identification of the Shared Targets between HSYA and ISFA
2.2. HSYA–ISFA Target Pathway Network Construction
2.3. PPI Network Construction
2.4. GO and KEGG Pathway Enrichment Analyses
2.5. Molecular Docking
2.6. Assessment of Carotid Ultrasound and Effects of HSYA on Arterial Plaque
2.7. Effects of HSYA on Blood Lipid Levels
2.8. Assessment of Rat Models of MCAO
2.9. Effects of HSYA on the Histopathological Changes in Rats with ISFA
2.10. Effects of HSYA on the Expression of PRKCA, IKBKB, STAT3, and NF-κB in Rat Brain Tissue
2.11. Effects of HSYA on the mRNA Levels of EP300, PRKCA, IKBKB, and STAT3 in Rat Brain Tissue
2.12. Effects of HSYA on the IL-1β Level in Rat Serum
3. Discussion
4. Materials and Methods
4.1. Identifying HSYA Genes Associated with ISFA
4.2. Construction of the Protein–Protein Interaction Network
4.3. Gene Ontology and Kyoto Encyclopedia of Genes and Genomes Pathway Enrichment Analyses
4.4. Chemicals and Reagents
4.4.1. Preparing for Animals
4.4.2. Construction of a Rat Model of ISFA
4.5. Neurological Scores
4.6. Carotid Ultrasound and Imaging [30]
4.7. 2,3,5-Triphenyltetrazolium Chloride Staining (TTC)
4.8. Biochemical Detection in Serum
4.9. Quantitative Real-Time PCR (RT-qPCR)
4.10. Enzyme-Linked Immunosorbent Assay
4.11. Hematoxylin and Eosin, Immunohistochemical Staining, and Oil Red O Staining
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
Abbreviations
References
- Chen, W.; Wang, H.; Feng, J.; Chen, L. Overexpression of circRNA circUCK2 Attenuates Cell Apoptosis in Cerebral Ischemia-Reperfusion Injury via miR-125b-5p/GDF11 Signaling. Mol. Ther. Nucleic Acids 2020, 22, 673–683. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; He, Y.; Wei, X.; Wan, H.; Ding, Z.; Yang, J.; Zhou, H. Network Pharmacology and Molecular Docking-Based Mechanism Study to Reveal the Protective Effect of Salvianolic Acid C in a Rat Model of Ischemic Stroke. Front. Pharmacol. 2021, 12, 799448. [Google Scholar] [CrossRef] [PubMed]
- Libby, P.; Buring, J.; Badimon, L.; Hansson, G.K.; Deanfield, J.; Bittencourt, M.S.; Tokgözoğlu, L. Atherosclerosis. Nat. Rev. Dis. Primers 2019, 5, 56. [Google Scholar] [CrossRef] [PubMed]
- Ntaios, G.; Swaminathan, B.; Berkowitz, S.D.; Gagliardi, R.J.; Lang, W.; Siegler, J.E.; Lavados, P.; Mundl, H.; Bornstein, N.; Meseguer, E.; et al. Efficacy and Safety of Rivaroxaban Versus Aspirin in Embolic Stroke of Undetermined Source and Carotid Atherosclerosis. Stroke 2019, 50, 2477–2485. [Google Scholar] [CrossRef] [PubMed]
- Banerjee, C.; Chimowitz, M.I. Stroke Caused by Atherosclerosis of the Major Intracranial Arteries. Circ. Res. 2017, 120, 502–513. [Google Scholar] [CrossRef] [PubMed]
- Yu, L.; Liu, Z.; He, W.; Chen, H.; Lai, Z.; Duan, Y.; Cao, X.; Tao, J.; Xu, C.; Zhang, Q.; et al. Hydroxysafflor Yellow A Confers Neuroprotection from Focal Cerebral Ischemia by Modulating the Crosstalk between JAK2/STAT3 and SOCS3 Signaling Pathways. Cell. Mol. Neurobiol. 2020, 40, 1271–1281. [Google Scholar] [CrossRef]
- Chen, L.; Xiang, Y.; Kong, L.; Zhang, X.; Sun, B.; Wei, X.; Liu, H. Hydroxysafflor yellow A protects against cerebral ischemia-reperfusion injury by anti-apoptotic effect through PI3K/Akt/GSK3β pathway in rat. Neurochem. Res. 2013, 38, 2268–2275. [Google Scholar] [CrossRef]
- Pei, J.P.; Fan, L.H.; Nan, K.; Li, J.; Dang, X.Q.; Wang, K.Z. HSYA alleviates secondary neuronal death through attenuating oxidative stress, inflammatory response, and neural apoptosis in SD rat spinal cord compression injury. J. Neuroinflamm. 2017, 14, 97. [Google Scholar] [CrossRef]
- Xue, X.; Deng, Y.; Wang, J.; Zhou, M.; Liao, L.; Wang, C.; Peng, C.; Li, Y. Hydroxysafflor yellow A, a natural compound from Carthamus tinctorius L with good effect of alleviating atherosclerosis. Phytomed. Int. J. Phytother. Phytopharm. 2021, 91, 153694. [Google Scholar] [CrossRef]
- Li, T.; Zhang, W.; Hu, E.; Sun, Z.; Li, P.; Yu, Z.; Zhu, X.; Zheng, F.; Xing, Z.; Xia, Z.; et al. Integrated metabolomics and network pharmacology to reveal the mechanisms of hydroxysafflor yellow A against acute traumatic brain injury. Comput. Struct. Biotechnol. J. 2021, 19, 1002–1013. [Google Scholar] [CrossRef]
- Li, L.; Dai, W.; Li, W.; Zhang, Y.; Wu, Y.; Guan, C.; Zhang, A.; Huang, H.; Li, Y. Integrated Network Pharmacology and Metabonomics to Reveal the Myocardial Protection Effect of Huang-Lian-Jie-Du-Tang on Myocardial Ischemia. Front. Pharmacol. 2020, 11, 589175. [Google Scholar] [CrossRef] [PubMed]
- Xiao, P.T.; Liu, S.Y.; Kuang, Y.J.; Jiang, Z.M.; Lin, Y.; Xie, Z.S.; Liu, E.H. Network pharmacology analysis and experimental validation to explore the mechanism of sea buckthorn flavonoids on hyperlipidemia. J. Ethnopharmacol. 2021, 264, 113380. [Google Scholar] [CrossRef] [PubMed]
- Appunni, S.; Gupta, D.; Rubens, M.; Ramamoorthy, V.; Singh, H.N.; Swarup, V. Deregulated Protein Kinases: Friend and Foe in Ischemic Stroke. Mol. Neurobiol. 2021, 58, 6471–6489. [Google Scholar] [CrossRef] [PubMed]
- Yu, H.; Wang, P.; An, P.; Yixue, X. Recombinant human angiopoietin-1 ameliorates the expressions of ZO-1, occludin, VE-cadherin, and PKCα signaling after focal cerebral ischemia/reperfusion in rats. J. Mol. Neurosci. 2012, 46, 236–247. [Google Scholar] [CrossRef] [PubMed]
- Chernikov, O.V.; Chiu, H.W.; Li, L.H.; Kokoulin, M.S.; Molchanova, V.I.; Hsu, H.T.; Ho, C.L.; Hua, K.F. Immunomodulatory Properties of Polysaccharides from the Coral Pseudopterogorgia americana in Macrophages. Cells 2021, 10, 3531. [Google Scholar] [CrossRef] [PubMed]
- Kaminska, B.; Mota, M.; Pizzi, M. Signal transduction and epigenetic mechanisms in the control of microglia activation during neuroinflammation. Biochim. Biophys. Acta 2016, 1862, 339–351. [Google Scholar] [CrossRef] [PubMed]
- Cho, I.H.; Hong, J.; Suh, E.C.; Kim, J.H.; Lee, H.; Lee, J.E.; Lee, S.; Kim, C.H.; Kim, D.W.; Jo, E.K.; et al. Role of microglial IKKbeta in kainic acid-induced hippocampal neuronal cell death. Brain J. Neurol. 2008, 131 Pt 11, 3019–3033. [Google Scholar] [CrossRef]
- Liu, L.; Doran, S.; Xu, Y.; Manwani, B.; Ritzel, R.; Benashski, S.; McCullough, L.; Li, J. Inhibition of mitogen-activated protein kinase phosphatase-1 (MKP-1) increases experimental stroke injury. Exp. Neurol. 2014, 261, 404–411. [Google Scholar] [CrossRef]
- Zhang, X.; Zhang, G.; Zhang, H.; Karin, M.; Bai, H.; Cai, D. Hypothalamic IKKbeta/NF-kappaB and ER stress link overnutrition to energy imbalance and obesity. Cell 2008, 135, 61–73. [Google Scholar] [CrossRef]
- Ogura, H.; Murakami, M.; Okuyama, Y.; Tsuruoka, M.; Kitabayashi, C.; Kanamoto, M.; Nishihara, M.; Iwakura, Y.; Hirano, T. Interleukin-17 promotes autoimmunity by triggering a positive-feedback loop via interleukin-6 induction. Immunity 2008, 29, 628–636. [Google Scholar] [CrossRef]
- Li, Y.; Zhang, X.; Cui, L.; Chen, R.; Zhang, Y.; Zhang, C.; Zhu, X.; He, T.; Shen, Z.; Dong, L.; et al. Salvianolic acids enhance cerebral angiogenesis and neurological recovery by activating JAK2/STAT3 signaling pathway after ischemic stroke in mice. J. Neurochem. 2017, 143, 87–99. [Google Scholar] [CrossRef] [PubMed]
- Hoffmann, C.J.; Harms, U.; Rex, A.; Szulzewsky, F.; Wolf, S.A.; Grittner, U.; Lättig-Tünnemann, G.; Sendtner, M.; Kettenmann, H.; Dirnagl, U.; et al. Vascular signal transducer and activator of transcription-3 promotes angiogenesis and neuroplasticity long-term after stroke. Circulation 2015, 131, 1772–1782. [Google Scholar] [CrossRef] [PubMed]
- Qin, C.; Fan, W.H.; Liu, Q.; Shang, K.; Murugan, M.; Wu, L.J.; Wang, W.; Tian, D.S. Fingolimod Protects Against Ischemic White Matter Damage by Modulating Microglia Toward M2 Polarization via STAT3 Pathway. Stroke 2017, 48, 3336–3346. [Google Scholar] [CrossRef] [PubMed]
- Xu, Q.; Briggs, J.; Park, S.; Niu, G.; Kortylewski, M.; Zhang, S.; Gritsko, T.; Turkson, J.; Kay, H.; Semenza, G.L.; et al. Targeting Stat3 blocks both HIF-1 and VEGF expression induced by multiple oncogenic growth signaling pathways. Oncogene 2005, 24, 5552–5560. [Google Scholar] [CrossRef]
- Srivastava, R. Chemical Reactivity and Optical and Pharmacokinetics Studies of 14 Multikinase Inhibitors and Their Docking Interactions Toward ACK1 for Precision Oncology. Front. Chem. 2022, 10, 843642. [Google Scholar] [CrossRef] [PubMed]
- Zhong, S.; Wu, B.; Wang, X.; Sun, D.; Liu, D.; Jiang, S.; Ge, J.; Zhang, Y.; Liu, X.; Zhou, X.; et al. Identification of driver genes and key pathways of prolactinoma predicts the therapeutic effect of genipin. Mol. Med. Rep. 2019, 20, 2712–2724. [Google Scholar] [CrossRef] [PubMed]
- Thome, T.; Miguez, K.; Willms, A.J.; Burke, S.K.; Chandran, V.; de Souza, A.R.; Fitzgerald, L.F.; Baglole, C.; Anagnostou, M.E.; Bourbeau, J.; et al. Chronic aryl hydrocarbon receptor activity phenocopies smoking-induced skeletal muscle impairment. J. Cachexia Sarcopenia Muscle 2022, 13, 589–604. [Google Scholar] [CrossRef]
- Kim, J.; Jakobsen, S.T.; Natarajan, K.N.; Won, K.J. TENET: Gene network reconstruction using transfer entropy reveals key regulatory factors from single cell transcriptomic data. Nucleic Acids Res. 2021, 49, e1. [Google Scholar] [CrossRef]
- Zeng, H.K.; Wang, Q.S.; Deng, Y.Y.; Jiang, W.Q.; Fang, M.; Chen, C.B.; Jiang, X. A comparative study on the efficacy of 10% hypertonic saline and equal volume of 20% mannitol in the treatment of experimentally induced cerebral edema in adult rats. BMC Neurosci. 2010, 11, 153. [Google Scholar] [CrossRef]
- Zhang, S.; Liu, H.; Fang, Q.; He, H.; Lu, X.; Wang, Y.; Fan, X. Shexiang Tongxin Dropping Pill Protects Against Chronic Heart Failure in Mice via Inhibiting the ERK/MAPK and TGF-β Signaling Pathways. Front. Pharmacol. 2021, 12, 796354. [Google Scholar] [CrossRef]
Rank | Name | Score | Rank | Name | Score |
---|---|---|---|---|---|
1 | STAT3 | 60 | 11 | IL1B | 10 |
2 | EGFR | 50 | 12 | PTPN2 | 7 |
3 | HSP90AA1 | 31 | 12 | PTPN1 | 7 |
4 | PIK3CA | 29 | 14 | TERT | 6 |
5 | MTOR | 25 | 15 | IKBKB | 5 |
6 | AR | 20 | 16 | MCL1 | 4 |
7 | MET | 18 | 17 | PTGS2 | 3 |
8 | EP300 | 16 | 17 | APP | 3 |
9 | JUN | 14 | 17 | KDR | 3 |
9 | PRKCA | 14 | 17 | GSK3B | 3 |
Target | Binding Energy (kcal/mol) | Target | Binding Energy (kcal/mol) |
---|---|---|---|
IL-1β | −7.7 | STAT3 | −8.1 |
EP300 | −8.1 | PRKCA | −8.4 |
IKBKB | −8.1 |
Target | Forward (5′ to 3′) | Reverse (5′ to 3′) |
---|---|---|
EP300 | ACCTTCTCCTGTTCCTAGCCGTAC | AATTGCTGTTGCTGCTGGTTGTTG |
PRKCA | TCCCTTTCCTTCGGCGTCTCAG | CGTTGCCTTCTTCATCTCCTTCTGG |
STAT3 | AGGGCTTCTCGTTCTGGGTCTG | CTCCCGCTCCTTGCTGATGAAAC |
IKBKB | CTGGTAGAACGGATGATGGCACTG | TGGCTTCTCCCTGAGTCTTCTGTAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2023 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Han, X.; Zhou, H.; Yin, J.; Zhu, J.; Yang, J.; Wan, H. Network Analysis and Experimental Verification of the Mechanisms of Hydroxysafflor Yellow A in Ischemic Stroke Following Atherosclerosis. Molecules 2023, 28, 7829. https://doi.org/10.3390/molecules28237829
Han X, Zhou H, Yin J, Zhu J, Yang J, Wan H. Network Analysis and Experimental Verification of the Mechanisms of Hydroxysafflor Yellow A in Ischemic Stroke Following Atherosclerosis. Molecules. 2023; 28(23):7829. https://doi.org/10.3390/molecules28237829
Chicago/Turabian StyleHan, Xi, Huifen Zhou, Junjun Yin, Jiaqi Zhu, Jiehong Yang, and Haitong Wan. 2023. "Network Analysis and Experimental Verification of the Mechanisms of Hydroxysafflor Yellow A in Ischemic Stroke Following Atherosclerosis" Molecules 28, no. 23: 7829. https://doi.org/10.3390/molecules28237829