Acute Endoplasmic Reticulum Stress-Independent Unconventional Splicing of XBP1 mRNA in the Nucleus of Mammalian Cells
Abstract
:1. Introduction
2. Results
2.1. The Presence of Acute ER Stress-Independent Unconventional Splicing of X-Box-Binding Protein-1 (XBP1) mRNA Sensor Sequence
2.2. Basal Unconventional Splicing of XBP1 mRNA Sensor Sequence in ERAI Occurs in the Nucleus and Requires IRE1α
2.3. The 5′ End Nucleotide Sequence Is Critical to the Unconventional Splicing of XBP1 mRNA
2.4. The Basal Unconventional Splicing of Endogenous XBP1 mRNA Occurs in the Nucleus Independent of ER Stress
2.5. ER Stress Promotes the Unconventional Splicing of XBP1 mRNA in the Nucleus
2.6. The De Novo Transcription Is Not Required for the Unconventional Splicing of XBP1 mRNA in the Nucleus
2.7. XBP1s Promotes the Growth of MCF-7 Cells
3. Discussion
4. Materials and Methods
4.1. Plasmid Construction
- shScr (Scramble shRNA): CCTAAGGTTAAGTCGCCCTCG.
- shIRE1α-1: GCACGTGAATTGATAGAGAAG.
- shIRE1α-2: CCCATCAACCTCTCTTCTGTA.
4.2. RNA Isolation and RT-PCR
- GAPDH-F: GAAGGTGAAGGTCGGAGTC.
- GAPDH-R: GAAGATGGTGATGGGATTTC.
- Human XBP1-F: GAATGAAGTGAGGCCAGTGG.
- Human XBP1-R: ACTGGGTCCTTCTGGGTAGA.
- Mouse XBP1-F: ACGAGGTTCCAGAGGTGGAG.
- Mouse XBP1-R: AAGAGGCAACAGTGTCAGAG.
- ERAIm-F: ATCGACTTCAAGGAGGACGGCAACA (for all ERAIm constructs).
- ERAIm454–557-R: TTCTGGAGGGGTGACAACTGG (for ERAIm375–596 and ERAIm454–557).
- ERAIm485–530-R: GTTCATCACCTTCTGCTTGCCG (for ERAIm485–530, ERAIm485–596 and ERAIm373–530).
- mCherry-F: ATGGTGAGCAAGGGCGAGG.
- mCherry-R: GACAGGATGTCCCAGGCGAA.
- GAPDH mRNA level was used as the normalization control.
4.3. Cellular Fraction
4.4. Cell Culture
4.5. Anchorage-Independent Cell Culture
4.6. Imaging of Cells
4.7. Western Blot
4.8. Lentivirus Production
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
XBP1 | X-box-binding protein-1 |
ER | endoplasmic reticulum |
IRE1α | inositol-requiring transmembrane kinase and endonuclease 1α |
UPR | unfolded protein response |
PERK | protein kinase-like ER kinase |
ATF6 | activation of transcription factor 6 |
ERAI | ER stress activated indicator |
RT-PCR | reverse transcription system and the expand high fidelity PCR system |
References
- Hetz, C. The unfolded protein response: Controlling cell fate decisions under ER stress and beyond. Nat. Rev. Mol. Cell Biol. 2012, 13, 89–102. [Google Scholar]
- Ron, D.; Walter, P. Signal integration in the endoplasmic reticulum unfolded protein response. Nat. Rev. Mol. Cell Biol. 2007, 8, 519–529. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; Korennykh, A.V.; Behrman, S.L.; Walter, P. Mammalian endoplasmic reticulum stress sensor IRE1 signals by dynamic clustering. Proc. Natl. Acad. Sci. USA 2010, 107, 16113–16118. [Google Scholar] [CrossRef] [PubMed]
- Tirosh, B.; Iwakoshi, N.N.; Glimcher, L.H.; Ploegh, H.L. Rapid turnover of unspliced XBP-1 as a factor that modulates the unfolded protein response. J. Biol. Chem. 2006, 281, 5852–5860. [Google Scholar] [CrossRef] [PubMed]
- Tarn, W.Y.; Steitz, J.A. Pre-mRNA splicing: The discovery of a new spliceosome doubles the challenge. Trends Biochem. Sci. 1997, 22, 132–137. [Google Scholar] [CrossRef]
- Calfon, M.; Zeng, H.; Urano, F.; Till, J.H.; Hubbard, S.R.; Harding, H.P.; Clark, S.G.; Ron, D. IRE1 couples endoplasmic reticulum load to secretory capacity by processing the XBP-1 mRNA. Nature 2002, 415, 92–96. [Google Scholar] [CrossRef] [PubMed]
- Gonzalez, T.N.; Sidrauski, C.; Dorfler, S.; Walter, P. Mechanism of non-spliceosomal mRNA splicing in the unfolded protein response pathway. EMBO J. 1999, 18, 3119–3132. [Google Scholar] [CrossRef] [PubMed]
- Goffin, L.; Vodala, S.; Fraser, C.; Ryan, J.; Timms, M.; Meusburger, S.; Catimel, B.; Nice, E.C.; Silver, P.A.; Xiao, C.Y.; et al. The unfolded protein response transducer Ire1p contains a nuclear localization sequence recognized by multiple beta importins. Mol. Biol. Cell 2006, 17, 5309–5323. [Google Scholar] [CrossRef] [PubMed]
- Ruegsegger, U.; Leber, J.H.; Walter, P. Block of HAC1 mRNA translation by long-range base pairing is released by cytoplasmic splicing upon induction of the unfolded protein response. Cell 2001, 107, 103–114. [Google Scholar] [CrossRef]
- Lee, K.; Tirasophon, W.; Shen, X.; Michalak, M.; Prywes, R.; Okada, T.; Yoshida, H.; Mori, K.; Kaufman, R.J. IRE1-mediated unconventional mRNA splicing and S2P-mediated ATF6 cleavage merge to regulate XBP1 in signaling the unfolded protein response. Genes Dev. 2002, 16, 452–466. [Google Scholar] [CrossRef] [PubMed]
- Niwa, M.; Sidrauski, C.; Kaufman, R.J.; Walter, P. A role for presenilin-1 in nuclear accumulation of Ire1 fragments and induction of the mammalian unfolded protein response. Cell 1999, 99, 691–702. [Google Scholar] [CrossRef]
- Back, S.H.; Lee, K.; Vink, E.; Kaufman, R.J. Cytoplasmic IRE1α-mediated XBP1 mRNA splicing in the absence of nuclear processing and endoplasmic reticulum stress. J. Biol. Chem. 2006, 281, 18691–18706. [Google Scholar] [CrossRef] [PubMed]
- Iwawaki, T.; Akai, R. Analysis of the XBP1 splicing mechanism using endoplasmic reticulum stress-indicators. Biochem. Biophys. Res. Commun. 2006, 350, 709–715. [Google Scholar] [CrossRef] [PubMed]
- Uemura, A.; Oku, M.; Mori, K.; Yoshida, H. Unconventional splicing of XBP1 mRNA occurs in the cytoplasm during the mammalian unfolded protein response. J Cell Sci. 2009, 122, 2877–2886. [Google Scholar] [CrossRef] [PubMed]
- Iwakoshi, N.N.; Lee, A.H.; Glimcher, L.H. The X-box binding protein-1 transcription factor is required for plasma cell differentiation and the unfolded protein response. Immunol. Rev. 2003, 194, 29–38. [Google Scholar] [CrossRef] [PubMed]
- Reimold, A.M.; Iwakoshi, N.N.; Manis, J.; Vallabhajosyula, P.; Szomolanyi-Tsuda, E.; Gravallese, E.M.; Friend, D.; Grusby, M.J.; Alt, F.; Glimcher, L.H. Plasma cell differentiation requires the transcription factor XBP-1. Nature 2001, 412, 300–307. [Google Scholar] [CrossRef] [PubMed]
- Carrasco, D.R.; Sukhdeo, K.; Protopopova, M.; Sinha, R.; Enos, M.; Carrasco, D.E.; Zheng, M.; Mani, M.; Henderson, J.; Pinkus, G.S.; et al. The differentiation and stress response factor XBP-1 drives multiple myeloma pathogenesis. Cancer Cell 2007, 11, 349–360. [Google Scholar] [CrossRef] [PubMed]
- Fujimoto, T.; Onda, M.; Nagai, H.; Nagahata, T.; Ogawa, K.; Emi, M. Upregulation and overexpression of human X-box binding protein 1 (hXBP-1) gene in primary breast cancers. Breast Cancer 2003, 10, 301–306. [Google Scholar] [CrossRef] [PubMed]
- Iwawaki, T.; Akai, R.; Kohno, K.; Miura, M. A transgenic mouse model for monitoring endoplasmic reticulum stress. Nat. Med. 2004, 10, 98–102. [Google Scholar] [CrossRef] [PubMed]
- Hu, C.D.; Chinenov, Y.; Kerppola, T.K. Visualization of interactions among bZIP and Rel family proteins in living cells using bimolecular fluorescence complementation. Mol. Cell 2002, 9, 789–798. [Google Scholar] [CrossRef]
- Hu, C.D.; Kerppola, T.K. Simultaneous visualization of multiple protein interactions in living cells using multicolor fluorescence complementation analysis. Nat. Biotechnol. 2003, 21, 539–545. [Google Scholar] [CrossRef] [PubMed]
- Carmody, S.R.; Wente, S.R. mRNA nuclear export at a glance. J. Cell Sci. 2009, 122, 1933–1937. [Google Scholar] [CrossRef] [PubMed]
- Dull, T.; Zufferey, R.; Kelly, M.; Mandel, R.J.; Nguyen, M.; Trono, D.; Naldini, L. A third-generation lentivirus vector with a conditional packaging system. J. Virol. 1998, 72, 8463–8471. [Google Scholar] [PubMed]
- Kamath, R.V.; Leary, D.J.; Huang, S. Nucleocytoplasmic shuttling of polypyrimidine tract-binding protein is uncoupled from RNA export. Mol. Biol. Cell 2001, 12, 3808–3820. [Google Scholar] [CrossRef] [PubMed]
- Perry, R.P.; Kelley, D.E. Inhibition of RNA synthesis by actinomycin D: characteristic dose-response of different RNA species. J. Cell. Physiol. 1970, 76, 127–139. [Google Scholar] [CrossRef] [PubMed]
- Romero-Ramirez, L.; Cao, H.; Nelson, D.; Hammond, E.; Lee, A.H.; Yoshida, H.; Mori, K.; Glimcher, L.H.; Denko, N.C.; Giaccia, A.J.; et al. XBP1 is essential for survival under hypoxic conditions and is required for tumor growth. Cancer Res. 2004, 64, 5943–5947. [Google Scholar] [CrossRef] [PubMed]
- Szegezdi, E.; Logue, S.E.; Gorman, A.M.; Samali, A. Mediators of endoplasmic reticulum stress-induced apoptosis. EMBO Rep. 2006, 7, 880–885. [Google Scholar] [CrossRef] [PubMed]
- Yanagitani, K.; Imagawa, Y.; Iwawaki, T.; Hosoda, A.; Saito, M.; Kimata, Y.; Kohno, K. Cotranslational targeting of XBP1 protein to the membrane promotes cytoplasmic splicing of its own mRNA. Mol. Cell 2009, 34, 191–200. [Google Scholar] [CrossRef] [PubMed]
- Ozcan, L.; Tabas, I. Role of endoplasmic reticulum stress in metabolic disease and other disorders. Annu. Rev. Med. 2012, 63, 317–328. [Google Scholar] [CrossRef] [PubMed]
- Scriven, P.; Coulson, S.; Haines, R.; Balasubramanian, S.; Cross, S.; Wyld, L. Activation and clinical significance of the unfolded protein response in breast cancer. Br. J. Cancer 2009, 101, 1692–1698. [Google Scholar] [CrossRef] [PubMed]
- Rutkowski, D.T.; Kaufman, R.J. That which does not kill me makes me stronger: Adapting to chronic ER stress. Trends Biochem. Sci. 2007, 32, 469–476. [Google Scholar] [CrossRef] [PubMed]
- Wang, S.; Kaufman, R.J. The impact of the unfolded protein response on human disease. J. Cell Biol. 2012, 197, 857–867. [Google Scholar] [CrossRef] [PubMed]
- Rasheva, V.I.; Domingos, P.M. Cellular responses to endoplasmic reticulum stress and apoptosis. Apoptosis 2009, 14, 996–1007. [Google Scholar] [CrossRef] [PubMed]
- Xu, C.; Bailly-Maitre, B.; Reed, J.C. Endoplasmic reticulum stress: Cell life and death decisions. J. Clin. Investig. 2005, 115, 2656–2664. [Google Scholar] [CrossRef] [PubMed]
- Cross, B.C.; Bond, P.J.; Sadowski, P.G.; Jha, B.K.; Zak, J.; Goodman, J.M.; Silverman, R.H.; Neubert, T.A.; Baxendale, I.R.; Ron, D.; et al. The molecular basis for selective inhibition of unconventional mRNA splicing by an IRE1-binding small molecule. Proc. Natl. Acad. Sci. USA 2012, 109, E869–E878. [Google Scholar] [CrossRef] [PubMed]
- Iwawaki, T.; Akai, R.; Yamanaka, S.; Kohno, K. Function of IRE1 α in the placenta is essential for placental development and embryonic viability. Proc. Natl. Acad. Sci. USA 2009, 106, 16657–16662. [Google Scholar] [CrossRef] [PubMed]
- Reimold, A.M.; Etkin, A.; Clauss, I.; Perkins, A.; Friend, D.S.; Zhang, J.; Horton, H.F.; Scott, A.; Orkin, S.H.; Byrne, M.C.; et al. An essential role in liver development for transcription factor XBP-1. Genes Dev. 2000, 14, 152–157. [Google Scholar] [PubMed]
- Al Yacoub, N.; Romanowska, M.; Haritonova, N.; Foerster, J. Optimized production and concentration of lentiviral vectors containing large inserts. J. Gene Med. 2007, 9, 579–584. [Google Scholar] [CrossRef] [PubMed]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, Y.; Xing, P.; Cui, W.; Wang, W.; Cui, Y.; Ying, G.; Wang, X.; Li, B. Acute Endoplasmic Reticulum Stress-Independent Unconventional Splicing of XBP1 mRNA in the Nucleus of Mammalian Cells. Int. J. Mol. Sci. 2015, 16, 13302-13321. https://doi.org/10.3390/ijms160613302
Wang Y, Xing P, Cui W, Wang W, Cui Y, Ying G, Wang X, Li B. Acute Endoplasmic Reticulum Stress-Independent Unconventional Splicing of XBP1 mRNA in the Nucleus of Mammalian Cells. International Journal of Molecular Sciences. 2015; 16(6):13302-13321. https://doi.org/10.3390/ijms160613302
Chicago/Turabian StyleWang, Yuanyuan, Pan Xing, Wenjing Cui, Wenwen Wang, Yanfen Cui, Guoguang Ying, Xin Wang, and Binghui Li. 2015. "Acute Endoplasmic Reticulum Stress-Independent Unconventional Splicing of XBP1 mRNA in the Nucleus of Mammalian Cells" International Journal of Molecular Sciences 16, no. 6: 13302-13321. https://doi.org/10.3390/ijms160613302