Encapsulation-Induced Stress Helps Saccharomyces cerevisiae Resist Convertible Lignocellulose Derived Inhibitors
Abstract
:1. Introduction
2. Results and Discussion
2.1. Encapsulation Confers Tolerance to Some Inhibitors
2.2. Encapsulation Triggers Stress Responses
2.3. Diffusion Rate through the Capsule Membrane Is Enhanced by Chitosan
3. Experimental Section
3.1. Yeast Strains and Medium
3.2. Encapsulation Procedure
3.3. Batch Cultivations
3.4. Quantitative PCR
3.5. Analytical Methods
3.6. Statistics, Yields and Elemental-Balance Calculations
3.7. Diffusion through the Capsule Membrane
4. Conclusions
Acknowledgments
References
- Taherzadeh, M.J.; Karimi, K. Pretreatment of lignocellulosic wastes to improve ethanol and biogas production: A review. Int. J. Mol. Sci 2008, 9, 1621–1651. [Google Scholar]
- Taherzadeh, M.J.; Eklund, R.; Gustafsson, L.; Niklasson, C.; Liden, G. Characterization and fermentation of dilute-acid hydrolyzates from wood. Ind. Eng. Chem. Res 1997, 36, 4659–4665. [Google Scholar]
- Klinke, H.B.; Thomsen, A.B.; Ahring, B.K. Inhibition of ethanol-producing yeast and bacteria by degradation products produced during pre-treatment of biomass. Appl. Microbiol. Biotechnol 2004, 66, 10–26. [Google Scholar]
- Almeida, J.R.M.; Modig, T.; Petersson, A.; Hähn-Hägerdal, B.; Lidén, G.; Gorwa-Grauslund, M.F. Increased tolerance and conversion of inhibitors in lignocellulosic hydrolysates by Saccharomyces cerevisiae. J. Chem. Technol. Biotechnol 2007, 82, 340–349. [Google Scholar]
- Zaldivar, J.; Nielsen, J.; Olsson, L. Fuel ethanol production from lignocellulose: A challenge for metabolic engineering and process integration. Appl. Microbiol. Biotechnol 2001, 56, 17–34. [Google Scholar]
- Taherzadeh, M.J.; Niklasson, C.; Liden, G. Conversion of dilute-acid hydrolyzates of spruce and birch to ethanol by fed-batch fermentation. Bioresour. Technol 1999, 69, 59–66. [Google Scholar]
- Sárvári Horváth, I.; Taherzadeh, M.J.; Niklasson, C.; Lidén, G. Effects of furfural on anaerobic continuous cultivation of Saccharomyces cerevisiae. Biotechnol. Bioeng 2001, 75, 540–549. [Google Scholar]
- Talebnia, F.; Taherzadeh, M.J. In situ detoxification and continuous cultivation of dilute-acid hydrolyzate to ethanol by encapsulated S. cerevisiae. J. Biotechnol 2006, 125, 377–384. [Google Scholar]
- Brandberg, T.; Karimi, K.; Taherzadeh, M.J.; Franzén, C.J.; Gustafsson, L. Continuous fermentation of wheat-supplemented lignocellulose hydrolysate with different types of cell retention. Biotechnol. Bioeng 2007, 98, 80–90. [Google Scholar]
- Cheong, S.H.; Park, J.K.; Kim, B.S.; Chang, H.N. Microencapsulation of yeast cells in the calcium alginate membrane. Biotechnol. Tech 1993, 7, 879–884. [Google Scholar]
- Taherzadeh, M.J.; Gustafsson, L.; Niklasson, C.; Lidén, G. Conversion of furfural in aerobic and anaerobic batch fermentation of glucose by Saccharomyces cerevisiae. J. Biosci. Bioeng 1999, 87, 169–174. [Google Scholar]
- Vilela-Moura, A.; Schuller, D.; Mendes-Faia, A.; Silva, R.; Chaves, S.; Sousa, M.; Côrte-Real, M. The impact of acetate metabolism on yeast fermentative performance and wine quality: Reduction of volatile acidity of grape musts and wines. Appl. Microbiol. Biotechnol 2011, 89, 271–280. [Google Scholar]
- Alriksson, B.; Sárvári Horváth, I.; Jönsson, L.J. Overexpression of Saccharomyces cerevisiae transcription factor and multidrug resistance genes conveys enhanced resistance to lignocellulose-derived fermentation inhibitors. Process Biochem 2010, 45, 264–271. [Google Scholar]
- Westman, J.O.; Taherzadeh, M.J.; Franzén, C.J. Inhibitor tolerance and flocculation of a yeast strain suitable for 2nd generation bioethanol production. Electron. J. Biotechnol 2012, 15. [Google Scholar] [CrossRef]
- Talebnia, F.; Taherzadeh, M.J. Physiological and morphological study of encapsulated Saccharomyces cerevisiae. Enzyme Microb. Technol 2007, 41, 683–688. [Google Scholar]
- Talebnia, F.; Niklasson, C.; Taherzadeh, M.J. Ethanol production from glucose and dilute-acid hydrolyzates by encapsulated S. cerevisiae. Biotechnol. Bioeng 2005, 90, 345–353. [Google Scholar]
- Wu, A.; Wemmie, J.A.; Edgington, N.P.; Goebl, M.; Guevara, J.L.; Moye-Rowley, W.S. Yeast bZip proteins mediate pleiotropic drug and metal resistance. J. Biol. Chem 1993, 268, 18850–18858. [Google Scholar]
- Herrero, E.; Ros, J.; Bellí, G.; Cabiscol, E. Redox control and oxidative stress in yeast cells. Biochim. Biophys. Acta 2008, 1780, 1217–1235. [Google Scholar]
- Wiatrowski, H.A.; Carlson, M. Yap1 accumulates in the nucleus in response to carbon stress in Saccharomyces cerevisiae. Eukaryotic Cell 2003, 2, 19–26. [Google Scholar]
- Coleman, S.T.; Tseng, E.; Moye-Rowley, W.S. Saccharomyces cerevisiae basic region-leucine zipper protein regulatory networks converge at the ATR1 structural gene. J. Biol. Chem 1997, 272, 23224–23230. [Google Scholar]
- Alarco, A.-M.; Balan, I.; Talibi, D.; Mainville, N.; Raymond, M. AP1-mediated multidrug resistance in Saccharomyces cerevisiae requires FLR1 encoding a transporter of the major facilitator superfamily. J. Biol. Chem 1997, 272, 19304–19313. [Google Scholar]
- Kanazawa, S.; Driscoll, M.; Struhl, K. ATR1, a Saccharomyces cerevisiae gene encoding a transmembrane protein required for aminotriazole resistance. Mol. Cell. Biol 1988, 8, 664–673. [Google Scholar]
- Ge, X.M.; Zhang, L.; Bai, F.W. Impacts of yeast floc size distributions on their observed rates for substrate uptake and product formation. Enzyme Microb. Technol 2006, 39, 289–295. [Google Scholar]
- Elliott, B.; Futcher, B. Stress resistance of yeast cells is largely independent of cell cycle phase. Yeast 1993, 9, 33–42. [Google Scholar]
- Gasch, A.P.; Spellman, P.T.; Kao, C.M.; Carmel-Harel, O.; Eisen, M.B.; Storz, G.; Botstein, D.; Brown, P.O. Genomic expression programs in the response of yeast cells to environmental changes. Mol. Biol. Cell 2000, 11, 4241–4257. [Google Scholar]
- Slattery, M.G.; Heideman, W. Coordinated regulation of growth genes in Saccharomyces cerevisiae. Cell Cycle 2007, 6, 1210–1219. [Google Scholar]
- Pourbafrani, M.; Talebnia, F.; Niklasson, C.; Taherzadeh, M.J. Protective effect of encapsulation in fermentation of limonene-contained media and orange peel hydrolyzate. Int. J. Mol. Sci 2007, 8, 777–787. [Google Scholar]
- Taherzadeh, M.J.; Lidén, G.; Gustafsson, L.; Niklasson, C. The effects of pantothenate deficiency and acetate addition on anaerobic batch fermentation of glucose by Saccharomyces cerevisiae. Appl. Microbiol. Biotechnol 1996, 46, 176–182. [Google Scholar]
- Nigam, S.C.; Tsao, I.-F.; Sakoda, A.; Wang, H.Y. Techniques for preparing hydrogel membrane capsules. Biotechnol. Lett 1988, 2, 271–276. [Google Scholar]
- Chang, H.N.; Seong, G.H.; Yoo, I.-K.; Park, J.K.; Seo, J.-H. Microencapsulation of recombinant Saccharomyces cerevisiae cells with invertase activity in liquid-core alginate capsules. Biotechnol. Bioeng 1996, 51, 157–162. [Google Scholar]
- Gåserød, O.; Sannes, A.; Skjåk-Bræk, G. Microcapsules of alginate-chitosan. II. A study of capsule stability and permeability. Biomaterials 1999, 20, 773–783. [Google Scholar]
- Taherzadeh, M.J.; Niklasson, C.; Lidén, G. Acetic acid-friend or foe in anaerobic batch conversion of glucose to ethanol by Saccharomyces cerevisiae? Chem. Eng. Sci 1997, 52, 2653–2659. [Google Scholar]
- Teste, M.-A.; Duquenne, M.; Francois, J.; Parrou, J.-L. Validation of reference genes for quantitative expression analysis by real-time RT-PCR in Saccharomyces cerevisiae. BMC Mol. Biol 2009, 10, 99. [Google Scholar]
- Brown, A.M. A step-by-step guide to non-linear regression analysis of experimental data using a Microsoft Excel spreadsheet. Comput. Methods Prog. Biomed 2001, 65, 191–200. [Google Scholar]
Medium | Cultivation mode | YSE | YSAce | YSGly | YSBiomass |
---|---|---|---|---|---|
Defined glucose medium (DGM) | Enc. | 415 ± 30 | 1 ± 2 | 57 ± 5 | 51 ± 8 |
Free | 435 ± 10 | 11 ± 3 | 44 ± 2 | 64 ± 4 | |
Carboxylic acids | Enc. | 462 ± 4 | 18 ± 4 | 25 ± 6 | −2 ± 2 |
Free | 416 ± 48 | 32 ± 10 | 73 ± 8 | 13 ± 7 | |
Furan aldehydes | Enc. | 426 ± 9 | 30 ± 3 | 41 ± 2 | 24 ± 1 |
Free | 432 ± 12 | 8 ± 2 | 33 ± 2 | 30 ± 3 | |
Hydrolysate | Enc. | 484 ± 23 | 7 ± 10 | 54 ± 6 | 34 ± 1 |
Free | 411 ± 5 | 70 ± 26 | 24 ± 10 | 76 ± 37 |
Medium | Cultivation mode | HMF (%) | Furfural (%) |
---|---|---|---|
Furan aldehydes | Enc. | 61 ± 3 | 100 ± 0 |
Free | 73 ± 2 | 100 ± 0 | |
Hydrolysate | Enc. | 74 ± 2 | 99 ± 1 |
Free | 10 ± 2 | 67 ± 11 |
Compound | K (cm3 min−1) | Mw (g mol−1) |
---|---|---|
Formic acid | 20.69 | 46.03 |
Acetic acid | 15.99 | 60.05 |
Levulinic acid | 14.65 | 116.11 |
Furfural | 13.44 | 96.08 |
HMF | 13.13 | 126.11 |
Glucose | 10.04 | 180.16 |
Gene | Forward (5′→3′) | Reverse (5′→3′) |
---|---|---|
ATR1 | ATTCTTTGGATGGGGCTCTT | AGCCCACATTGAATGCTACC |
FLR1 | GCCTGCCTCTGTCTTTGTTC | ACCAAACAACGGAAAAGCAC |
YAP1 | TACACGTGATGGCGAGGATA | CCACTTCATTTTGCTGCTGA |
TAF10 | TACCCGAATTTACAAGAAAAGATAAGA | ATTTCTGAGTAGCAAGTGCTAAAAGTC |
© 2012 by the authors; licensee Molecular Diversity Preservation International, Basel, Switzerland. This article is an open-access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Westman, J.O.; Manikondu, R.B.; Franzén, C.J.; Taherzadeh, M.J. Encapsulation-Induced Stress Helps Saccharomyces cerevisiae Resist Convertible Lignocellulose Derived Inhibitors. Int. J. Mol. Sci. 2012, 13, 11881-11894. https://doi.org/10.3390/ijms130911881
Westman JO, Manikondu RB, Franzén CJ, Taherzadeh MJ. Encapsulation-Induced Stress Helps Saccharomyces cerevisiae Resist Convertible Lignocellulose Derived Inhibitors. International Journal of Molecular Sciences. 2012; 13(9):11881-11894. https://doi.org/10.3390/ijms130911881
Chicago/Turabian StyleWestman, Johan O., Ramesh Babu Manikondu, Carl Johan Franzén, and Mohammad J. Taherzadeh. 2012. "Encapsulation-Induced Stress Helps Saccharomyces cerevisiae Resist Convertible Lignocellulose Derived Inhibitors" International Journal of Molecular Sciences 13, no. 9: 11881-11894. https://doi.org/10.3390/ijms130911881