Reference Gene Selection for Quantitative PCR Studies in Sheep Neutrophils
Abstract
:1. Introduction
2. Results and Discussion
2.1. Expression Level of Neutrophil Reference Genes Evaluated in This Study
2.2. GeNorm Analysis of Reference Genes
2.3. NormFinder Analysis of Reference Genes
2.4. BestKeeper Analysis of Reference Genes
2.5. Delta Cq Analysis of Reference Genes
2.6. Stability of Neutrophil Reference Genes Evaluated in This Study
3. Experimental Section
3.1. Candidate Genes for Expression Studies
3.2. Whole-Blood Collection
3.3. Neutrophil Isolation
3.4. RNA Isolation
3.5. Quantitative PCR
3.6. Statistical Analysis of Neutrophil Gene Expression Stability
4. Conclusions
Supplementary Information
ijms-14-11484-s001.pdfAcknowledgements
Conflict of Interest
References
- Bustin, S.A. Absolute quantification of mRNA using real-time reverse transcription polymerase chain reaction assays. J. Mol. Endocrinol 2000, 25, 169–193. [Google Scholar]
- Suzuki, T.; Higgins, P.J.; Crawford, D.R. Control selection for RNA quantitation. Biotechniques 2000, 29, 332–337. [Google Scholar]
- Warrington, J.A.; Nair, A.; Mahadevappa, M.; Tsyganskaya, M. Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiol. Genomics 2000, 2, 143–147. [Google Scholar]
- Thellin, O.; Zorzi, W.; Lakaye, B.; de Borman, B.; Coumans, B.; Hennen, G.; Grisar, T.; Igout, A.; Heinen, E. Housekeeping genes as internal standards: Use and limits. J. Biotechnol 1999, 75, 291–295. [Google Scholar]
- Huggett, J.; Dheda, K.; Bustin, S.; Zumla, A. Real-time RT-PCR normalisation; strategies and considerations. Genes Immun 2005, 6, 279–284. [Google Scholar]
- Marshall, D.J.; Walker, R.I.; Cullis, B.R.; Luff, M.F. The effect of footrot on body weight and wool growth of sheep. Aust. Vet. J 1991, 68, 45–49. [Google Scholar]
- Hall, J.A.; Sendek, R.L.; Chinn, R.M.; Bailey, D.P.; Thonstad, K.N.; Wang, Y.; Forsberg, N.E.; Vorachek, W.R.; Stang, B.V.; van Saun, R.J.; et al. Higher whole-blood selenium is associated with improved immune responses in footrot-affected sheep. Vet. Res 2011, 42, 99. [Google Scholar]
- Kiremidjian-Schumacher, L.; Stotzky, G. Selenium and immune responses. Environ. Res 1987, 42, 277–303. [Google Scholar]
- Zhang, X.; Ding, L.; Sandford, A.J. Selection of reference genes for gene expression studies in human neutrophils by real-time PCR. BMC Mol. Biol 2005, 6, 4. [Google Scholar]
- Ledderose, C.; Heyn, J.; Limbeck, E.; Kreth, S. Selection of reliable reference genes for quantitative real-time PCR in human T cells and neutrophils. BMC Res. Notes 2011, 4, 427. [Google Scholar]
- Peletto, S.; Bertuzzi, S.; Campanella, C.; Modesto, P.; Maniaci, M.G.; Bellino, C.; Ariello, D.; Quasso, A.; Caramelli, M.; Acutis, P.L. Evaluation of internal reference genes for quantitative expression analysis by real-time PCR in ovine whole blood. Int. J. Mol. Sci 2011, 12, 7732–7747. [Google Scholar]
- Vandesompele, J.; de Preter, K.; Pattyn, F.; Poppe, B.; van Roy, N.; de Paepe, A.; Speleman, F. Accurate normalization of real-time quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol. 2002, 3, research0034:1–research0034:12. [Google Scholar]
- Andersen, C.L.; Jensen, J.L.; Orntoft, T.F. Normalization of real-time quantitative reverse transcription-PCR data: A model-based variance estimation approach to identify genes suited for normalization, applied to bladder and colon cancer data sets. Cancer Res 2004, 64, 5245–5250. [Google Scholar]
- Pfaffl, M.W.; Tichopad, A.; Prgomet, C.; Neuvians, T.P. Determination of stable housekeeping genes, differentially regulated target genes and sample integrity: BestKeeper—Excel-based tool using pair-wise correlations. Biotechnol. Lett 2004, 26, 509–515. [Google Scholar]
- Silver, N.; Best, S.; Jiang, J.; Thein, S.L. Selection of housekeeping genes for gene expression studies in human reticulocytes using real-time PCR. BMC Mol. Biol 2006, 7, 33. [Google Scholar]
- Taylor, D.L.; Zhong, L.; Begg, D.J.; de Silva, K.; Whittington, R.J. Toll-like receptor genes are differentially expressed at the sites of infection during the progression of Johne’s disease in outbred sheep. Vet. Immunol. Immunopathol 2008, 124, 132–151. [Google Scholar]
- Wang, Y.; Puntenney, S.B.; Burton, J.L.; Forsberg, N.E. Ability of a commercial feed additive to modulate expression of innate immunity in sheep immunosuppressed with dexamethasone. Animal 2007, 1, 945–951. [Google Scholar]
- Bustin, S.A.; Benes, V.; Garson, J.A.; Hellemans, J.; Huggett, J.; Kubista, M.; Mueller, R.; Nolan, T.; Pfaffl, M.W.; Shipley, G.L.; et al. The MIQE guidelines: Minimum information for publication of quantitative real-time PCR experiments. Clin. Chem 2009, 55, 611–622. [Google Scholar]
- Pfister, C.; Tatabiga, M.S.; Roser, F. Selection of suitable reference genes for quantitative real-time polymerase chain reaction in human meningiomas and arachnoidea. BMC Res. Notes 2011, 4, 275. [Google Scholar]
| Gene name | Function | Accession number * | Gene synonyms | |
|---|---|---|---|---|
| ACTB | Beta-actin | Cytoskeletal structural protein | NM_001009784.1 | Actin cytoplasmic 1; beta-actin |
| RPL19 | Ribosomal protein L19 | Found in the large ribosomal subunit | XM_004012836.1 | |
| B2M | Beta-2-microglobin | Beta-chain of class I major histocompatibility complex (MHC) molecules | NM_001009284.2 | |
| GAPDH | Glyceraldehyde-3-phosphate dehydrogenase | Enzyme in carbohydrate metabolism | NM_001190390.1 | GAPD; G3PDH |
| YWHAZ | Tyrosine 3-monoxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide | Signal transduction | NM_001267887.1 | 14-3-3 protein zeta/delta; tyrosine 3-monooxygenase |
| SDHA | Succinate dehydrogenase complex, subunit A | Mitochondrial respiratory chain | XM_004017097.1 | |
| PGK1 | Phosphoglycerate kinase I | Catalyzes the transfer of the high-energy phosphate group of 1,3-bisphosphoglycerate to ADP, forming ATP and 3-phosphoglycerate | NM_001142516.1 | |
| G6PD | Glucose-6-phosphate dehydrogenase | Enzyme in carbohydrate metabolism | NM_001093780.1 | |
| HPRT | Hypoxanthine phosphoribosyl-transferase 1 | Phosphoribosyl-transferase (PRT)-type I domain | XM_004022693.1 | HPRT1 |
| TFRC | Transferrin receptor | Protease-associated domain containing proteins, like transferrin receptor | XM_004003001.1 | p90; CD71 |
| GYPC | Glycophorin C | Integral RBC membrane binding protein | XM_004004772.1 | BOS_1916; CD236; CD236R |
| Gene symbol | Healthy control sheep (n = 4) | Foot rot-diseased sheep, untreated with Se (n = 6) | Foot rot-diseased sheep, treated with Se (n = 6) | Combined groups (n = 16) | ||||
|---|---|---|---|---|---|---|---|---|
| Mean Cq | SD | Mean Cq | SD | Mean Cq | SD | Mean Cq | SD | |
| ACTB | 18.68 | 0.88 | 18.14 | 0.52 | 19.09 | 0.36 | 18.63 | 0.69 |
| RPL19 | 18.72 | 0.56 | 18.68 | 0.41 | 19.22 | 0.35 | 18.89 | 0.49 |
| B2M | 19.61 | 1.47 | 19.01 | 0.80 | 20.72 | 0.87 | 19.80 | 1.18 |
| GAPDH | 20.09 | 0.39 | 19.59 | 0.28 | 19.88 | 0.45 | 19.82 | 0.38 |
| YWHAZ | 20.82 | 0.35 | 20.48 | 0.33 | 20.60 | 0.37 | 20.61 | 0.35 |
| SDHA | 20.99 | 0.39 | 21.06 | 0.30 | 21.25 | 0.45 | 21.11 | 0.34 |
| PGK1 | 21.12 | 0.51 | 21.24 | 0.53 | 21.58 | 0.41 | 21.34 | 0.51 |
| G6PD | 21.82 | 0.23 | 21.62 | 0.22 | 21.95 | 0.24 | 21.80 | 0.26 |
| HPRT | 25.54 | 2.33 | 23.76 | 1.86 | 24.59 | 2.07 | 24.52 | 2.22 |
| TFRC | 29.17 | 1.82 | 28.02 | 1.04 | 30.55 | 0.89 | 29.25 | 1.70 |
| GYPC | 29.56 | 0.59 | 30.24 | 0.19 | 30.15 | 0.71 | 30.04 | 0.55 |
| Healthy control sheep (n = 4) | Foot rot-diseased sheep, untreated with Se (n = 6) | Foot rot-diseased sheep, treated with Se (n = 6) | Combined groups (n = 16) | ||||
|---|---|---|---|---|---|---|---|
| Gene Symbol and Stability Value | |||||||
| SDHA|G6PD | 0.041 | GAPDH|YWHAZ | 0.235 | GAPDH|YWHAZ | 0.195 | GAPDH|YWHAZ | 0.278 |
| YWHAZ | 0.258 | G6PD | 0.253 | G6PD | 0.265 | G6PD | 0.307 |
| GAPDH | 0.333 | SDHA | 0.284 | SDHA | 0.288 | SDHA | 0.327 |
| RPL19 | 0.449 | RPL19 | 0.346 | RPL19 | 0.326 | RPL19 | 0.396 |
| PGK1 | 0.542 | PGK1 | 0.426 | ACTB | 0.420 | PGK1 | 0.478 |
| ACTB | 0.631 | ACTB | 0.495 | PGK1 | 0.466 | ACTB | 0.546 |
| B2M | 0.756 | B2M | 0.588 | B2M | 0.583 | B2M | 0.683 |
| Healthy control sheep (n = 4) | Foot rot-diseased sheep, untreated with Se (n = 6) | Foot rot-diseased sheep, treated with Se (n = 6) | Combined groups (n = 16) | ||||
|---|---|---|---|---|---|---|---|
| Gene Symbol and Stability Value | |||||||
| G6PD | 0.253 | G6PD | 0.127 | RPL19 | 0.183 | G6PD | 0.198 |
| SDHA | 0.265 | GAPDH | 0.209 | YWHAZ | 0.265 | RPL19 | 0.234 |
| RPL19 | 0.297 | YWHAZ | 0.249 | G6PD | 0.298 | GAPDH | 0.377 |
| GAPDH | 0.434 | RPL19 | 0.281 | ACTB | 0.333 | YWHAZ | 0.406 |
| YWHAZ | 0.528 | SDHA | 0.379 | GAPDH | 0.360 | SDHA | 0.433 |
| ACTB | 0.607 | ACTB | 0.474 | PGK1 | 0.383 | ACTB | 0.465 |
| PGK1 | 0.779 | PGK1 | 0.698 | SDHA | 0.536 | PGK1 | 0.594 |
| B2M | 1.078 | B2M | 0.828 | B2M | 0.897 | B2M | 1.043 |
| Healthy control sheep (n = 4) | Foot rot-diseased sheep, untreated with Se (n = 6) | Foot rot-diseased sheep, treated with Se (n = 6) | Combined groups (n = 16) | ||||
|---|---|---|---|---|---|---|---|
| Gene Symbol and Stability Value | |||||||
| GAPDH | 0.131 | G6PD | 0.153 | G6PD | 0.202 | G6PD | 0.226 |
| SDHA | 0.158 | GAPDH | 0.211 | RPL19 | 0.249 | YWHAZ | 0.282 |
| G6PD | 0.168 | YWHAZ | 0.220 | ACTB | 0.251 | SDHA | 0.291 |
| YWHAZ | 0.218 | SDHA | 0.220 | YWHAZ | 0.263 | GAPDH | 0.308 |
| PGK1 | 0.388 | RPL19 | 0.336 | PGK1 | 0.321 | RPL19 | 0.380 |
| RPL19 | 0.465 | PGK1 | 0.355 | SDHA | 0.346 | PGK1 | 0.392 |
| ACTB | 0.642 | ACTB | 0.377 | GAPDH | 0.354 | ACTB | 0.577 |
| B2M | 0.951 | B2M | 0.546 | B2M | 0.557 | B2M | 0.906 |
| Healthy control sheep (n = 4) | Foot rot-diseased sheep, untreated with Se (n = 6) | Foot rot-diseased sheep, treated with Se (n = 6) | Combined groups (n = 16) | ||||
|---|---|---|---|---|---|---|---|
| Gene Symbol and Stability Value | |||||||
| G6PD | 0.58 | G6PD | 0.44 | YWHAZ | 0.47 | G6PD | 0.53 |
| SDHA | 0.58 | GAPDH | 0.48 | RPL19 | 0.49 | RPL19 | 0.58 |
| RPL19 | 0.66 | YWHAZ | 0.49 | G6PD | 0.50 | GAPDH | 0.59 |
| GAPDH | 0.68 | RPL19 | 0.53 | GAPDH | 0.52 | YWHAZ | 0.60 |
| YWHAZ | 0.72 | SDHA | 0.54 | ACTB | 0.56 | SDHA | 0.61 |
| ACTB | 0.80 | ACTB | 0.62 | PGK1 | 0.58 | ACTB | 0.70 |
| PGK1 | 0.90 | PGK1 | 0.75 | SDHA | 0.61 | PGK1 | 0.76 |
| B2M | 1.13 | B2M | 0.87 | B2M | 0.93 | B2M | 1.09 |
| Healthy control sheep (n = 4) | Foot rot-diseased sheep, untreated with Se (n = 6) | Foot rot-diseased sheep, treated with Se (n = 6) | Combined groups (n = 16) | ||||
|---|---|---|---|---|---|---|---|
| Gene Symbol and Geomean Ranking Value | |||||||
| G6PD | 1.46 | G6PD | 1.32 | YWHAZ | 1.86 | G6PD | 1.32 |
| SDHA | 1.86 | GAPDH | 1.86 | RPL19 | 2.11 | YWHAZ | 2.63 |
| GAPDH | 2.83 | YWHAZ | 2.52 | G6PD | 2.28 | GAPDH | 2.71 |
| RPL19 | 4.05 | RPL19 | 4.47 | GAPDH | 3.81 | RPL19 | 3.16 |
| YWHAZ | 4.16 | SDHA | 4.47 | ACTB | 4.53 | SDHA | 4.16 |
| PGK1 | 6.19 | PGK1 | 6.48 | PGK1 | 5.73 | PGK1 | 6.48 |
| ACTB | 6.48 | ACTB | 6.48 | SDHA | 5.86 | ACTB | 6.48 |
| B2M | 8.00 | B2M | 8.00 | B2M | 8.00 | B2M | 8.00 |
| Gene name | Primer sequences (forward/reverse) | Spanned exons | Amplicon size (bp) |
|---|---|---|---|
| ACTB | CCAACCGTGAGAAGATGACC | 2nd | 97 |
| CCAGAGGCGTACAGGGACAG | 3rd | ||
| GAPDH | CTGGCCAAGGTCATCCAT | 7th | 86 |
| ACAGTCTTCTGGGTGGCAGT | 8th | ||
| SDHA | CATCCACTACATGACGGAGCA | 4th | 90 |
| ATCTTGCCATCTTCAGTTCTGCT | 5th | ||
| GYPC | ATCAACATCGCTGTCATTGC | 3rd | 117 |
| CTCGTTGGTGTCCTATGTGC | 4th | ||
| RPL19 | AGCCTGTGACTGTCCATTCC | 2nd | 126 |
| ACGTTACCTTCTCGGGCATT | 3rd | ||
| YWHAZ | AGACGGAAGGTGCTGAGAAA | 2nd | 123 |
| CGTTGGGGATCAAGAACTTT | 3rd | ||
| PGK1 | ACTCCTTGCAGCCAGTTGCT | 3rd | 101 |
| AGCACAAGCCTTCTCCACTTCT | 4th | ||
| HPRT | CCACCCATCTCCTTCATCAC | 4th | 71 |
| TTCTGGGCAGACCTCAAATC | 5th | ||
| TFRC | TTCTGGGCAGACCTCAAATC | 4th | 106 |
| CAGCTTCACGTGGGACATAA | 5th | ||
| G6PD | TGACCTATGGCAACCGATACAA | 10th | 76 |
| CCGCAAAAGACATCCAGGAT | 11th | ||
| B2M | CTGTCGCTGTCTGGACTGG | 1st | 86 |
| TTTGGCTTTCCATCTTCTGG | 2nd |
© 2013 by the authors; licensee MDPI, Basel, Switzerland This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license ( http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Vorachek, W.R.; Hugejiletu; Bobe, G.; Hall, J.A. Reference Gene Selection for Quantitative PCR Studies in Sheep Neutrophils. Int. J. Mol. Sci. 2013, 14, 11484-11495. https://doi.org/10.3390/ijms140611484
Vorachek WR, Hugejiletu, Bobe G, Hall JA. Reference Gene Selection for Quantitative PCR Studies in Sheep Neutrophils. International Journal of Molecular Sciences. 2013; 14(6):11484-11495. https://doi.org/10.3390/ijms140611484
Chicago/Turabian StyleVorachek, William R., Hugejiletu, Gerd Bobe, and Jean A. Hall. 2013. "Reference Gene Selection for Quantitative PCR Studies in Sheep Neutrophils" International Journal of Molecular Sciences 14, no. 6: 11484-11495. https://doi.org/10.3390/ijms140611484
APA StyleVorachek, W. R., Hugejiletu, Bobe, G., & Hall, J. A. (2013). Reference Gene Selection for Quantitative PCR Studies in Sheep Neutrophils. International Journal of Molecular Sciences, 14(6), 11484-11495. https://doi.org/10.3390/ijms140611484
