Ferulic Acid Interferes with Radioactive Intestinal Injury Through the DJ-1-Nrf2 and Sirt1-NF-κB-NLRP3 Pathways
Abstract
1. Introduction
2. Results
2.1. Effects of FA on MDA and SOD Content in Mice
2.2. Effects of FA on TNF-α and IL-6 Content in Mice
2.3. Effects of FA on Post-Radiation Intestine Tissue Injury in Mice
2.4. Effects of FA on mRNA and Protein Expression Levels of DJ-1 and Nrf2 in Post-Radiation Intestine Tissue in Mice
2.5. FA Inhibited the Expression of NLRP3 Protein in Post-Radiation Intestine Tissue in Mice
2.6. Effects of FA on the Levels of NLRP3, IL-18 and IL-1β in Intestine in Mice
2.7. Effects of FA on mRNA and Protein Expression Levels of Sirt1-NF-κB-NLRP3 Pathways in Post-Radiation Intestine Tissue in Mice
3. Discussion
4. Materials and Methods
4.1. Reagents
4.2. Mice and Treatment
4.3. Radiation
4.4. Sample and Tissue Preparation
4.5. Measurement of MDA and SOD Content
4.6. Intestine Tissue Inflammatory Cytokines TNF-α and IL-6 Detection
4.7. Histological Analysis
4.8. Immunofluorescence Detection of NLRP3 Protein Expression
4.9. The Expression Levels of NLRP3, IL-18 and IL1β Were Detected by ELISA
4.10. Quantitative Real-Time PCR
4.11. Western Blot
4.12. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Institutional Review Board Statement
Informed Consent Statement
Data Availability Statement
Conflicts of Interest
References
- Li, L.; Yue, H.C.; Han, Y.W.; Liu, W.; Xiong, L.G.; Zhang, J.W. Relationship between the invasion of lymphocytes and cytokines in the tumor microenvironment and the interval after single brachytherapy hypofractionated radiotherapy and conventional fractionation radiotherapy in non-small cell lung Cancer. BMC Cancer 2020, 20, 893. [Google Scholar] [CrossRef] [PubMed]
- Zhou, X.; Wang, H.; Li, D.; Song, N.; Yang, F.; Xu, W. MST1/2 inhibitor XMU-MP-1 alleviates the injury induced by ionizing radiation in haematopoietic and intestinal system. J. Cell Mol. Med. 2022, 26, 1621–1628. [Google Scholar] [CrossRef] [PubMed]
- Dolgacheva, L.P.; Berezhnov, A.V.; Fedotova, E.I.; Zinchenko, V.P.; Abramov, A.Y. Role of DJ-1 in the mechanism of pathogenesis of Parkinson’s disease. J. Bioenerg. Biomembr. 2019, 51, 175–188. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wang, J.; Wang, J.; Yang, B.; He, Q.; Weng, Q. Role of DJ-1 in Immune and Inflammatory Diseases. Front. Immunol. 2020, 11, 994. [Google Scholar] [CrossRef] [PubMed]
- van der Vlag, M.; Havekes, R.; Heckman, P.R.A. The contribution of Parkin, PINK1 and DJ-1 genes to selective neuronal degeneration in Parkinson’s disease. Eur. J. Neurosci. 2020, 52, 3256–3268. [Google Scholar] [CrossRef]
- Zhao, M.; Wang, B.; Zhang, C.; Su, Z.; Guo, B.; Zhao, Y.; Zheng, R. The DJ1-Nrf2-STING axis mediates the neuroprotective effects of Withaferin A in Parkinson’s disease. Cell Death Differ. 2021, 28, 2517–2535. [Google Scholar] [CrossRef]
- Chen, R.; Li, W.; Qiu, Z.; Zhou, Q.; Zhang, Y.; Li, W.Y.; Ding, K.; Meng, Q.T.; Xia, Z.Y. Ischemic Postconditioning-Mediated DJ-1 Activation Mitigate Intestinal Mucosa Injury Induced by Myocardial Ischemia Reperfusion in Rats Through Keap1/Nrf2 Pathway. Front. Mol. Biosci. 2021, 8, 655619. [Google Scholar] [CrossRef]
- Qin, H.; Zhang, H.; Zhang, X.; Zhang, S.; Zhu, S.; Wang, H. Resveratrol protects intestinal epithelial cells against radiation-induced damage by promoting autophagy and inhibiting apoptosis through SIRT1 activation. J. Radiat. Res. 2021, 62, 574–581. [Google Scholar] [CrossRef]
- Salminen, A.; Ojala, J.; Huuskonen, J.; Kauppinen, A.; Suuronen, T.; Kaarniranta, K. Interaction of aging-associated signaling cascades: Inhibition of NF-kappaB signaling by longevity factors FoxOs and SIRT1. Cell Mol. Life Sci. 2008, 65, 1049–1058. [Google Scholar] [CrossRef]
- Fu, Y.; Wang, Y.; Du, L.; Xu, C.; Cao, J.; Fan, T.; Liu, J.; Su, X.; Fan, S.; Liu, Q.; et al. Resveratrol inhibits ionising irradiation-induced inflammation in MSCs by activating SIRT1 and limiting NLRP-3 inflammasome activation. Int. J. Mol. Sci. 2013, 14, 14105–14118. [Google Scholar] [CrossRef]
- Abderrazak, A.; Syrovets, T.; Couchie, D.; El Hadri, K.; Friguet, B.; Simmet, T.; Rouis, M. NLRP3 inflammasome: From a danger signal sensor to a regulatory node of oxidative stress and inflammatory diseases. Redox Biol. 2015, 4, 296–307. [Google Scholar] [CrossRef]
- Wei, J.; Wang, H.; Wang, H.; Wang, B.; Meng, L.; Xin, Y.; Jiang, X. The role of NLRP3 inflammasome activation in radiation damage. Biomed. Pharmacother. 2019, 118, 109217. [Google Scholar] [CrossRef]
- Mancuso, C.; Santangelo, R. Ferulic acid: Pharmacological and toxicological aspects. Food Chem. Toxicol. 2014, 65, 185–195. [Google Scholar] [CrossRef]
- Huang, M.; Ye, A.; Zhang, H.; Chen, J.; Yang, T.; Wei, X.; Gao, Y.; Ma, Z. Ferulic Acid Alleviates Radiation-Induced Immune Damage by Acting on JAK/STAT Signaling Pathway. Pharmaceuticals 2024, 17, 1175. [Google Scholar] [CrossRef]
- Ma, Z.C.; Hong, Q.; Wang, Y.G.; Tan, H.L.; Xiao, C.R.; Liang, Q.D.; Wang, D.G.; Gao, Y. Ferulic acid protects lymphocytes from radiation-predisposed oxidative stress through extracellular regulated kinase. Int. J. Radiat. Biol. 2011, 87, 130–140. [Google Scholar] [CrossRef]
- Liu, G.; Nie, Y.; Huang, C.; Zhu, G.; Zhang, X.; Hu, C.; Li, Z.; Gao, Y.; Ma, Z. Ferulic acid produces neuroprotection against radiation-induced neuroinflammation by affecting NLRP3 inflammasome activation. Int. J. Radiat. Biol. 2022, 98, 1442–1451. [Google Scholar] [CrossRef]
- Zhang, D.; Jing, B.; Chen, Z.N.; Li, X.; Shi, H.M.; Zheng, Y.C.; Chang, S.Q.; Gao, L.; Zhao, G.P. Ferulic acid alleviates sciatica by inhibiting neuroinflammation and promoting nerve repair via the TLR4/NF-κB pathway. CNS Neurosci. Ther. 2023, 29, 1000–1011. [Google Scholar] [CrossRef]
- Ma, Z.C.; Hong, Q.; Wang, Y.G.; Tan, H.L.; Xiao, C.R.; Liang, Q.D.; Lu, B.B.; Gao, Y. Effects of ferulic acid on hematopoietic cell recovery in whole-body gamma irradiated mice. Int. J. Radiat. Biol. 2011, 87, 499–505. [Google Scholar] [CrossRef]
- Chaudhary, A.; Jaswal, V.S.; Choudhary, S.; Sonika Sharma, A.; Beniwal, V.; Tuli, H.S.; Sharma, S. Ferulic Acid: A Promising Therapeutic Phytochemical and Recent Patents Advances. Recent Pat. Inflamm. Allergy Drug Discov. 2019, 13, 115–123. [Google Scholar] [CrossRef]
- Suzuki, T. Regulation of intestinal epithelial permeability by tight junctions. Cell Mol. Life Sci. 2013, 70, 631–659. [Google Scholar] [CrossRef]
- Zduńska, K.; Dana, A.; Kolodziejczak, A.; Rotsztejn, H. Antioxidant Properties of Ferulic Acid and Its Possible Application. Skin. Pharmacol. Physiol. 2018, 31, 332–336. [Google Scholar] [CrossRef]
- Asano, J.; Sato, T.; Ichinose, S.; Kajita, M.; Onai, N.; Shimizu, S.; Ohteki, T. Intrinsic Autophagy Is Required for the Maintenance of Intestinal Stem Cells and for Irradiation-Induced Intestinal Regeneration. Cell Rep. 2017, 20, 1050–1060. [Google Scholar] [CrossRef]
- Mittal, M.; Siddiqui, M.R.; Tran, K.; Reddy, S.P.; Malik, A.B. Reactive oxygen species in inflammation and tissue injury. Antioxid. Redox Signal 2014, 20, 1126–1167. [Google Scholar] [CrossRef]
- Meena, S.K.; Joriya, P.R.; Yadav, S.M.; Kumar, R.; Meena, P.; Patel, D.D. Modulation of radiation-induced intestinal injury by radioprotective agents: A cellular and molecular perspectives. Rev. Environ. Health 2023, 38, 295–311. [Google Scholar] [CrossRef]
- Dodson, M.; de la Vega, M.R.; Cholanians, A.B.; Schmidlin, C.J.; Chapman, E.; Zhang, D.D. Modulating NRF2 in Disease: Timing Is Everything. Annu. Rev. Pharmacol. Toxicol. 2019, 59, 555–575. [Google Scholar] [CrossRef]
- Huang, S.; Huang, Y.; Lin, W.; Wang, L.; Yang, Y.; Li, P.; Xiao, L.; Chen, Y.; Chu, Q.; Yuan, X. Sitagliptin Alleviates Radiation-Induced Intestinal Injury by Activating NRF2-Antioxidant Axis, Mitigating NLRP3 Inf--lammasome Activation, and Reversing Gut Microbiota Disorder. Oxid. Med. Cell Longev. 2022, 2022, 2586305. [Google Scholar] [CrossRef]
- Das, U.; Manna, K.; Sinha, M.; Datta, S.; Das, D.K.; Chakraborty, A.; Ghosh, M.; Saha, K.D.; Dey, S. Role of ferulic acid in the amelioration of ionizing radiation induced inflammation: A murine model. PLoS ONE 2014, 9, e97599. [Google Scholar] [CrossRef]
- Zhang, X.L.; Yuan, Y.H.; Shao, Q.H.; Wang, Z.Z.; Zhu, C.G.; Shi, J.G.; Ma, K.L.; Yan, X.; Chen, N.H. DJ-1 regulating PI3K-Nrf2 signaling plays a significant role in bibenzyl compound 20C-mediated neuroprotection against rotenone-induced oxidative insult. Toxicol. Lett. 2017, 271, 74–83. [Google Scholar] [CrossRef]
- Bonifati, V.; Rizzu, P.; van Baren, M.J.; Schaap, O.; Breedveld, G.J.; Krieger, E.; Dekker, M.C.; Squitieri, F.; Ibanez, P.; Joosse, M.; et al. Mutations in the DJ-1 gene associated with autosomal recessive early-onset parkinsonism. Science 2003, 299, 256–259. [Google Scholar] [CrossRef]
- Wang, X.; Petrie, T.G.; Liu, Y.; Liu, J.; Fujioka, H.; Zhu, X. Parkinson’s disease-associated DJ-1 mutations impair mitochondrial dynamics and cause mitochondrial dysfunction. J. Neurochem. 2012, 121, 830–839. [Google Scholar] [CrossRef]
- Cheng, Y.T.; Lin, J.A.; Jhang, J.J.; Yen, G.C. Protocatechuic acid-mediated DJ-1/PARK7 activation followed by PI3K/mTOR signaling pathway activation as a novel mechanism for protection against ketoprofen-induced oxidative damage in the gastrointestinal mucosa. Free Radic. Biol. Med. 2019, 130, 35–47. [Google Scholar] [CrossRef]
- Kayagaki, N.; Warming, S.; Lamkanfi, M.; Vande Walle, L.; Louie, S.; Dong, J.; Newton, K.; Qu, Y.; Liu, J.; Heldens, S.; et al. Non-canonical inflammasome activation targets caspase-11. Nature 2011, 479, 117–121. [Google Scholar] [CrossRef]
- Takeuchi, O.; Akira, S. Pattern recognition receptors and inflammation. Cell 2010, 140, 805–820. [Google Scholar] [CrossRef]
- Kummer, J.A.; Broekhuizen, R.; Everett, H.; Agostini, L.; Kuijk, L.; Martinon, F.; van Bruggen, R.; Tschopp, J. Inflammasome components NALP 1 and 3 show distinct but separate expression profiles in human tissues suggesting a site-specific role in the inflammatory response. J. Histochem. Cytochem. 2007, 55, 443–452. [Google Scholar] [CrossRef]
- Villani, A.C.; Lemire, M.; Fortin, G.; Louis, E.; Silverberg, M.S.; Collette, C.; Baba, N.; Libioulle, C.; Belaiche, J.; Bitton, A.; et al. Common variants in the NLRP3 region contribute to Crohn’s disease susceptibility. Nat. Genet. 2009, 41, 71–76. [Google Scholar] [CrossRef]
- Dinarello, C.A. IL-1: Discoveries, controversies and future directions. Eur. J. Immunol. 2010, 40, 599–606. [Google Scholar] [CrossRef]
- Maeda, S.; Hsu, L.C.; Liu, H.; Bankston, L.A.; Iimura, M.; Kagnoff, M.F.; Eckmann, L.; Karin, M. Nod2 mutation in Crohn’s disease potentiates NF-kappaB activity and IL-1beta processing. Science 2005, 307, 734–738. [Google Scholar] [CrossRef]
- Zhou, Z.; Ye, T.J.; DeCaro, E.; Buehler, B.; Stahl, Z.; Bonavita, G.; Daniels, M.; You, M. Intestinal SIRT1 Deficiency Protects Mice from Ethanol-Induced Liver Injury by Mitigating Ferroptosis. Am. J. Pathol. 2020, 190, 82–92. [Google Scholar] [CrossRef]
- El-Mesallamy, H.O.; Gawish, R.A.; Sallam, A.M.; Fahmy, H.A.; Nada, A.S. Ferulic acid protects against radiation-induced testicular damage in male rats: Impact on SIRT1 and PARP1. Environ. Sci. Pollut. Res. Int. 2018, 25, 6218–6227. [Google Scholar] [CrossRef]
Gene | Sense (5′-3′) | Sense (5′-3′) |
---|---|---|
Sirt1 | CAATCAGCTGTTGGTCAAGACT | GACAATGCAAGCTCTACCACAG |
NF-κB | ATGTGGAGATCATTGAGCAGC | CCTGGTCCTGTGTAGCCATT |
NLRP3 | AAGGGCCATGGACTATTTCC | GACTCCACCCGATGACAGTT |
Caspase-1 | TCCAATAATGCAAGTCAAGCC | GCTGTACCCCAGATTTTGTAGCA |
IL-18 | GACCTTCCAGATCGCTTCCTC | GATGCAATTGTCTTCTACTGGTTC |
IL-1β | CACGATGCACCTGTACGATCA | GTTGCTCCATATCCTGTCCCT |
β-actin | ACCCAGATCATGTTTGAGAC | GCATACAGGGACAACACAG |
Disclaimer/Publisher’s Note: The statements, opinions and data contained in all publications are solely those of the individual author(s) and contributor(s) and not of MDPI and/or the editor(s). MDPI and/or the editor(s) disclaim responsibility for any injury to people or property resulting from any ideas, methods, instructions or products referred to in the content. |
© 2024 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (https://creativecommons.org/licenses/by/4.0/).
Share and Cite
Zhang, X.; Zhang, H.; Huang, M.; Mei, Y.; Hu, C.; Huang, C.; Zhang, H.; Wei, X.; Gao, Y.; Ma, Z. Ferulic Acid Interferes with Radioactive Intestinal Injury Through the DJ-1-Nrf2 and Sirt1-NF-κB-NLRP3 Pathways. Molecules 2024, 29, 5072. https://doi.org/10.3390/molecules29215072
Zhang X, Zhang H, Huang M, Mei Y, Hu C, Huang C, Zhang H, Wei X, Gao Y, Ma Z. Ferulic Acid Interferes with Radioactive Intestinal Injury Through the DJ-1-Nrf2 and Sirt1-NF-κB-NLRP3 Pathways. Molecules. 2024; 29(21):5072. https://doi.org/10.3390/molecules29215072
Chicago/Turabian StyleZhang, Xuemei, Haoyu Zhang, Mingyue Huang, Yu Mei, Changkun Hu, Congshu Huang, Huiting Zhang, Xue Wei, Yue Gao, and Zengchun Ma. 2024. "Ferulic Acid Interferes with Radioactive Intestinal Injury Through the DJ-1-Nrf2 and Sirt1-NF-κB-NLRP3 Pathways" Molecules 29, no. 21: 5072. https://doi.org/10.3390/molecules29215072
APA StyleZhang, X., Zhang, H., Huang, M., Mei, Y., Hu, C., Huang, C., Zhang, H., Wei, X., Gao, Y., & Ma, Z. (2024). Ferulic Acid Interferes with Radioactive Intestinal Injury Through the DJ-1-Nrf2 and Sirt1-NF-κB-NLRP3 Pathways. Molecules, 29(21), 5072. https://doi.org/10.3390/molecules29215072