Changes in Air CO2 Concentration Differentially Alter Transcript Levels of NtAQP1 and NtPIP2;1 Aquaporin Genes in Tobacco Leaves
Abstract
:1. Introduction
2. Results
2.1. Leaf-to-Air Gas Exchange Responses to CO2 Enrichment and Impairment
2.2. Expression Analysis of NtAQP1 and NtPIP2;1
3. Discussion
4. Materials and Methods
4.1. Plant Materials, CO2 Treatment and Gas Exchange Measurements
4.2. RNA Extraction, cDNA Synthesis and Real Time PCR
4.3. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
Ci | leaf internal (substomatal) CO2 concentration |
Gs | stomatal conductance |
Pn | leaf net photosynthesis |
E | transpiration rate |
ANOVA | analysis of variance |
References
- Kaldenhoff, R.; Ribas-Carbo, M.; Flexas, J.; Lovisolo, C.; Heckwolf, M.; Uehlein, N. Aquaporins and plant water balance. Plant Cell Environ. 2008, 31, 658–666. [Google Scholar] [CrossRef] [PubMed]
- Maurel, C.; Boursiac, Y.; Luu, D.T.; Santoni, V.; Shahzad, Z.; Verdoucq, L. Aquaporins in plants. Physiol. Rev. 2015, 95, 1321–1358. [Google Scholar] [CrossRef] [PubMed]
- Hirano, Y.; Okimoto, N.; Kadohira, I.; Suematsu, M.; Yasuoka, K.; Yasui, M. Molecular mechanisms of how mercury inhibits water permeation through Aquaporin1: Understanding by molecular dynamics simulation. Biophys. J. 2010, 98, 1512–1519. [Google Scholar] [CrossRef] [PubMed]
- Hachez, C.; Zelazny, E.; Chaumont, F. Modulating the expression of aquaporin genes in planta: A key to understand their physiological functions? Biochim. Biophys. Acta 2006, 1758, 1142–1156. [Google Scholar] [CrossRef] [PubMed]
- Perrone, I.; Gambino, G.; Chitarra, W.; Vitali, M.; Pagliarani, C.; Riccomagno, N.; Balestrini, R.; Kaldenhoff, R.; Uehlein, N.; Gribaudo, I.; et al. The Grapevine Root-Specific Aquaporin VvPIP2;4N Controls Root Hydraulic Conductance and Leaf Gas Exchange under Well-Watered Conditions But Not under Water Stress. Plant Physiol. 2012, 160, 965–977. [Google Scholar] [CrossRef] [PubMed]
- Secchi, F.; Zwieniecki, M.A. The physiological response of Populus tremula x alba leaves to the down-regulation of PIP1 aquaporin gene expression under no water stress. Front. Plant Sci. 2013, 4, 507. [Google Scholar] [CrossRef] [PubMed]
- Secchi, F.; Zwieniecki, M.A. Down-Regulation of Plasma Intrinsic Protein1 Aquaporin in Poplar Trees Is Detrimental to Recovery from Embolism. Plant Physiol. 2014, 164, 1789–1799. [Google Scholar] [CrossRef] [PubMed]
- Lopez, D.; Bronner, G.; Brunel, N.; Auguin, D.; Bourgerie, S.; Brignolas, F.; Carpin, S.; Tournaire-Roux, C.; Maurel, C.; Fumanal, B.; et al. Insights into Populus XIP aquaporins: Evolutionary expansion, protein functionality, and environmental regulation. J. Exp. Bot. 2012, 63, 2217–2230. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Uehlein, N.; Sperling, H.; Heckwolf, M.; Kaldenhoff, R. The Arabidopsis aquaporin PIP1;2 rules cellular CO2 uptake. Plant Cell Environ. 2012, 35, 1077–1083. [Google Scholar] [CrossRef] [PubMed]
- Mori, I.C.; Rhee, J.; Shibasaka, M.; Sasano, S.; Kaneko, T.; Horie, T.; Katsuhara, M. CO2 Transport by PIP2 Aquaporins of Barley. Plant Cell Physiol. 2014, 55, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Terashima, I.; Ono, K. Effects of HgCl2 on CO2 dependence of leaf photosynthesis: Evidence indicating involvement of aquaporins in CO2 diffusion across the plasma membrane. Plant Cell Physiol. 2002, 43, 70–78. [Google Scholar] [CrossRef] [PubMed]
- Uehlein, N.; Lovisolo, C.; Siefritz, F.; Kaldenhoff, R. The tobacco aquaporin NtAQP1 is a membrane CO2 pore with physiological functions. Nature 2003, 425, 734–737. [Google Scholar] [CrossRef] [PubMed]
- Uehlein, N.; Otto, B.; Hanson, D.T.; Fischer, M.; McDowell, N.; Kaldenhoff, R. Function of Nicotiana tabacum aquaporins as chloroplast gas pores challenges the concept of membrane CO2 permeability. Plant Cell 2008, 20, 648–657. [Google Scholar] [CrossRef] [PubMed]
- Hanba, Y.T.; Shibasaka, M.; Hayashi, Y.; Hayakawa, T.; Kasamo, K.; Terashima, I.; Katsuhara, M. Overexpression of the barley aquaporin HvPIP2;1 increases internal CO2 conductance and CO2 assimillation in the leaves of transgenic rice plants. Plant Cell Physiol. 2004, 45, 521–529. [Google Scholar] [CrossRef] [PubMed]
- Flexas, J.; Ribas-Carbo, M.; Hanson, D.T.; Bota, J.; Otto, B.; Cifre, J.; McDowell, N.; Medrano, H.; Kaldenhoff, R. Tobacco aquaporin NtAQP1 is involved in mesophyll conductance to CO2 in vivo. Plant J. 2006, 48, 427–439. [Google Scholar] [CrossRef] [PubMed]
- Heckwolf, M.; Pater, D.; Hanson, D.T.; Kaldenhoff, R. The Arabidopsis thaliana aquaporin AtPIP1;2 is a physiologically relevant CO2 transport facilitator. Plant J. 2011, 67, 795–804. [Google Scholar] [CrossRef] [PubMed]
- Sade, N.; Galle, A.; Flexas, J.; Lerner, S.; Peleg, G.; Yaaran, A.; Moshelion, M. Differential tissue-specific expression of NtAQP1 in Arabidopsis thaliana reveals a role for this protein in stomatal and mesophyll conductance of CO2 under standard and salt-stress conditions. Planta 2014, 239, 357–366. [Google Scholar] [CrossRef] [PubMed]
- Evans, J.R.; Kaldenhoff, R.; Genty, B.; Terashima, I. Resistances along the CO2 diffusion pathway inside leaves. J. Exp. Bot. 2009, 60, 2235–2248. [Google Scholar] [CrossRef] [PubMed]
- Otto, B.; Kaldenhoff, R. Cell-specific expression of the mercury-insensitive plasma-membrane aquaporin NtAQP1 from Nicotiana tabacum. Planta 2000, 211, 167–172. [Google Scholar] [PubMed]
- Biela, A.; Grote, K.; Otto, B.; Hoth, S.; Hedrich, R.; Kaldenhoff, R. The Nicotiana tabacum plasma membrane aquaporin NtAQP1 is mercury-insensitive and permeable for glycerol. Plant J. 1999, 18, 565–570. [Google Scholar] [CrossRef] [PubMed]
- Bots, M.; Feron, R.; Uehlein, N.; Weterings, K.; Kaidenhoff, R.; Mariani, T. PIP1 and PIP2 aquaporins are differentially expressed during tobacco anther and stigma development. J. Exp. Bot. 2005, 56, 113–121. [Google Scholar] [CrossRef] [PubMed]
- Mahdieh, M.; Mostajeran, A.; Horie, T.; Katsuhara, M. Drought stress alters water relations and expression of PIP-type aquaporin genes in Nicotiana tabacum plants. Plant Cell Physiol. 2008, 49, 801–813. [Google Scholar] [CrossRef] [PubMed]
- Mahdieh, M.; Mostajeran, A. Abscisic acid regulates root hydraulic conductance via aquaporin expression modulation in Nicotiana tabacum. J. Plant Physiol. 2009, 166, 1993–2003. [Google Scholar] [CrossRef] [PubMed]
- Otto, B.; Uehlein, N.; Sdorra, S.; Fischer, M.; Ayaz, M.; Belastegui-Macadam, X.; Heckwolf, M.; Lachnit, M.; Pede, N.; Priem, N.; et al. Aquaporin Tetramer Composition Modifies the Function of Tobacco Aquaporins. J. Biol. Chem. 2010, 285, 31253–31260. [Google Scholar] [CrossRef] [PubMed]
- Mott, K.A. Sensing of atmospheric CO2 by plants. Plant Cell Environ. 1990, 13, 731–737. [Google Scholar] [CrossRef]
- Taylor, G.; Street, N.R.; Tricker, P.J.; Sjodin, A.; Graham, L.; Skogstrom, O.; Calfapietra, C.; Scarascia-Mugnozza, G.; Jansson, S. The transcriptome of Populus in elevated CO2. New Phytol. 2005, 167, 143–154. [Google Scholar] [CrossRef] [PubMed]
- Niinemets, U.; Diaz-Espejo, A.; Flexas, J.; Galmes, J.; Warren, C.R. Role of mesophyll diffusion conductance in constraining potential photosynthetic productivity in the field. J. Exp. Bot. 2009, 60, 2249–2270. [Google Scholar] [CrossRef] [PubMed]
- Flexas, J.; Diaz-Espejo, A.; Galmes, J.; Kaldenhoff, R.; Medrano, H.; Ribas-Carbo, M. Rapid variations of mesophyll conductance in response to changes in CO2 concentration around leaves. Plant Cell Environ. 2007, 30, 1284–1298. [Google Scholar] [CrossRef] [PubMed]
- Miyazawa, S.; Yoshimura, S.; Shinzaki, Y.; Maeshima, M.; Miyake, C. Deactivation of aquaporins decreases internal conductance to CO2 diffusion in tobacco leaves grown under long-term drought. Funct. Plant Biol. 2008, 35, 553–564. [Google Scholar] [CrossRef]
- Ferrio, J.P.; Pou, A.; Florez-Sarasa, I.; Gessler, A.; Kodama, N.; Flexas, J.; Ribas-Carbo, M. The Peclet effect on leaf water enrichment correlates with leaf hydraulic conductance and mesophyll conductance for CO2. Plant Cell Environ. 2012, 35, 611–625. [Google Scholar] [CrossRef] [PubMed]
- Lopez, M.; Bousser, A.S.; Sissoeff, I.; Gaspar, M.; Lachaise, B.; Hoarau, J.; Mahe, A. Diurnal regulation of water transport and aquaporin gene expression in maize roots: Contribution of PIP2 proteins. Plant Cell Physiol. 2003, 44, 1384–1395. [Google Scholar] [CrossRef] [PubMed]
- Siefritz, F.; Otto, B.; Bienert, G.P.; van der Krol, A.; Kaldenhoff, R. The plasma membrane aquaporin NtAQP1 is a key component of the leaf unfolding mechanism in tobacco. Plant J. 2004, 37, 147–155. [Google Scholar] [CrossRef] [PubMed]
- Von Caemmerer, S.; Farquhar, G.D. Some relationships between the biochemistry of photosynthesis and the gas exchange of leaves. Planta 1981, 153, 376–387. [Google Scholar] [CrossRef] [PubMed]
- Pieruschka, R.; Schurr, U.; Jensen, M.; Wolff, W.F.; Jahnke, S. Lateral diffusion of CO2 from shaded to illuminated leaf parts affects photosynthesis inside homobaric leaves. New Phytol. 2006, 169, 779–787. [Google Scholar] [CrossRef] [PubMed]
- Morison, J.I.L.; Gallouet, E.; Lawson, T.; Cornic, G.; Herbin, R.; Baker, N.R. Lateral diffusion of CO2 in leaves is not sufficient to support photosynthesis. Plant Physiol. 2005, 139, 254–266. [Google Scholar] [CrossRef] [PubMed]
- Morison, J.I.L.; Lawson, T.; Cornic, G. Lateral CO2 diffusion inside dicotyledonous leaves can be substantial: Quantification in different light intensities. Plant Physiol. 2007, 145, 680–690. [Google Scholar] [CrossRef] [PubMed]
- Pieruschka, R.; Chavarria-Krauser, A.; Cloos, K.; Scharr, H.; Schurr, U.; Jahnke, S. Photosynthesis can be enhanced by lateral CO2 diffusion inside leaves over distances of several millimeters. New Phytol. 2008, 178, 335–347. [Google Scholar] [CrossRef] [PubMed]
- Ainsworth, E.A.; Rogers, A.; Vodkin, L.O.; Walter, A.; Schurr, U. The effects of elevated CO2 concentration on soybean gene expression. An analysis of growing and mature leaves. Plant Physiol. 2006, 142, 135–147. [Google Scholar] [CrossRef] [PubMed]
- Rothan, C.; Duret, S.; Chevalier, C.; Raymond, P. Suppression of ripening-associated gene expression in tomato fruits subjected to a high CO2 concentration. Plant. Physiol. 1997, 114, 255–263. [Google Scholar] [PubMed]
- Fernandez-Caballero, C.; Rosales, R.; Romero, I.; Escribano, M.I.; Merodio, C.; Sanchez-Ballesta, M.T. Unraveling the roles of CBF1, CBF4 and dehydrin 1 genes in the response of table grapes to high CO2 levels and low temperature. J. Plant Physiol. 2012, 169, 744–748. [Google Scholar] [CrossRef] [PubMed]
- Springer, C.J.; Orozco, R.A.; Kelly, J.K.; Ward, J.K. Elevated CO2 influences the expression of floral-initiation genes in Arabidopsis thaliana. New Phytol. 2008, 178, 63–67. [Google Scholar] [CrossRef] [PubMed]
- Galmés, J.; Pou, A.; Alsina, M.M.; Tomàs, M.; Medrano, H.; Flexas, J. Aquaporin expression in response to different water stress intensities and recovery in Richter-110 (Vitis sp.): Relationship with ecophysiological status. Planta 2007, 226, 671–681. [Google Scholar] [CrossRef] [PubMed]
- Secchi, F.; Lovisolo, C.; Uehlein, N.; Kaldenhoff, R.; Schubert, A. Isolation and functional characterization of three aquaporins from olive (Olea europaea L.). Planta 2007, 225, 381–392. [Google Scholar] [CrossRef] [PubMed]
- Perrone, I.; Pagliarini, C.; Lovisolo, C.; Chitarra, W.; Roman, F.; Schubert, A. Recovery from water stress affects grape leaf petiole transcriptome. Planta 2012, 235, 1383–1396. [Google Scholar] [CrossRef] [PubMed]
- Farquhar, G.D.; von Caemmerer, S.; Berry, J.A. Models of photosynthesis. Plant Physiol. 2001, 125, 42–45. [Google Scholar] [CrossRef] [PubMed]
- Sade, N.; Shatil-Cohen, A.; Attia, Z.; Maurel, C.; Boursiac, Y.; Kelly, G.; Granot, D.; Yaaran, A.; Lerner, S.; Moshelion, M. The Role of Plasma Membrane Aquaporins in Regulating the Bundle Sheath-Mesophyll Continuum and Leaf Hydraulics. Plant Physiol. 2014, 166, 1609. [Google Scholar] [CrossRef] [PubMed]
- Agre, P. Aquaporin water channels (Nobel lecture). Angew. Chem. Int. Ed. 2004, 43, 4278–4290. [Google Scholar] [CrossRef] [PubMed]
- Kaldenhoff, R.; Grote, K.; Zhu, J.J.; Zimmermann, U. Significance of plasmalemma aquaporins for water-transport in Arabidopsis thaliana. Plant J. 1998, 14, 121–128. [Google Scholar] [CrossRef] [PubMed]
- Lovisolo, C.; Secchi, F.; Nardini, A.; Salleo, S.; Buffa, R.; Schubert, A. Expression of PIP1 and PIP2 aquaporins is enhanced in olive dwarf genotypes and is related to root and leaf hydraulic conductance. Physiol. Plant. 2007, 130, 543–551. [Google Scholar] [CrossRef]
- Tournaire-Roux, C.; Sutka, M.; Javot, H.; Gout, E.; Gerbeau, P.; Luu, D.T.; Bligny, R.; Maurel, C. Cytosolic pH regulates root water transport during anoxic stress through gating of aquaporins. Nature 2003, 425, 393–397. [Google Scholar] [CrossRef] [PubMed]
- Prescott, A.; Martin, C. A rapid method for the quantitative assessment of levels of specific mRNAs in plants. Plant Mol. Biol. Rep. 1987, 4, 219–224. [Google Scholar] [CrossRef]
- Rozen, S.; Skaletsky, H.J. Primer 3 on the WWW for general users and for biologist programmers. In Bioinformatics Methods and Protocols: Methods in Molecular Biology; Krawetz, S., Misener, S., Eds.; Humana Press: Totowa, NJ, USA, 2000; pp. 365–386. [Google Scholar]
- Rasmussen, R. Quantification on the LightCycler instrument. In Rapid Cycle Real-Time PCR: Methods and Application; Meuer, S., Wittwer, C., Nakagawara, K., Eds.; Springer: Berlin, Germany; Heidelberg, Germany; New York, NY, USA, 2001; pp. 21–34. [Google Scholar]
- Cramer, G.R.; Urano, K.; Delrot, S.; Pezzotti, M.; Shinozaki, K. Effects of abiotic stress on plants: A systems biology perspective. BMC Plant Biol. 2011, 11, 163. [Google Scholar] [CrossRef] [PubMed]
- Kaldenhoff, R.; Kai, L.; Uehlein, N. Aquaporins and membrane diffusion of CO2 in living organisms. Biochim. Biophys. Acta 2014, 1840, 1592–1595. [Google Scholar] [CrossRef] [PubMed]
Gene Name | Forward Primer (5′–3′) | Reverse Primer (5′–3′) |
---|---|---|
NtAQP1 | CTGGATCTTTTGGGTTGGAC | CAGAAAGATTAAGGCTTCTTGAGG |
NtPIP2;1 | CATTTGTGGGAGCATTGGTA | CTGGTAGTGGTTGCAAAAGTTG |
NtEF-1α | CTCTCTGCGTACCCACCATT | TAGCACCAGTTGGGTCCTTC |
Actin | CGTCCTTAGTGGTGGAACA | GCCACCACCTTGATCTTC |
© 2016 by the authors; licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons by Attribution (CC-BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Secchi, F.; Schubert, A.; Lovisolo, C. Changes in Air CO2 Concentration Differentially Alter Transcript Levels of NtAQP1 and NtPIP2;1 Aquaporin Genes in Tobacco Leaves. Int. J. Mol. Sci. 2016, 17, 567. https://doi.org/10.3390/ijms17040567
Secchi F, Schubert A, Lovisolo C. Changes in Air CO2 Concentration Differentially Alter Transcript Levels of NtAQP1 and NtPIP2;1 Aquaporin Genes in Tobacco Leaves. International Journal of Molecular Sciences. 2016; 17(4):567. https://doi.org/10.3390/ijms17040567
Chicago/Turabian StyleSecchi, Francesca, Andrea Schubert, and Claudio Lovisolo. 2016. "Changes in Air CO2 Concentration Differentially Alter Transcript Levels of NtAQP1 and NtPIP2;1 Aquaporin Genes in Tobacco Leaves" International Journal of Molecular Sciences 17, no. 4: 567. https://doi.org/10.3390/ijms17040567