P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells
Abstract
:1. Introduction
2. Results and Discussion
2.1. Results
2.1.1. Pgp Modulates Pokemon Expression
2.1.2. Mutation of p53 Affects the Repression of Pokemon by Pgp
2.1.3. The Degragation of Pokemon by Pgp Is p53-dependent
2.1.4. Pgp Combines with p53 and Interacts with the Pokemon Promoter in Vivo
2.2. Discussion
3. Experimental Section
3.1. Cell Culture
3.2. Luciferase Assay
3.3. RT-PCR
3.4. Real-Time PCR
3.5. Western Blot Analysis
3.6. ChIPs Assay
3.7. Immunoprecipitation (IP)
4. Conclusions
Acknowledgements
References
- Xia, W; Zhao, T; Lv, J; Xu, S; Shi, J; Wang, S; Han, X; Sun, Y. Celecoxib enhanced the sensitivity of cancer cells to anticancer drugs by inhibition of the expression of P-glycoprotein through a COX-2-Independent Manner. J. Cell. Biochem 2009, 108, 181–194. [Google Scholar]
- Riordan, JR; Deuchars, K; Kartner, N; Alon, N; Trent, J; Ling, V. Amplification of P-glycoprotein genes in multidrug-resistant mammalian cell lines. Nature 1985, 316, 817–819. [Google Scholar]
- Ambudkar, S; Kimchi-Sarfaty, C; Sauna, Z; Gottesman, M. P-glycoprotein: From genomics to mechanism. Oncogene 2003, 22, 7468–7485. [Google Scholar]
- Fojo, A; Cornwell, M; Cardarelli, C; Clark, D; Richert, N; Shen, D; Ueda, K; Willingham, M; Gottesman, M; Pastan, I. Molecular biology of drug resistance. Breast Cancer Res. Tr 1987, 9, 5–16. [Google Scholar]
- Schinkel, AH. The physiological function of drug-transporting P-glycoproteins. Semin. Cancer Biol 1997, 8, 161–170. [Google Scholar]
- Johnson, D; Finch, R; Lin, Z; Zeiss, C; Sartorelli, A. The pharmacological phenotype of combined multidrug-resistance mdr1a/1b-and mrp1-deficient mice. Cancer Res 2001, 61, 1469–1476. [Google Scholar]
- Maeda, T; Hobbs, R; Pandolfi, P. The transcription factor Pokemon: A new key player in cancer pathogenesis. Cancer Res 2005, 65, 8575–8578. [Google Scholar]
- Maeda, T; Hobbs, R; Merghoub, T; Guernah, I; Zelent, A; Cordon-Cardo, C; Teruya-Feldstein, J; Pandolfi, P. Role of the proto-oncogene pokemon in cellular transformation and ARF repression. Nature 2005, 433, 278–285. [Google Scholar]
- Zhao, Z; Wang, S; Yu, L; Ju, W; Chang, H; Yan, W; Fu, K; Zhang, J. Expression of transcription factor Pokemon in non-small cell lung cancer and its clinical significance. Chin. Med. J 2008, 121, 445–449. [Google Scholar]
- Deng, Y; Ni, B; Jiang, M; Yang, D; Li, F; Wu, Y. Inhibition of proliferation of human Hela cells by small interference RNA against Pokemon gene. Chin. J. Cancer Res 2008, 20, 5–11. [Google Scholar]
- Jeon, B; Yoo, J; Choi, W; Lee, C; Yoon, H; Hur, M. Proto-oncogene FBI-1 (Pokemon/ZBTB7A) represses transcription of the tumor suppressor Rb gene via binding competition with Sp1 and recruitment of co-repressors. J. Biol. Chem 2008, 283, 33199–33210. [Google Scholar]
- Lee, D; Kang, J; Park, H; Kim, M; Yim, T; Kim, J; Heo, M; Kim, K; Kwon, H; Hur, M. FBI-1 enhances transcription of the nuclear factor-{kappa} B (NF-{kappa} B)-responsive E-selectin gene by nuclear localization of the p65 subunit of NF-{kappa} B. J. Biol. Chem 2005, 280, 27783–27791. [Google Scholar]
- Laudes, M; Bilkovski, R; Oberhauser, F; Droste, A; Gomolka, M; Leeser, U; Udelhoven, M; Krone, W. Transcription factor FBI-1 acts as a dual regulator in adipogenesis by coordinated regulation of cyclin-A and E2F-4. J. Mol. Med 2008, 86, 597–608. [Google Scholar]
- Choi, W; Jeon, B; Yun, C; Kim, P; Kim, S; Choi, K; Kim, S; Hur, M. Proto-oncogene FBI-1 represses transcription of p21CIP1 by inhibition of transcription activation by p53 and Sp1. J. Biol. Chem 2009, 284, 12633–12644. [Google Scholar]
- Levine, A. p53, the cellular gatekeeper for growth and division. Cell 1997, 88, 323–331. [Google Scholar]
- Bartek, J; Lukas, J. Pathways governing G1/S transition and their response to DNA damage. FEBS Lett 2001, 490, 117–122. [Google Scholar]
- Taylor, W; Stark, G. Regulation of the G2/M transition by p53. Oncogene 2001, 20, 1803–1815. [Google Scholar]
- Ko, L; Prives, C. p53: Puzzle and paradigm. Gene. Dev 1996, 10, 1054–1072. [Google Scholar]
- Vogelstein, B; Lane, D; Levine, A. Surfing the p53 network. Nature 2000, 408, 307–310. [Google Scholar]
- Grinkevich, V; Nikulenkov, F; Shi, Y; Enge, M; Bao, W; Maljukova, A; Gluch, A; Kel, A; Sangfelt, O; Selivanova, G. Ablation of key oncogenic pathways by RITA-Reactivated p53 is required for efficient apoptosis. Cancer Cell 2009, 15, 441–453. [Google Scholar]
- Thottassery, J; Zambetti, G; Arimori, K; Schuetz, E; Schuetz, J. p53-dependent regulation of MDR1 gene expression causes selective resistance to chemotherapeutic agents. Proc. Natl. Acad. Sci. USA 1997, 94, 11037–11042. [Google Scholar]
- Liu, F; Xie, Z; Cai, G; Jiang, YY. The effect of survivin on multidrug resistance mediated by Pglycoprotein in MCF-7 and its adriamycin resistant cells. Biol. Pharm. Bull 2007, 30, 2279–2283. [Google Scholar]
- Zu, X; Ma, J; Liu, HX; Liu, F; Tan, CY; Y, LL; W, J; Xie, ZH; Cao, DL; Jiang, YY. Pro-oncogene pokemon promotes breast cancer progression via upregulating survivin expression. Clin. Cancer Res 2010. submitted. [Google Scholar]
- Zu, XY; Yu, LL; Sun, QS; Liu, F; Wang, J; Xie, ZH; Wang, Y; Xu, W; Jiang, YY. SP 1 enhances Zbtb 7 A gene expression via direct binding to GC box in HePG 2 cells. BMC Res. Not 2009, 2, 175–181. [Google Scholar]
- Leonard, G; Fojo, T; Bates, S. The role of ABC transporters in clinical practice. Oncologist 2003, 8, 411–424. [Google Scholar]
- Avendano, C; Carlos, M. Inhibitors of multidrug resistance to antitumor agents (MDR). Curr. Med. Chem 2002, 9, 159–193. [Google Scholar]
- Babakhanian, K; Bendayan, M; Bendayan, R. Localization of P-glycoprotein at the nuclear envelope of rat brain cells. Biochem. Bioph. Res. Commun 2007, 361, 301–306. [Google Scholar]
- Munteanu, E; Verdier, M; Grandjean-Forestier, F; Stenger, C; Jayat-Vignoles, C; Huet, S; Robert, J; Ratinaud, M. Mitochondrial localization and activity of P-glycoprotein in doxorubicinresistant K562 cells. Biochem. Pharmacol 2006, 71, 1162–1174. [Google Scholar]
- Solazzo, M; Fantappiè, O; Lasagna, N; Sassoli, C; Nosi, D; Mazzanti, R. Pgp localization in mitochondria and its functional characterization in multiple drug-resistant cell lines. Exp. Cell Res 2006, 312, 4070–4078. [Google Scholar]
- Bendayan, R; Ronaldson, P; Gingras, D; Bendayan, M. In situ localization of P-glycoprotein (ABCB1) in human and rat brain. J. Histochem. Cytochem 2006, 54, 1159–1167. [Google Scholar]
- Maeda, T; Ito, K; Merghoub, T; Poliseno, L; Hobbs, R; Wang, G; Dong, L; Maeda, M; Dore, L; Zelent, A. LRF is an essential downstream target of GATA1 in erythroid development and regulates BIM-dependent apoptosis. Dev. Cell 2009, 17, 527–540. [Google Scholar]
- Dyer, B; Ferrer, F; Klinedinst, D; Rodriguez, R. A noncommercial dual luciferase enzyme assay system for reporter gene analysis. Anal. Biochem 2000, 282, 158–161. [Google Scholar]
Name | Sequence | Name | Sequence |
---|---|---|---|
Pgp1 | AAAGCGACTGAATGTTCAGTGG | p531 | TGCGTGTGGAGTATTTGGATG |
Pgp2 | AATAGATGCCTTTCTGTGCCAG | p532 | TGGTACAGTCAGAGCCAACCAG |
Pokemon1 | GAAGCCCTACGAGTGCAACATC | GAPDH1 | GGTGGTCTCCTCTGACTTCAACA |
Pokemon2 | GTGGTTCTTCAGGTCGTAGTTGTG | GAPDH2 | GTTGCTGTAGCCAAATTCGTTGT |
ChIP1 | GCCTGGCCAACATGGTGATAG | ||
ChIP2 | ACGTGAAGGCGGTCAGATGTCG |
Pokemon | p53 | Pgp | GAPDH | ChIP PCR | ||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
Temp. (°C) | Time (min:sec) | Cycle | Temp. (°C) | Time (min:sec) | Cycle | Temp. (°C) | Time (min:sec) | Cycle | Temp. (°C) | Time (min:sec) | Cycle | Temp. (°C) | Time (min:sec) | Cycle |
98 | 02:40 | 1 | 98 | 02:40 | 1 | 98 | 02:40 | 1 | 98 | 02:40 | 1 | 98 | 02:20 | 1 |
98 | 00:15 | }26 | 98 | 00:15 | }26 | 98 | 00:15 | }26 | 98 | 00:15 | }26 | 98 | 00:18 | }27 |
60 | 01:00 | 60 | 01:00 | 60 | 01:00 | 60 | 01:00 | 60 | 00:30 | |||||
72 | 01:30 | 72 | 01:30 | 72 | 01:30 | 72 | 01:30 | 72 | 00:30 | |||||
72 | 06:00 | 1 | 72 | 06:00 | 1 | 72 | 06:00 | 1 | 72 | 06:00 | 1 | 72 | 10:00 | 1 |
© 2010 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
He, S.; Liu, F.; Xie, Z.; Zu, X.; Xu, W.; Jiang, Y. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells. Int. J. Mol. Sci. 2010, 11, 3039-3051. https://doi.org/10.3390/ijms11093039
He S, Liu F, Xie Z, Zu X, Xu W, Jiang Y. P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells. International Journal of Molecular Sciences. 2010; 11(9):3039-3051. https://doi.org/10.3390/ijms11093039
Chicago/Turabian StyleHe, Shengnan, Feng Liu, Zhenhua Xie, Xuyu Zu, Wei Xu, and Yuyang Jiang. 2010. "P-Glycoprotein/MDR1 Regulates Pokemon Gene Transcription Through p53 Expression in Human Breast Cancer Cells" International Journal of Molecular Sciences 11, no. 9: 3039-3051. https://doi.org/10.3390/ijms11093039