Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora
Abstract
:1. Introduction
2. Results and Discussion
2.1. Selection of Salt-Tolerant FOX (Full-Length cDNA Over-Expressing Gene)-Yeast Lines from Yeast Full-Length P. tenuiflora cDNA Libraries
2.2. Multi-Resistance and Sequence Analyses of Salt-Resistant FOX-Yeast Lines
Primer Name | Sequences (from 5' to 3') |
---|---|
pAUR101-FW | CCGGATCGGACTACTAGCAGCTG |
pAUR101-RV | TAGGGACCTAGACTTCAGGTTGTC |
pYES2-construct-F158 | GGATCCCCGGATCGGACTATAGCAGCTG |
pYES2-construct-R158 | TCTGGATAGGGACCTAGACTTCAGGTTGTC |
pYES2-construct-F167 | GAATTCCCGGATCGGACTATAGCAGCTG |
pYES2-construct-R167 | CTCGAGTAGGGACCTAGACTTCAGGTTGTC |
Put-tubulin-F | GTGTCAGCCATACTGTGCCAATC |
Put-tubulin-R | TTGCTCATGCGGTCAGCAATACC |
NaCl-158#-F | GAGCAGAGGAGCAAGATG |
NaCl-158#-R | TTACACGGAGGACAGACAC |
NaCl-167#-F | ACAGTTGGGAGGAGCGTC |
NaCl-167#-R | CCACTCGATCTGCATTTCT |
NO. | Superfamily | Description | E-Value | Species and Accession |
---|---|---|---|---|
NaCl-3 | RbcS superfamily | ribulose-1,5-bisphosphate carboxylase | 8 × 10−117 | Triticum aestivum [P00871.2] |
NaCl-9 | Metallothio 2 superfamily | metallothionein-like protein type 2 | 2 × 10−21 | Zea mays [ACF85243.1] |
NaCl-30 | Chloroa b bind superfamily | PSI type III chlorophyll a/b-binding protein | 6 × 10−92 | Arabidopsis thaliana [NP_001031217.1] |
NaCl-40 | - | glycine-rich cell wall structural protein | 3 × 10−5 | Oryza sativa [EAY86471.1] |
NaCl-41 | NAD binding 8 superfamily | thiamin biosynthetic enzyme | 0.0 | Triticum urartu [EMS66450.1] |
NaCl-42 | - | hypothetical protein ZEAMMB73879106 | - | Zea mays [AFW58868.1] |
NaCl-44 | AAI LTSS superfamily | lipid transfer protein | 8 × 10−44 | Triticum aestivum [ABB90546.1] |
NaCl-46 | PP-binding superfamily | acyl carrier protein 3 | 9 × 10−63 | Zea mays [ACG24988.1] |
NaCl-47 | Plant peroxidase like superfamily | Peroxidase | 1 × 10−165 | Glycine max [XP_003517206.1] |
NaCl-48 | - | Dehydrin | 3 × 10−58 | Hordeum vulgare [CAA50499.1] |
NaCl-51 | DIOX-N superfamily ACC oxidase | ACC oxidase | 5 × 10−140 | Glycine max [NP_001276303.1] |
NaCl-53 | - | nucleic acid binding/zinc ion binding | 2 × 10−31 | Arabidopsis thaliana [NP_001154741.1] |
NaCl-54 | - | unknown | 0.35 | - |
NaCl-55 | UBQ superfamily | Polyubiquitin3 | 2 × 10−167 | Arabidopsis thaliana [NP_851029.1] |
NaCl-57 | Ribosomal-S7e superfamily | 40S ribosomal protein S7 | 2 × 10−5 | Cucumis sativus [XP_004137317.1] |
NaCl-60 | - | neurogenic locus notch protein precursor-like | 5 × 10−89 | Zea mays [NP_001158958.1] |
NaCl-61 | Ribokinase-pfkB-like superfamily | fructokinase-2 | 5 × 10−154 | Arabidopsis thaliana [NP_191507.1] |
NaCl-62 | Cupin-2 superfamily | germin-like protein | 2 × 10−92 | Arabidopsis thaliana [AAB51752.1] |
NaCl-63 | - | Unknown | - | - |
NaCl-74 | TIM-phosphate binding superfamily | glycolate oxidase | 6 × 10−72 | Arabidopsis thaliana [AAB80700.1] |
NaCl-77 | Duf1313 superfamily | EARLY flowering protein | 5 × 10−33 | Zea mays [ACG45265.1] |
NaCl-79 | DOMON superfamily | auxin-responsive protein | 3 × 10−116 | Arabidopsis thaliana [NP_199564.1] |
NaCl-81 | Glycosyltransferase-GTB-type superfamily | trehalose-6-phosphate synthase | 0.0 | Oryza sativa [NP_001063104.1] |
NaCl-84 | PSI-psaK superfamily | photosystem I reaction center subunit psaK | 4 × 10−52 | Arabidopsis thaliana [CAB53033.1] |
NaCl-93 | Rubredoxin-like superfamily | rubredoxin family protein | 7 × 10−62 | Arabidopsis thaliana [NP_001078598.1] |
NaCl-101 | - | Unknown | 6 × 10−11 | Zea mays [DAA58889.1] |
NaCl-109 | PsbR superfamily | PSBR (photosystem II subunit R) | 7 × 10−63 | Oryza sativa Japonica Group [BAC83336.1] |
NaCl-116 | Ntn-hydrolase superfamily | proteasome subunit beta type 4 precursor | 3 × 10−156 | Zea mays [ACG33740.1] |
NaCl-125 | - | homeodomain leucine zipper protein | 2 × 10−106 | Zea mays [AFW63782.1] |
NaCl-128 | Ribosomal-L21e superfamily | 60S ribosomal protein L21 | 3 × 10−38 | Zea mays [DAA49694.1] |
NaCl-158 | - | Unknown | - | - |
NaCl-167 | - | Unknown | - | - |
2.3. Discovery of Two Novel Endogenous Genes of P. tenuiflora
2.4. Expression Patterns of NaCl-158# and NaCl-167#
2.5. Overexpression of NaCl-158# and NaCl-167# in Yeast under Various Stress Conditions
3. Experimental Section
3.1. Materials
3.2. Constructs
3.3. Multiple Screening for Salt-Tolerant Transgenic Yeast Lines
3.4. Yeast Resistance Analysis Media and Growth Conditions
3.5. Northern Blot Analysis
4. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Degenhardt, B.; Gimmler, H.; Hose, E.; Hartung, W. Effect of alkaline and saline substrates on ABA contents, distribution and transport in plant roots. Plant Soil 2000, 225, 83–94. [Google Scholar]
- Greenway, H.; Munns, R. Mechanisms of salt tolerance in nonhalophytes. Annu. Rev. Plant Physiol. 1980, 31, 149–190. [Google Scholar]
- Zhu, J.K. Salt and drought stress signal transduction in plants. Annu. Rev. Plant Biol. 2002, 53, 247–273. [Google Scholar]
- Munns, R.; Tester, M. Mechanisms of salinity tolerance. Annu. Rev. Plant Biol. 2008, 59, 651–681. [Google Scholar]
- Wang, C.M.; Zhang, J.L.; Liu, X.S.; Li, Z.; Wu, G.Q.; Cai, J.Y.; Flowers, T.J.; Wang, S.M. Puccinellia tenuiflora maintains a low Na+ level under salinity by limiting unidirectional Na+ influx resulting in a high selectivity for K+ over Na+. Plant Cell Environ. 2009, 32, 486–496. [Google Scholar]
- Wang, W.; Vinocur, B.; Altman, A. Plant responses to drought, salinity and extreme temperatures: Towards genetic engineering for stress tolerance. Planta 2003, 218, 1–14. [Google Scholar]
- Glenn, E.P.; Brown, J.J.; Blumwald, E. Salt tolerance and crop potential of halophytes. Crit. Rev. Plant Sci. 1999, 18, 227–255. [Google Scholar]
- Munns, R. Comparative physiology of salt and water stress. Plant Cell Environ. 2002, 25, 239–250. [Google Scholar]
- Niu, X.; Bressan, R.A.; Hasegawa, P.M.; Pardo, J.M. Ion homeostasis in NaCl stress environments. Plant Physiol. 1995, 109, 735–742. [Google Scholar]
- Yang, C.W.; Li, C.Y.; Zhang, M.L.; Liu, J.; Ju, M.; Shi, D.C. pH and ion balance in wheat-wheatgrass under salt- or alkali stress. Chin. J. Appl. Ecol. 2008, 19, 1000–1005. [Google Scholar]
- Yeo, A. Molecular biology of salt tolerance in the context of whole-plant physiology. J. Exp. Bot. 1998, 49, 915–929. [Google Scholar]
- Alonso, J.M.; Stepanova, A.N.; Leisse, T.J.; Kim, C.J.; Chen, H.; Shinn, P.; Stevenson, D.K.; Zimmerman, J.; Barajas, P.; Cheuk, R.; et al. Genome-wide insertional mutagenesis of Arabidopsis thaliana. Science 2003, 301, 653–657. [Google Scholar]
- Hirochika, H.; Guiderdoni, E.; An, G.; Hsing, Y.I.; Eun, M.Y.; Han, C.D.; Upadhyaya, N.; Ramachandran, S.; Zhang, Q.; Pereira, A.; et al. Rice mutant resources for gene discovery. Plant Mol. Biol. 2004, 54, 325–334. [Google Scholar]
- Hsing, Y.I.; Chern, C.G.; Fan, M.J.; Lu, P.C.; Chen, K.T.; Lo, S.F.; Sun, P.K.; Ho, S.L.; Lee, K.W.; Wang, Y.C.; et al. A rice gene activation/knockout mutant resource for high throughput functional genomics. Plant Mol. Biol. 2007, 63, 351–364. [Google Scholar]
- Kolesnik, T.; Szeverenyi, I.; Bachmann, D.; Kumar, C.S.; Jiang, S.; Ramamoorthy, R.; Cai, M.; Ma, Z.G.; Sundaresan, V.; Ramachandran, S. Establishing an efficient Ac/Ds tagging system in rice: large-scale analysis of Ds flanking sequences. Plant J. 2004, 37, 301–314. [Google Scholar]
- Kuromori, T.; Hirayama, T.; Kiyosue, Y.; Takabe, H.; Mizukado, S.; Sakurai, T.; Akiyama, K.; Kamiya, A.; Ito, T.; Shinozaki, K. A collection of 11 800 single-copy Ds transposon insertion lines in Arabidopsis. Plant J. 2004, 37, 897–905. [Google Scholar]
- Li, J.; Lease, K.A.; Tax, F.E.; Walker, J.C. BRS1, a serine carboxypeptidase, regulates BRI1 signaling in Arabidopsis thalian. Proc.Natl. Acad. Sci. USA 2001, 98, 5916–5921. [Google Scholar]
- Nakazawa, M.; Ichikawa, T.; Ishikawa, A.; Kobayashi, H.; Tsuhara, Y.; Kawashima, M.; Suzuki, K.; Muto, S.; Matsui, M. Activation tagging, a novel tool to dissect the functions of a gene family. Plant J. 2003, 34, 741–750. [Google Scholar]
- Upadhyaya, N.M.; Zhou, X.-R.; Zhu, Q.-H.; Ramm, K.; Wu, L.; Eamens, A.; Sivakumar, R.; Kato, T.; Yun, D.-W.; Santhoshkumar, C.; et al. An iAc/Ds gene and enhancer trapping system for insertional mutagenesis in rice. Funct. Plant Biol. 2002, 29, 547–559. [Google Scholar]
- Van Enckevort, L.J.; Droc, G.; Piffanelli, P.; Greco, R.; Gagneur, C.; Weber, C.; Gonzalez, V.M.; Cabot, P.; Fornara, F.; Berri, S.; et al. EU-OSTID: A collection of transposon insertional mutants for functional genomics in rice. Plant Mol. Biol. 2005, 59, 99–110. [Google Scholar]
- Weigel, D.; Ahn, J.H.; Blazquez, M.A.; Borevitz, J.O.; Christensen, S.K.; Fankhauser, C.; Ferrandiz, C.; Kardailsky, I.; Malancharuvil, E.J.; Neff, M.M.; et al. Activation tagging in Arabidopsis. Plant Physiol. 2000, 122, 1003–1013. [Google Scholar]
- Yoshizumi, T.; Tsumoto, Y.; Takiguchi, T.; Nagata, N.; Yamamoto, Y.Y.; Kawashima, M.; Ichikawa, T.; Nakazawa, M.; Yamamoto, N.; Matsui, M. Increased level of polyploidy1, a conserved repressor of CYCLINA2 transcription, controls endoreduplication in Arabidopsis. Plant Cell 2006, 18, 2452–2468. [Google Scholar]
- Ichikawa, T.; Nakazawa, M.; Kawashima, M.; Iizumi, H.; Kuroda, H.; Kondou, Y.; Tsuhara, Y.; Suzuki, K.; Ishikawa, A.; Seki, M.; et al. The FOX hunting system: An alternative gain-of-function gene hunting technique. Plant J. 2006, 48, 974–985. [Google Scholar]
- Nakamura, H.; Hakata, M.; Amano, K.; Miyao, A.; Toki, N.; Kajikawa, M.; Pang, J.; Higashi, N.; Ando, S.; Toki, S.; et al. A genome-wide gain-of function analysis of rice genes using the FOX-hunting system. Plant Mol. Biol. 2007, 65, 357–371. [Google Scholar]
- Du, J.; Huang, Y.P.; Xi, J.; Cao, M.J.; Ni, W.S.; Chen, X.; Zhu, J.K.; Oliver, D.J.; Xiang, C.B. Functional gene-mining for salt-tolerance genes with the power of Arabidopsis. Plant J. 2008, 56, 653–664. [Google Scholar]
- Himuro, Y.; Tanaka, H.; Hashiguchi, M.; Ichikawa, T.; Nakazawa, M.; Seki, M.; Fujita, M.; Shinozaki, K.; Matsui, M.; Akashi, R.; et al. FOX-superroots of Lotus corniculatus, overexpressing Arabidopsis full-length cDNA, show stable variations in morphological traits. J. Plant Physiol. 2011, 168, 181–187. [Google Scholar]
- Liu, X.; Chen, X.; Oliver, D.J.; Xiang, C.B. Isolation of a low-sulfur tolerance gene from Eichhornia crassipes using a functional gene-mining approach. Planta 2009, 231, 211–219. [Google Scholar]
- Wan, C.G.; Zou, X. A study on salt tolerance of Puccinellia chinampoensis and its’ desalinizing effect on the soil. Pratacult. Sci. 1990, 3, 3–8. [Google Scholar]
- Peng, Y.H.; Zhu, Y.F.; Mao, Y.Q.; Wang, S.M.; Su, W.A.; Tang, Z.C. Alkali grass resists salt stress through high [K+] and an endodermis barrier to Na+. J. Exp. Bot. 2004, 55, 939–949. [Google Scholar]
- Wang, Y.; Chu, Y.; Liu, G.; Wang, M.H.; Jiang, J.; Hou, Y.; Qu, G.; Yang, C. Identification of expressed sequence tags in an alkali grass (Puccinellia tenuiflora) cDNA library. J. Plant Physiol. 2007, 164, 78–89. [Google Scholar]
- Wang, Y.; Yang, C.; Liu, G.; Jiang, J. Development of a cDNA microarray to identify gene expression of Puccinellia tenuiflora under saline-alkali stress. Plant Physiol. Biochem. 2007, 45, 567–576. [Google Scholar]
- Liu, H.; Zhang, X.; Takano, T.; Liu, S. Characterization of a PutCAX1 gene from Puccinellia tenuiflora that confers Ca2+ and Ba2+ tolerance in yeast. Biochem. Biophys. Res. Commun. 2009, 383, 392–396. [Google Scholar]
- National Center for Biotechnology Information. Available online: http://www.ncbi.nlm.nih.gov (accessed on 12 September 2014).
- ORF Finder. Available online: http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi (accessed on 12 September 2014).
- TMHMM-2.0. Available online: http://www.cbs.dtu.dk/services/TMHMM-2.0/ (accessed on 12 September 2014).
- Dat, J.; Vandenabeele, S.; Vranova, E.; van Montagu, M.; Inze, D.; van Breusegem, F. Dual action of the active oxygen species during plant stress responses. Cell. Mol. Life Sci. CMLS 2000, 57, 779–795. [Google Scholar]
- Foyer, C.H.; Noctor, G. Oxidant and antioxidant signalling in plants: A re-evaluation of the concept of oxidative stress in a physiological context. Plant Cell Environ. 2005, 28, 1056–1071. [Google Scholar]
- Gomez, J.M.; Hernandez, J.A.; Jimenez, A.; del Rio, L.A.; Sevilla, F. Differential response of antioxidative enzymes of chloroplasts and mitochondria to long-term NaCl stress of pea plants. Free Radic. Res. 1999, 31, S11–S18. [Google Scholar]
- Van Assche, F.; Clijsters, H. Effects of metals on enzyme activity in plants. Plant Cell Environ. 1990, 13, 195–206. [Google Scholar]
- Gietz, R.D.; Schiestl, R.H.; Willems, A.R.; Woods, R.A. Studies on the transformation of intact yeast cells by the LiAc/SS-DNA/PEG procedure. Yeast 1995, 11, 355–360. [Google Scholar]
- Sambrook, J.; Russell, D.W. Molecular Cloning: A Laboratory Manual, 3rd ed.; Cold Spring Harbor Laboratory Press: Cold Spring Harbor, NY, USA, 2001. [Google Scholar]
© 2014 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/3.0/).
Share and Cite
Li, Y.; Takano, T.; Liu, S. Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora. Int. J. Mol. Sci. 2014, 15, 16469-16483. https://doi.org/10.3390/ijms150916469
Li Y, Takano T, Liu S. Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora. International Journal of Molecular Sciences. 2014; 15(9):16469-16483. https://doi.org/10.3390/ijms150916469
Chicago/Turabian StyleLi, Ying, Tetsuo Takano, and Shenkui Liu. 2014. "Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora" International Journal of Molecular Sciences 15, no. 9: 16469-16483. https://doi.org/10.3390/ijms150916469