Reprimo, a Potential p53-Dependent Tumor Suppressor Gene, Is Frequently Hypermethylated in Estrogen Receptor α-Positive Breast Cancer
Abstract
:1. Introduction
2. Results
2.1. Hypermethylation in CpG-Island (CGIs) of Reprimo (RPRM) Is Frequently Found in Estrogen Receptor α–Positive (ERα) Breast Cancer
2.2. High Methylation Intensity in CGIs Is Inversely Correlated with Transcriptional Expression of RPRM
3. Discussion
4. Materials and Methods
4.1. Tissue Samples
4.2. DNA Methylation Profiles
4.3. Cell Line Culture
4.4. mRNA Expression by Real-Time PCR
4.5. Quantitative Methylation-Specific PCR (qMSP)
4.6. Ethics Statement
4.7. Statistical Analysis
5. Conclusions
Supplementary Materials
Acknowledgments
Author Contributions
Conflicts of Interest
Abbreviations
RPRM | Reprimo |
BC | Breast cancer |
CGIs | CpG-islands |
ERα | Estrogen receptor α |
PR | Progesterone receptor |
TNBC | Triple negative breast cancer |
CMS | Cancer methylome system |
MBD | Methyl-CpG binding domain |
References
- Ferlay, J.; Soerjomataram, I.; Ervik, M.; Dikshit, R.; Eser, S.; Mathers, C.; Rebelo, M.; Parkin, D.M.; Forman, D.; Bray, F. Cancer incidence and mortality worldwide: Sources, methods and major patterns in GLOBOCAN 2012. Int. J. Cancer 2015, 136, E359–E386. [Google Scholar] [CrossRef] [PubMed]
- Sørlie, T.; Perou, C.M.; Tibshirani, R.; Aas, T.; Geisler, S.; Johnsen, H.; Hastie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; et al. Gene expression patterns of breast carcinomas distinguish tumor subclasses with clinical implications. Proc. Natl. Acad. Sci. USA 2001, 98, 10869–10874. [Google Scholar] [CrossRef] [PubMed]
- Yersal, O.; Barutca, S. Biological subtypes of breast cancer: Prognostic and therapeutic implications. World J. Clin. Oncol. 2014, 5, 412–424. [Google Scholar] [CrossRef] [PubMed]
- Perou, C.M.; Sùrlie, T.; Eisen, M.B.; van de Rijn, M.; Jeffrey, S.S.; Rees, C.A.; Pollack, J.R.; Ross, D.T.; Johnsen, H.; Akslen, L.A.; et al. Molecular portraits of human breast tumours. Nature 2000, 406, 747–752. [Google Scholar] [CrossRef] [PubMed]
- Kwan, M.L.; Kushi, L.H.; Weltzien, E.; Maring, B.; Kutner, S.E.; Fulton, R.S.; Lee, M.M.; Ambrosone, C.B.; Caan, B.J. Epidemiology of breast cancer subtypes in two prospective cohort studies of breast cancer survivors. Breast Cancer Res. 2009, 11, R31. [Google Scholar] [CrossRef] [PubMed]
- Livasy, C.A.; Karaca, G.; Nanda, R.; Tretiakova, M.S.; Olopade, O.I.; Moore, D.T.; Perou, C.M. Phenotypic evaluation of the basal-like subtype of invasive breast carcinoma. Mod. Pathol. 2006, 19, 264–271. [Google Scholar] [CrossRef] [PubMed]
- García-Becerra, R.; Santos, N.; Díaz, L.; Camacho, J. Mechanisms of resistance to endocrine therapy in breast cancer: Focus on signaling pathways, miRNAs and genetically based resistance. Int. J. Mol. Sci. 2013, 14, 108–145. [Google Scholar] [CrossRef] [PubMed]
- Ross-Innes, C.S.; Stark, R.; Holmes, K.A.; Schmidt, D.; Spyrou, C.; Russell, R.; Massie, C.E.; Vowler, S.L.; Eldridge, M.; Carroll, J.S. Cooperative interaction between retinoic acid receptor-α and estrogen receptor in breast cancer. Genes Dev. 2010, 24, 171–182. [Google Scholar] [CrossRef] [PubMed]
- Marino, M.; Galluzzo, P.; Ascenzi, P. Estrogen signaling multiple pathways to impact gene transcription. Curr. Genom. 2006, 7, 497–508. [Google Scholar] [CrossRef]
- Tang, S. ERGDB: Estrogen responsive genes database. Nucleic Acids Res. 2004, 32, D533–D536. [Google Scholar] [CrossRef] [PubMed]
- Malik, S.; Jiang, S.; Garee, J.P.; Verdin, E.; Lee, A.V.; O’Malley, B.W.; Zhang, M.; Belaguli, N.S.; Oesterreich, S. Histone deacetylase 7 and FoxA1 in estrogen-mediated repression of RPRM. Mol. Cell. Biol. 2010, 30, 399–412. [Google Scholar] [CrossRef] [PubMed]
- Ohki, R.; Nemoto, J.; Murasawa, H.; Oda, E.; Inazawa, J.; Tanaka, N.; Taniguchi, T. Reprimo, a new candidate mediator of the p53-mediated cell cycle arrest at the G2 phase. J. Biol. Chem. 2000, 275, 22627–22630. [Google Scholar] [CrossRef] [PubMed]
- Sato, N.; Fukushima, N.; Maitra, A.; Matsubayashi, H.; Yeo, C.J.; Cameron, J.L.; Hruban, R.H.; Goggins, M. Discovery of novel targets for aberrant methylation in pancreatic carcinoma using high-throughput microarrays. Cancer Res. 2003, 63, 3735–3742. [Google Scholar] [PubMed]
- Hamilton, J.P.; Sato, F.; Greenwald, B.D.; Suntharalingam, M.; Krasna, M.J.; Edelman, M.J.; Doyle, A.; Berki, A.T.; Abraham, J.M.; Mori, Y.; et al. Promoter methylation and response to chemotherapy and radiation in esophageal cancer. Clin. Gastroenterol. Hepatol. 2006, 4, 701–708. [Google Scholar] [CrossRef] [PubMed]
- Bernal, C.; Aguayo, F.; Villarroel, C.; Vargas, M.; Díaz, I.; Ossandon, F.J.; Santibáñez, E.; Palma, M.; Aravena, E.; Barrientos, C.; et al. Reprimo as a potential biomarker for early detection in gastric cancer. Clin. Cancer Res. 2008, 14, 6264–6269. [Google Scholar] [CrossRef] [PubMed]
- Yoshino, M.; Suzuki, M.; Tian, L.; Moriya, Y.; Hoshino, H.; Okamoto, T.; Yoshida, S.; Shibuya, K.; Yoshino, I. Promoter hypermethylation of the p16 and Wif-1 genes as an independent prognostic marker in stage IA non-small cell lung cancers. Int. J. Oncol. 2009, 35, 1201–1209. [Google Scholar] [CrossRef] [PubMed]
- Xu, M.; Knox, A.J.; Michaelis, K.A.; Kiseljak-Vassiliades, K.; Kleinschmidt-DeMasters, B.K.; Lillehei, K.O.; Wierman, M.E. Reprimo (RPRM) is a novel tumor suppressor in pituitary tumors and regulates survival, proliferation, and tumorigenicity. Endocrinology 2012, 153, 2963–2973. [Google Scholar] [CrossRef] [PubMed]
- Ooki, A.; Yamashita, K.; Yamaguchi, K.; Mondal, A.; Nishimiya, H.; Watanabe, M. DNA damage-inducible gene, reprimo functions as a tumor suppressor and is suppressed by promoter methylation in gastric cancer. Mol. Cancer Res. 2013, 11, 1362–1374. [Google Scholar] [CrossRef] [PubMed]
- Liu, L.; Yang, X. Implication of Reprimo and hMLH1 gene methylation in early diagnosis of gastric carcinoma. Int. J. Clin. Exp. Pathol. 2015, 8, 14977–14982. [Google Scholar] [PubMed]
- Kovalchuk, O.; Tryndyak, V.P.; Montgomery, B.; Boyko, A.; Kutanzi, K.; Zemp, F.; Warbritton, A.R.; Latendresse, J.R.; Kovalchuk, I.; Beland, F.A.; et al. Estrogen-induced rat breast carcinogenesis is characterized by alterations in DNA methylation, histone modifications and aberrant microRNA expression. Cell Cycle 2007, 6, 2010–2018. [Google Scholar] [CrossRef] [PubMed]
- Kutanzi, K.R.; Koturbash, I.; Kovalchuk, O. Reversibility of pre-malignant estrogen-induced epigenetic changes. Cell Cycle 2010, 9, 3078–3084. [Google Scholar] [CrossRef] [PubMed]
- Rodriguez, B.A.T.; Weng, Y.-I.; Liu, T.-M.; Zuo, T.; Hsu, P.-Y.; Lin, C.-H.; Cheng, A.-L.; Cui, H.; Yan, P.S.; Huang, T.H.-M. Estrogen-mediated epigenetic repression of the imprinted gene cyclin-dependent kinase inhibitor 1C in breast cancer cells. Carcinogenesis 2011, 32, 812–821. [Google Scholar] [CrossRef] [PubMed]
- Tan, S.K.; Lin, Z.H.; Chang, C.W.; Varang, V.; Chng, K.R.; Pan, Y.F.; Yong, E.L.; Sung, W.K.; Cheung, E. AP-2γ regulates oestrogen receptor-mediated long-range chromatin interaction and gene transcription. EMBO J. 2011, 30, 2569–2581. [Google Scholar] [CrossRef] [PubMed]
- Li, L.; Lee, K.-M.; Han, W.; Choi, J.-Y.; Lee, J.-Y.; Kang, G.H.; Park, S.K.; Noh, D.-Y.; Yoo, K.-Y.; Kang, D. Estrogen and progesterone receptor status affect genome-wide DNA methylation profile in breast cancer. Hum. Mol. Genet. 2010, 19, 4273–4277. [Google Scholar] [CrossRef] [PubMed]
- Shi, J.-F.; Li, X.-J.; Si, X.-X.; Li, A.-D.; Ding, H.-J.; Han, X.; Sun, Y.-J. ERα positively regulated DNMT1 expression by binding to the gene promoter region in human breast cancer MCF-7 cells. Biochem. Biophys. Res. Commun. 2012, 427, 47–53. [Google Scholar] [CrossRef] [PubMed]
- Hsu, P.Y.; Hsu, H.K.; Singer, G.A.C.; Yan, P.S.; Rodriguez, B.A.T.; Liu, J.C.; Weng, Y.I.; Deatherage, D.E.; Chen, Z.; Pereira, J.S.; et al. Estrogen-mediated epigenetic repression of large chromosomal regions through DNA looping. Genome Res. 2010, 20, 733–744. [Google Scholar] [CrossRef] [PubMed]
- Hsu, P.Y.; Hsu, H.K.; Lan, X.; Juan, L.; Yan, P.; Labanowska, J.; Heerema, N.; Hsiao, T.H.; Chiu, Y.C.; Chen, Y.; et al. Amplification of distant estrogen response elements deregulates target genes associated with tamoxifen resistance in breast cancer. Cancer Cell 2013, 24, 197–212. [Google Scholar] [CrossRef] [PubMed]
- Jadhav, R.R.; Ye, Z.; Huang, R.-L.; Liu, J.; Hsu, P.-Y.; Huang, Y.-W.; Rangel, L.B.; Lai, H.-C.; Roa, J.C.; Kirma, N.B.; et al. Genome-wide DNA methylation analysis reveals estrogen-mediated epigenetic repression of metallothionein-1 gene cluster in breast cancer. Clin. Epigenet. 2015, 7, 13. [Google Scholar] [CrossRef] [PubMed]
- Gu, F.; Doderer, M.S.; Huang, Y.W.; Roa, J.C.; Goodfellow, P.J.; Kizer, E.L.; Huang, T.H M.; Chen, Y. CMS: A Web-Based System for Visualization and Analysis of Genome-Wide Methylation Data of Human Cancers. PLoS ONE 2013, 8. [Google Scholar] [CrossRef] [PubMed]
- Hamilton, J.P.; Sato, F.; Jin, Z.; Greenwald, B.D.; Ito, T.; Mori, Y.; Paun, B.C.; Kan, T.; Cheng, Y.; Wang, S.; et al. Reprimo methylation is a potential biomarkerof Barrett’s-associated esophageal neoplastic progression. Clin. Cancer Res. 2006, 12, 6637–6642. [Google Scholar] [CrossRef] [PubMed]
- Luo, J.; Zhu, Y.; Yang, G.; Gong, L.; Wang, B.; Liu, H. Loss of Reprimo and S100A2 expression in human gastric adenocarcinoma. Diagn. Cytopathol. 2011, 39, 752–757. [Google Scholar] [CrossRef] [PubMed]
- Ushijima, T. Epigenetic field for cancerization. J. Biochem. Mol. Biol. 2007, 40, 142–150. [Google Scholar] [CrossRef] [PubMed]
- Wong, T.S.; Kwong, D.L.-W.; Sham, J.S.-T.; Wei, W.I.; Yuen, A.P.-W. Methylation status of Reprimo in head and neck carcinomas. Int. J. Cancer 2005, 117, 697. [Google Scholar] [CrossRef] [PubMed]
- Ellinger, J.; Bastian, P.J.; Jurgan, T.; Biermann, K.; Kahl, P.; Heukamp, L.C.; Wernert, N.; Müller, S.C.; von Ruecker, A. CpG island hypermethylation at multiple gene sites in diagnosis and prognosis of prostate cancer. Urology 2008, 71, 161–167. [Google Scholar] [CrossRef] [PubMed]
- Nishida, N.; Nagasaka, T.; Nishimura, T.; Ikai, I.; Boland, C.R.; Goel, A. Aberrant methylation of multiple tumor suppressor genes in aging liver, chronic hepatitis, and hepatocellular carcinoma. Hepatology 2008, 47, 908–918. [Google Scholar] [CrossRef] [PubMed]
- Morris, M.R.; Ricketts, C.; Gentle, D.; Abdulrahman, M.; Clarke, N.; Brown, M.; Kishida, T.; Yao, M.; Latif, F.; Maher, E.R. Identification of candidate tumour suppressor genes frequently methylated in renal cell carcinoma. Oncogene 2010, 29, 2104–2117. [Google Scholar] [CrossRef] [PubMed]
- Sato, N.; Fukushima, N.; Matsubayashi, H.; Iacobuzio-Donahue, C.A.; Yeo, C.J.; Goggins, M. Aberrant methylation of Reprimo correlates with genetic instability and predicts poor prognosis in pancreatic ductal adenocarcinoma. Cancer 2006, 107, 251–257. [Google Scholar] [CrossRef] [PubMed]
- Wang, H.; Zheng, Y.; Lai, J.; Luo, Q.; Ke, H.; Chen, Q. Methylation-Sensitive Melt Curve Analysis of the Reprimo Gene Methylation in Gastric Cancer. PLoS ONE 2016, 1–16. [Google Scholar] [CrossRef] [PubMed]
- Garcia-Bloj, B.; Moses, C.; Sgro, A.; Plani-Lam, J.; Arooj, M.; Duffy, C.; Thiruvengadam, S.; Sorolla, A.; Rashwan, R.; Mancera, R.L.; et al. Waking up dormant tumor suppressor genes with zinc fingers, TALEs and the CRISPR/dCas9 system. Oncotarget 2016, 7, 1–5. [Google Scholar] [CrossRef] [PubMed]
- Buchegger, K.; Ili, C.; Riquelme, I.; Letelier, P.; Corvalán, A.H.; Brebi, P.; Huang, T.H.M.; Roa, J.C. Reprimo as a modulator of cell migration and invasion in the MDA-MB-231 breast cancer cell line. Biol. Res. 2016, 1–10. [Google Scholar] [CrossRef] [PubMed]
- Cancer Genome Atlas Network. Comprehensive molecular portraits of human breast tumours. Nature 2012, 490, 61–70. [Google Scholar] [CrossRef]
- Antequera, F. Structure, function and evolution of CpG island promoters. Cell. Mol. Life Sci. 2003, 60, 1647–1658. [Google Scholar] [CrossRef] [PubMed]
- Clark, S.J. Action at a distance: Epigenetic silencing of large chromosomal regions in carcinogenesis. Hum. Mol. Genet. 2007, 16, R88–R95. [Google Scholar] [CrossRef] [PubMed]
- Irizarry, R.A.; Ladd-Acosta, C.; Wen, B.; Wu, Z.; Montano, C.; Onyango, P.; Cui, H.; Gabo, K.; Rongione, M.; Webster, M. Genome-wide methylation analysis of human colon cancer reveals similar hypo-and hypermethylation at conserved tissue-specific CpG island shores. Nat. Genet. 2009, 41, 178. [Google Scholar] [CrossRef] [PubMed]
- Shenker, N.; Flanagan, J.M. Intragenic DNA methylation: Implications of this epigenetic mechanism for cancer research. Br. J. Cancer 2012, 106, 248–253. [Google Scholar] [CrossRef] [PubMed]
- Kulis, M.; Queirós, A.C.; Beekman, R.; Martín-Subero, J.I. Intragenic DNA methylation in transcriptional regulation, normal differentiation and cancer. Biochim. Biophys. Acta Gene Regul. Mech. 2013, 1829, 1161–1174. [Google Scholar] [CrossRef] [PubMed]
- Mourad, R.; Hsu, P.-Y.; Juan, L.; Shen, C.; Koneru, P.; Lin, H.; Liu, Y.; Nephew, K.; Huang, T.H.; Li, L. Estrogen induces global reorganization of chromatin structure in human breast cancer cells. PLoS ONE 2014, 9, e113354. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Wang, J.; Lan, X.; Hsu, P.-Y.; Hsu, H.-K.; Huang, K.; Parvin, J.; Huang, T.H.-M.; Jin, V.X. Genome-wide analysis uncovers high frequency, strong differential chromosomal interactions and their associated epigenetic patterns in E2-mediated gene regulation. BMC Genom. 2013, 14, 70. [Google Scholar] [CrossRef] [PubMed]
- Gu, F.; Hsu, H.-K.; Hsu, P.-Y.; Wu, J.; Ma, Y.; Parvin, J.; Huang, T.H.-M.; Jin, V.X. Inference of hierarchical regulatory network of estrogen-dependent breast cancer through ChIP-based data. BMC Syst. Biol. 2010, 4, 170. [Google Scholar] [CrossRef] [PubMed]
- Welboren, W.-J.; van Driel, M.A.; Janssen-Megens, E.M.; van Heeringen, S.J.; Sweep, F.C.; Span, P.N.; Stunnenberg, H.G. ChIP-Seq of ERα and RNA polymerase II defines genes differentially responding to ligands. EMBO J. 2009, 28, 1418–1428. [Google Scholar] [CrossRef] [PubMed]
- Moon, H.-S.; Park, W.I.; Choi, E.-A.; Chung, H.-W.; Kim, S.-C. The expression and tyrosine phosphorylation of E-cadherin/catenin adhesion complex, and focal adhesion kinase in invasive cervical carcinomas. Int. J. Gynecol. Cancer 2003, 13, 640–646. [Google Scholar] [CrossRef] [PubMed]
Clinicopathological Features | n | Methylation of RPRM CGIs | p | |
---|---|---|---|---|
Low | High | |||
Age (year; mean 60) | 77 | 0.021 | ||
≤60 | 43 | 23 (71.9%) | 20 (44.4%) | |
>60 | 34 | 9 (28.1%) | 25 (55.6%) | |
Tumor Size * | 76 | 0.586 | ||
T1 + T2 | 58 | 23 (39.7%) | 35 (60.3%) | |
T3 + T4 | 18 | 9 (50.0%) | 9 (50.0%) | |
Lymph node metástasis * | 76 | 0.247 | ||
No | 35 | 12 (34.3%) | 23 (65.7%) | |
Yes | 41 | 20 (48.4%) | 21 (51.2%) | |
TNM Stage * | 76 | 0.621 | ||
I + II | 51 | 20 (39.2%) | 31 (60.8%) | |
III + IV | 25 | 12 (48.0%) | 13 (52.0%) | |
Elston Grade * | 75 | 0.239 | ||
Well differentiated | 14 | 5 (35.7%) | 9 (64.3%) | |
Moderately differentiated | 34 | 12 (35.3%) | 22 (64.7%) | |
Poorly differentiated | 27 | 15 (55.6%) | 12 (44.4%) | |
Estrogen receptor α * | 74 | 0.000 | ||
ERα-negative | 24 | 18 (75.0%) | 6 (25.0%) | |
ERα-positive | 50 | 14 (28.0%) | 36 (72.0%) | |
Progesterone receptor * | 74 | 0.034 | ||
PR-negative | 35 | 20 (57.1%) | 15 (42.9%) | |
PR-positive | 39 | 12 (30.8%) | 27 (69.2%) | |
Her2/neu * | 65 | 1.000 | ||
Her2-negative | 62 | 29 (46.8%) | 33 (53.2%) | |
Her2-positive | 3 | 2 (66.7%) | 1 (33.3%) | |
Ki67 * | 63 | 0.062 | ||
Low | 50 | 19 (38.0%) | 31 (62.0%) | |
High | 13 | 9 (69.2%) | 4 (30.8%) | |
Molecular Subtype * | 67 | 0.001 | ||
Luminal A | 30 | 6 (20.0%) | 24 (80.0%) | |
Luminal B | 15 | 7 (46.7%) | 8 (53.3%) | |
Her2-positive | 3 | 2 (66.7%) | 1 (33.3%) | |
TNBC | 19 | 14 (77.8%) | 4 (22.2%) |
ID | Sequences (5′-3′) | PCR Product (pb) | Ref. |
---|---|---|---|
RPRM-M (forward) | GCGAGTGAGCGTTTAGTTC | 120 | Sato et al. [13] |
RPRM-M (reverse) | TACCTAAAACCGAATTCATCG | 120 | Sato et al. [13] |
B-actin-M (forward) | TGGTGATGGAGGAGGTTTAGTAAGT | 133 | Moon et al. [51] |
B-actin-M (reverse) | AACCAATAAAACCTACTCCTCCCTTAA | 133 | Moon et al. [51] |
RPRM (probe qMSP) | /56-FAM/TT CGC GTC G/ZEN/T TCG CGG CGT TCG TT/3IABkFQ/ | 120 | - |
β-actin (probe qMSP) | /56-FAM/AC CAC CAC C/ZEN/C AAC ACA CAA TAA CAA ACA CA/3IABkFQ/ | 133 | Moon et al. [51] |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Buchegger, K.; Riquelme, I.; Viscarra, T.; Ili, C.; Brebi, P.; Huang, T.H.-M.; Roa, J.C. Reprimo, a Potential p53-Dependent Tumor Suppressor Gene, Is Frequently Hypermethylated in Estrogen Receptor α-Positive Breast Cancer. Int. J. Mol. Sci. 2017, 18, 1525. https://doi.org/10.3390/ijms18081525
Buchegger K, Riquelme I, Viscarra T, Ili C, Brebi P, Huang TH-M, Roa JC. Reprimo, a Potential p53-Dependent Tumor Suppressor Gene, Is Frequently Hypermethylated in Estrogen Receptor α-Positive Breast Cancer. International Journal of Molecular Sciences. 2017; 18(8):1525. https://doi.org/10.3390/ijms18081525
Chicago/Turabian StyleBuchegger, Kurt, Ismael Riquelme, Tamara Viscarra, Carmen Ili, Priscilla Brebi, Tim Hui-Ming Huang, and Juan Carlos Roa. 2017. "Reprimo, a Potential p53-Dependent Tumor Suppressor Gene, Is Frequently Hypermethylated in Estrogen Receptor α-Positive Breast Cancer" International Journal of Molecular Sciences 18, no. 8: 1525. https://doi.org/10.3390/ijms18081525