Roles of NlAKTIP in the Growth and Eclosion of the Rice Brown Planthopper, Nilaparvata lugens Stål, as Revealed by RNA Interference
Abstract
:1. Introduction
2. Results
2.1. Cloning of NlAKTIP, Sequence Comparison and Phylogenetic Analysis
2.2. The mRNA Expression of NlAKTIP in Different Colonies and Different Developmental Stages
2.3. Effects of NlAKTIP Knockdown on mRNA and Protein Expression
2.4. Effects of NlAKTIP RNAi on Body Weight and Size
2.5. Effects of NlAKTIP RNAi on Eclosion and Ovarian Development
2.6. Effects of NlAKTIP RNAi on BPH Survival Rates
3. Discussion
4. Experimental Section
4.1. Insects
4.2. Cloning of Full-Length NlAKTIP cDNA
Primer Name | Sequence (5′→3′) |
---|---|
cDNA cloning | |
3′RACE outer | TCAAACGGCAAGGCTCAT |
3′RACE inner | CGTCCACAACAATCTTCTTCGC |
5′RACE outer | AGGAGAAGAAGCGGAGGG |
5′RACE inner | GGCATAACATAGAGCCCTGGAA |
AKTIP-FL-F | ACATGGGAGACAATAACACATAACC |
AKTIP-FL-R | CGACTTTAAAGCTTCTCTTGCTGTC |
RT-qPCR | |
QAKTIP-F | TGTCTGCCAAAATGATCGAAC |
QAKTIP-R | CTCCATGATAGAGCCCTT |
Actin-F | TGCGTGACATCAAGGAGAAGC |
Actin-R | CCATACCCAAGAAGGAAGGCT |
dsRNA synthesis | |
dsAKTIP-F | GGATCCGGGAGAGCTCTATGTTATGCCCTCCG |
dsAKTIP-R | GGATCCGGGAGAGATGCTTCTTGGTTGACTGC |
dsGFP-F | GGATCCGGGATACGTGCAGGAGAGGAC |
dsGFP-R | GGATCCGGGCAGATTGTGTGGACAGG |
4.3. Gene Expression Analysis of NlAKTIP
4.4. Synthesis of dsRNA
4.5. Insect Bioassays
4.6. Antibody
4.7. Western Blot Analysis
4.8. Data Analysis
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Wang, Y.; Chen, J.; Zhu, Y.C.; Ma, C.; Huang, Y.; Shen, J. Susceptibility to neonicotinoids and risk of resistance development in the brown planthopper, Nilaparvata lugens (Stål) (Homoptera: Delphacidae). Pest. Manag. Sci. 2008, 64, 1278–1284. [Google Scholar] [PubMed]
- Jena, K.K.; Kim, S.M. Current status of brown planthopper (BPH) resistance and genetics. Rice. 2010, 3, 161–171. [Google Scholar] [CrossRef]
- Bottrell, D.G.; Schoenly, K.G. Resurrecting the ghost of green revolutions past: The brown planthopper as a recurring threat to high-yielding rice production in tropical Asia. J. Asia Pac. Entomol. 2012, 15, 122–140. [Google Scholar]
- Noda, H.; Kawai, S.; Koizumi, Y.; Matsui, K.; Zhang, Q.; Furukawa, S.; Shimomura, M.; Mita, K. Annotated ESTs from various tissues of the brown planthopper Nilaparvata lugens: A genomic resource for studying agricultural pests. BMC Genom. 2008, 9. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Liang, Q.M.; Zhou, W.W.; Jiang, Y.D.; Zhu, Q.Z.; Yu, H.; Zhang, C.X.; Gurr, G.M.; Zhu, Z.R. RNA interference of NADPH-cytochrome P450 reductase of the rice brown planthopper, Nilaparvata lugens, increases susceptibility to insecticides. Pest management science. Pest. Manag. Sci. 2015, 71, 32–39. [Google Scholar] [CrossRef] [PubMed]
- Yang, Y.; Dong, B.; Xu, H.; Zheng, X.; Tian, J.; Heong, K.; Lu, Z. Decrease of insecticide resistance over generations without exposure to insecticides in Nilaparvata lugens (Hemipteran: Delphacidae). J. Econ. Entomol. 2014, 107, 1618–1625. [Google Scholar] [PubMed]
- Zhang, X.; Liu, X.; Zhu, F.; Li, J.; You, H.; Lu, P. Field evolution of insecticide resistance in the brown planthopper (Nilaparvata lugens Stål) in China. Crop. Prot. 2014, 58, 61–66. [Google Scholar] [CrossRef]
- Staal, S.P.; Hartley, J.W.; Rowe, W.P. Isolation of transforming murine leukemia viruses from mice with a high incidence of spontaneous lymphoma. Proc. Natl. Acad. Sci. USA. 1977, 74, 3065–3067. [Google Scholar] [CrossRef] [PubMed]
- Martelli, A.M.; Faenza, I.; Billi, A.M.; Manzoli, L.; Evangelisti, C.; Falà, F.; Cocco, L. Intranuclear 3′-phosphoinositide metabolism and AKT signaling: New mechanisms for tumorigenesis and protection against apoptosis? Cell Signal. 2006, 18, 1101–1107. [Google Scholar] [CrossRef] [PubMed]
- Verdu, J.; Buratovich, M.A.; Wilder, E.L.; Birnbaum, M.J. Cell-autonomous regulation of cell and organ growth in Drosophila by AKT/PKB. Nat. Cell Biol. 1999, 1, 500–506. [Google Scholar] [CrossRef] [PubMed]
- Brazil, D.P.; Hemmings, B.A. Ten years of protein kinase B signalling: A hard AKT to follow. Trends Biochem. Sci. 2001, 26, 657–664. [Google Scholar] [CrossRef]
- Chuang, C.L.; Lu, Y.N.; Wang, H.C.; Chang, H.Y. Genetic dissection reveals that AKT is the critical kinase downstream of LRRK2 to phosphorylate and inhibit FOXO1, and promotes neuron survival. Hum. Mol. Genet. 2014. [Google Scholar] [CrossRef] [PubMed]
- Clancy, D.J.; Gems, D.; Harshman, L.G.; Oldham, S.; Stocker, H.; Hafen, E.; Leevers, S.J.; Partridge, L. Extension of life-span by loss of CHICO, a Drosophila insulin receptor substrate protein. Science 2001, 292, 104–106. [Google Scholar] [CrossRef] [PubMed]
- Taniguchi, C.M.; Emanuelli, B.; Kahn, C.R. Critical nodes in signalling pathways: Insights into insulin action. Nat. Rev. Mol. Cell Biol. 2006, 7, 85–96. [Google Scholar] [CrossRef] [PubMed]
- Yamaguchi, M.; Suyari, O.; Nagai, R.; Takahashi, M. dGirdin a new player of AKT/PKB signaling in Drosophila melanogaster. Front. Biosci. 2010, 15, 1164–1171. [Google Scholar] [CrossRef]
- Corby-Harris, V.; Drexler, A.; Watkins de Jong, L.; Antonova, Y.; Pakpour, N.; Ziegler, R.; Ramberg, F.; Lewis, E.E.; Brown, J.M.; Luckhart, S.; et al. Activation of Akt signaling reduces the prevalence and intensity of malaria parasite infection and lifespan in Anopheles stephensi mosquitoes. PLoS. Pathog. 2010, 6, e1001003. [Google Scholar] [CrossRef] [PubMed]
- Xu, H.J.; Xue, J.; Lu, B.; Zhang, X.C.; Zhuo, J.C.; He, S.F.; Ma, X.F.; Jiang, Y.Q.; Fan, H.W.; Xu, J.Y.; et al. Two insulin receptors determine alternative wing morphs in planthoppers. Nature 2015, 519, 464–467. [Google Scholar] [CrossRef] [PubMed]
- Woodard, J.; Sassano, A.; Hay, N.; Platanias, L.C. Statin-dependent suppression of the AKT/mammalian target of rapamycin signaling cascade and programmed cell death 4 up-regulation in renal cell carcinoma. Clin. Cancer Res. 2008, 14, 4640–4649. [Google Scholar] [CrossRef] [PubMed]
- Lesche, R.; Peetz, A.; van der Hoeven, F.; Rüther, U. Ft1, a novel gene related to ubiquitin-conjugating enzymes, is deleted in the Fused toes mouse mutation. Mamm. Genome. 1997, 8, 879–883. [Google Scholar] [CrossRef] [PubMed]
- Muthusami, S.; Prabakaran, D.S.; Yu, J.R.; Park, W.Y. FTS is responsible for radiation-induced nuclear phosphorylation of EGFR and repair of DNA damage in cervical cancer cells. J. Cancer. Res. Clin. Oncol. 2015, 141, 203–210. [Google Scholar] [CrossRef] [PubMed]
- Xu, L.; Sowa, M.E.; Chen, J.; Li, X.; Gygi, S.P.; Harper, J.W. An FTS/Hook/p107FHIP complex interacts with and promotes endosomal clustering by the homotypic vacuolar protein sorting complex. Mol. Biol. Cell 2008, 19, 5059–5071. [Google Scholar] [CrossRef]
- Remy, I.; Michnick, S.W. Regulation of Apoptosis by the Ft1 Protein, a new modulator of protein Kinase B/AKT. Mol. Cell. Biol. 2004, 24, 1493–1504. [Google Scholar] [CrossRef] [PubMed]
- Hao, P.Y.; Yan, M.; Lu, C.F.; Zhu, J.J.; Yu, X.P. Gene expression profiles reveal the mechanism of brown planthopper, Nilaparvata lugens getting adapted to the resistant rice. unpublished; manuscript in preparation. 2015. [Google Scholar]
- Xue, J.; Bao, Y.Y.; Li, B.L.; Cheng, Y.B.; Peng, Z.Y.; Liu, H.; Xu, H.J.; Zhu, Z.R.; Lou, Y.G.; Cheng, J.A. Transcriptome analysis of the brown planthopper Nilaparvata lugens. PLoS ONE 2010, 5, e14233. [Google Scholar] [CrossRef] [PubMed]
- Peñalver Cruz, A.; Arida, A.; Heong, K.L.; Horgan, F.G. Aspects of brown planthopper adaptation to resistant rice varieties with the Bph3 gene. Entomol. Exp. Appl. 2011, 141, 245–257. [Google Scholar] [CrossRef]
- Teleman, A. Molecular mechanisms of metabolic regulation by insulin in Drosophila. Biochem. J. 2010, 425, 13–26. [Google Scholar] [CrossRef] [PubMed]
- Kenessey, A.; Ojamaa, K. Thyroid hormone stimulates protein synthesis in the cardiomyocyte by activating the Akt-mTOR and p70S6K pathways. J. Biol. Chem. 2006, 281, 20666–20672. [Google Scholar] [CrossRef] [PubMed]
- Broughton, S.J.; Piper, M.D.; Ikeya, T.; Bass, T.M.; Jacobson, J.; Driege, Y.; Martinez, P.; Hafen, E.; Withers, D.J.; Leevers, S.J. Longer lifespan, altered metabolism, and stress resistance in Drosophila from ablation of cells making insulin-like ligands. Proc. Natl. Acad. Sci. USA. 2005, 102, 3105–3110. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Felix, T.M.; Hughes, K.A.; Stone, E.A.; Drnevich, J.M.; Leips, J. Age-specific variation in immune response in Drosophila melanogaster has a genetic basis. Genetics 2012, 191, 989–1002. [Google Scholar] [CrossRef] [PubMed]
- Zhang, H.; Liu, J.; Li, C.R.; Momen, B.; Kohanski, R.A.; Pick, L. Deletion of Drosophila insulin-like peptides causes growth defects and metabolic abnormalities. Proc. Natl. Acad. Sci. USA 2009, 106, 19617–19622. [Google Scholar] [CrossRef] [PubMed]
- DiAngelo, J.R.; Bland, M.L.; Bambina, S.; Cherry, S.; Birnbaum, M.J. The immune response attenuates growth and nutrient storage in Drosophila by reducing insulin signaling. Proc. Natl. Acad. Sci. USA 2009, 106, 20853–20858. [Google Scholar] [CrossRef]
- Cornils, A.; Gloeck, M.; Chen, Z.; Zhang, Y.; Alcedo, J. Specific insulin-like peptides encode sensory information to regulate distinct developmental processes. Development 2011, 138, 1183–1193. [Google Scholar] [CrossRef] [PubMed]
- Lu, C.F.; Hao, P.Y.; Ma, Y.; Zhu, J.J.; Feng, Y.L.; Yu, X.P. Molecular cloning and function analysis of phosphatidyl inositol 3 kinase p85α subunit gene NlPIK3R1 in the brown planthopper, Nilaparvata lugens (Hemiptera: Delphacidae). Acta. Entomol. Sin. 2015, 58, 487–495. [Google Scholar]
- Hunter, W.; Ellis, J.; Vanengelsdorp, D.; Hayes, J.; Westervelt, D.; Glick, E.; Paldi, N. Large-scale field application of RNAi technology reducing Israeli acute paralysis virus disease in honey bees (Apis. mellifera, Hymenoptera: Apidae). PLoS Pathog. 2010, 6, e1001160. [Google Scholar] [CrossRef] [PubMed]
- Chen, J.; Zhang, D.; Yao, Q.; Zhang, J.; Dong, X.; Tian, H.; Zhang, W. Feeding-based RNA interference of a trehalose phosphate synthase gene in the brown planthopper, Nilaparvata lugens. Insect. Mol. Biol. 2010, 19, 777–786. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCt method. Methods 2001, 25, 402–408. [Google Scholar] [CrossRef] [PubMed]
- Milligan, J.F.; Groebe, D.R.; Witherell, G.W.; Uhlenbeck, O.C. Oligoribonucleotide synthesis using T7 RNA polymerase and synthetic DNA templates. Nucleic Acids Res. 1987, 15, 8783–8798. [Google Scholar] [CrossRef] [PubMed]
- Fu, Q.; Zhang, Z.; Hu, C.; Lai, F.; Sun, Z. A chemically defined diet enables continuous rearing of the brown planthopper, Nilaparvata lugens (Stål) (Homoptera: Delphacidae). Appl. Entomol. Zool. 2001, 36, 111–116. [Google Scholar] [CrossRef]
- Dong, S.Z.; Ma, Y.; Hou, Y.; Yu, X.; Ye, G. Development of an ELISA for evaluating the reproductive status of female brown planthopper, Nilaparvata lugens, by measuring vitellogenin and vitellin levels. Entomol. Exp. Appl. 2001, 139, 103–110. [Google Scholar] [CrossRef]
© 2015 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Hao, P.; Lu, C.; Ma, Y.; Xu, L.; Zhu, J.; Yu, X. Roles of NlAKTIP in the Growth and Eclosion of the Rice Brown Planthopper, Nilaparvata lugens Stål, as Revealed by RNA Interference. Int. J. Mol. Sci. 2015, 16, 22888-22903. https://doi.org/10.3390/ijms160922888
Hao P, Lu C, Ma Y, Xu L, Zhu J, Yu X. Roles of NlAKTIP in the Growth and Eclosion of the Rice Brown Planthopper, Nilaparvata lugens Stål, as Revealed by RNA Interference. International Journal of Molecular Sciences. 2015; 16(9):22888-22903. https://doi.org/10.3390/ijms160922888
Chicago/Turabian StyleHao, Peiying, Chaofeng Lu, Yan Ma, Lingbo Xu, Jiajun Zhu, and Xiaoping Yu. 2015. "Roles of NlAKTIP in the Growth and Eclosion of the Rice Brown Planthopper, Nilaparvata lugens Stål, as Revealed by RNA Interference" International Journal of Molecular Sciences 16, no. 9: 22888-22903. https://doi.org/10.3390/ijms160922888