Toll-Like Receptor-4 Inhibitor TAK-242 Attenuates Motor Dysfunction and Spinal Cord Pathology in an Amyotrophic Lateral Sclerosis Mouse Model
Abstract
:1. Introduction
2. Results
2.1. TAK-242 Attenuated Splenocytes Proliferation in hSOD1G93A Mice
2.2. TAK-242 Treatment Transiently Delayed Clinical Disease Progression in hSOD1G93A Mice
2.3. TAK-242 Treatment Decreased Serum IL1-β Levels in hSOD1G93A Mice
2.4. TAK-242 Treatment Attenuated Motor Neuron Loss in the Spinal Cords of hSOD1G93A Mice
2.5. TAK-242 Treatment Attenuated Spinal Cord Astrogliosis and Microglia Activation in hSOD1G93A Mice
2.6. TAK-242 Treatment Attenuated TNF-α but Not IL1-β Expression in the Spinal Cords of hSOD1G93A Mice
3. Discussion
4. Materials and Methods
4.1. Transgenic hSOD1G93A Mice
4.2. Treatment Protocol
4.3. Behavioral Motor Evaluations
4.3.1. Ladder Test
4.3.2. Neurological Gait Assessment
4.3.3. Hindlimb Reflex Measurement
4.4. Plasma IL1-β Measurement
4.5. Histological Analysis
4.6. IL1-β and TNF-α mRNA Measurements in the Spinal Cord
4.7. Splenocytes Viability and Proliferation Assay
4.8. Statistical Analysis
5. Conclusions
Author Contributions
Conflicts of Interest
Abbreviations
ALS | Amyotrophic lateral sclerosis |
ChAT | Choline Acetyltransferase |
CNS | Central nervous system |
DAMP | Danger-associated molecular pattern |
GFAP | Glial fibrillary acidic protein |
HMGB1 | High-mobility group box-1 |
IBA1 | Ionized calcium-binding adapter molecule 1 |
LPS | Lipopolysaccharide |
NF-κB | Nuclear factor kappa-B |
NMJ | Neuromuscular junction |
PAMP | Pathogen-associated molecular pattern |
RT-PCR | Real-time polymerase chain reaction |
SEM | Standard error of the mean |
SOD1 | Superoxidedismutase-1 |
TIR | Toll-interleukin 1 receptor |
TLR | Toll-like receptor |
WT | Wild-type |
References
- Degenerative diseases of the nervous system. In Adams and Victor’s Principles of Neurology, 10th ed.; Ropper, A.H.; Samuels, M.A.; Klein, J.P. (Eds.) McGraw-Hill: New York, NY, USA, 2014; pp. 1109–1116. [Google Scholar]
- Lee, J.Y.; Lee, J.D.; Phipps, S.; Noakes, P.G.; Woodruff, T.M. Absence of toll-like receptor 4 (TLR4) extends survival in the hSOD1G93A mouse model for amyotrophic lateral sclerosis. J. Neuroinflamm. 2015. [Google Scholar] [CrossRef] [PubMed]
- Kiernan, M.C.; Vucic, S.; Cheah, B.C.; Turner, M.R.; Eisen, A.; Hardiman, O.; Zoing, M.C. Amyotrophic lateral sclerosis. Lancet 2013, 377, 942–955. [Google Scholar] [CrossRef]
- Arjoud-Driss, S.; Siddique, T. Sporadic and hereditary amyotrophic lateral sclerosis (ALS). Biochim. Biophys. Acta 2015, 1852, 679–684. [Google Scholar] [CrossRef] [PubMed]
- Gonzales, H.; Elgueta, D.; Montoya, A.; Pachero, R. Neuroimmune regulation of microglial activity involved in neuroinflammation and neurodegenerative diseases. J. Neuroimmunol. 2014, 274, 1–13. [Google Scholar] [CrossRef] [PubMed]
- Heneka, M.T.; Kummer, M.P.; Latz, E. Innate immune activation in neurodegenerative disease. Nat. Rev. Immunol. 2014, 14, 463–477. [Google Scholar] [CrossRef] [PubMed]
- Trotta, T.; Porro, C.; Calvello, R.; Panaro, M.A. Biological role of toll-like receptor-4 in the brain. J. Neuroimmunol. 2014, 268, 1–12. [Google Scholar] [CrossRef] [PubMed]
- Sasi, M.; Yamamoto, M. Pathogen recognition receptors: Ligands and signaling pathways by toll-like receptors. Int. Rev. Immun. 2013, 32, 116–133. [Google Scholar] [CrossRef]
- Hanke, M.L.; Kielian, T. Toll-like receptors in health and disease in the brain: Mechanisms and therapeutic potential. Clin. Sci. 2011, 121, 367–387. [Google Scholar] [CrossRef] [PubMed]
- Walter, S.; Letiembre, M.; Liu, Y.; Heine, H.; Penke, B.; Hao, W.; Bode, B.; Manietta, N.; Walter, J.; Schulz-Schuffer, W.; et al. Role of the toll-like receptor 4 in neuroinflammation in Alzheimer’s disease. Cell. Physiol. Biochem. 2007, 20, 947–956. [Google Scholar] [CrossRef] [PubMed]
- Tahara, K.; Kim, H.D.; Jin, J.J.; Maxwell, J.A.; Fukuchi, K. Role of toll-like receptor signaling in Aβ uptake and clearance. Brain 2006, 129, 3006–3019. [Google Scholar] [CrossRef]
- Malaspina, A.; Puentes, F.; Amore, S. Disease origin and progression in amyotrophic lateral sclerosis: An immunology perspective. Int. Immunol. 2015, 27, 117–129. [Google Scholar] [CrossRef] [PubMed]
- De Paola, M.; Mariani, A.; Bigini, P.; Peviani, M.; Ferrara, G.; Molteni, M.; Gemma, S.; Veglianese, P.; Castellaneta, V.; Boldrin, V.; et al. Neuroprotective effects of toll-like receptor 4 antagonism in spinal cord cultures and in a mouse model of motor neuron degeneration. Mol. Med. 2012, 18, 971–981. [Google Scholar] [PubMed]
- De Paola, M.; Sestito, S.E.; Mariani, A.; Memo, C.; Fanelli, R.; Freschi, M.; Bendotti, C.; Calabrese, V.; Peri, F. Synthetic and natural small molecule TLR4 antagonists inhibit motoneuron death in cultures from ALS mouse model. Pharmacol. Res. 2016, 103, 180–187. [Google Scholar] [CrossRef] [PubMed]
- Matsunaga, N.; Tsuchimori, N.; Matsumoto, T.; Li, M. TAK-242 (Resatorvid), a small-molecule Inhibitor of toll-like receptor (TLR) 4 signaling, binds selectively to TLR4 and interferes with interactions between TLR4 and its adaptor molecules. Mol. Pharmacol. 2011, 79, 34–41. [Google Scholar] [CrossRef] [PubMed]
- Hua, F.; Tang, H.; Wang, J.; Prunty, M.C.; Hua, X.; Sayeed, I.; Stein, D.G. TAK-242, an antagonist for toll-like receptor 4, protects against acute cerebral ischemia/reperfusion injury in mice. J. Cereb. Blood Flow Metable. 2015, 35, 536–542. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.C.; Wang, P.F.; Fang, H.; Chen, J.; Xiong, X.Y.; Yang, Q.W. Toll-like receptor 4 antagonist attenuates hemorrhage-induced brain injury. Stroke 2013, 44, 2545–2552. [Google Scholar] [CrossRef] [PubMed]
- Gurney, M.E.; Pu, H.; Chiu, A.Y.; Dal Canto, M.C.; Polchow, C.Y.; Alexander, D.D.; Caliendo, J.; Hentati, A.; Kwon, Y.W.; Deng, H.X.; et al. Motor neuron degeneration in mice that express a human Cu, Zn superoxide dismutase mutation. Science 1994, 264, 1772–1775. [Google Scholar] [CrossRef] [PubMed]
- Hall, E.D.; Oostveen, J.A.; Gurney, M.E. Relationship of microglial and astrocytic activation to disease onset and progression in transgenic model of familial ALS. Glia 1998, 23, 249–256. [Google Scholar] [CrossRef]
- Philips, T.; Robberecht, W. Neuroinflammation in amyotrophic lateral sclerosis: Role of glial activation in motor neuron disease. Lancet Neurol. 2011, 10, 253–263. [Google Scholar] [CrossRef]
- Alshikho, M.J.; Zurcher, N.R.; Loggia, M.L.; Cernasov, P.; Chonde, D.B.; Izquierdo Garcia, D.; Yasek, J.E.; Akeju, O.; Catana, C.; Rosen, B.R.; et al. Glial activation colocalizes with structural abnormalities in amyotrophic lateral sclerosis. Neurology 2016, 87, 2554–2561. [Google Scholar] [CrossRef] [PubMed]
- Kawamata, T.; Akiyama, H.; Yamada, T.; McGeer, P.L. Immunologic reactions in amyotrophic lateral sclerosis brain and spinal cord tissue. Am. J. Pathol. 1992, 140, 691–707. [Google Scholar] [PubMed]
- Frakes, A.E.; Ferraiuolo, L.; Haidet-Phillips, A.M.; Schmelzer, L.; Braun, L.; Miranda, C.J.; Ladner, K.J.; Bevan, A.K.; Foust, K.D.; Godbout, J.P.; et al. Microglia induce motor neuron death via the classical NF-kB pathway in amyotrophic lateral sclerosis. Neuron 2014, 81, 1009–1023. [Google Scholar] [CrossRef] [PubMed]
- Zhao, W.; Beers, D.R.; Henkel, J.S.; Zhang, W.; Urushitani, M.; Julien, J.P.; Appel, S.H. Extracellular mutant SOD1 induces microglial-mediated motoneuron injury. Glia 2010, 58, 231–243. [Google Scholar] [CrossRef] [PubMed]
- Brettschneider, J.; Toledo, J.B.; Van Deerlin, V.M.; Elman, L.; McCluskey, L.; Lee, V.M.Y.; Trojanowski, J.Q. Microglial activation correlates with disease progression and upper motor neuron clinical symptoms in amyotrophic lateral sclerosis. PLoS ONE 2012, 7, e39216. [Google Scholar] [CrossRef] [PubMed]
- Radford, R.A.; Morsch, M.; Rayner, S.L.; Cole, N.J.; Pountney, D.L.; Chung, R.S. The established and emerging roles of astrocytes and microglia in amyotrophic lateral sclerosis and frontotemporal dementia. Front. Cell. Neurosci. 2015, 9, 414. [Google Scholar] [CrossRef] [PubMed]
- Haidet-Phillips, A.M.; Hester, M.E.; Miranda, C.J.; Meyer, K.; Braun, L.; Frakes, A.; Song, S.; Likhite, S.; Murtha, M.J.; Foust, K.D.; et al. Astrocytes from familial and sporadic ALS patients are toxic to motor neurons. Nat. Biotechnol. 2011, 29, 824–828. [Google Scholar] [CrossRef] [PubMed]
- Re, D.B.; Le Verche, V.; Yu, C.; Amoroso, M.W.; Politi, K.A.; Phani, S.; Ikiz, B.; Hoffmann, L.; Koolen, M.; Nagata, T.; et al. Necroptosis drives motor neuron death in models of both sporadic and familial ALS. Neuron 2014, 81, 1001–1008. [Google Scholar] [CrossRef] [PubMed]
- Meyer, K.; Ferraiuolo, L.; Miranda, C.J.; Likhite, S.; McElroy, S.; Renusch, S.; Ditsworth, D.; Lagier-Tourenne, C.; Smith, R.A.; Ravits, J.; et al. Direct conversion of patient fibroblasts demonstrates non-cell autonomous toxicity of astrocytes to motor neurons in familial and sporadic ALS. Proc. Natl. Acad. Sci. USA 2014, 111, 829–832. [Google Scholar] [CrossRef] [PubMed]
- Casula, M.; Iyer, A.M.; Spliet, W.G.M.; Anink, J.J.; Steentjes, K.; Sta, M.; Troost, D.; Aronica, E. Toll-like receptor signaling in amyotrophic lateral sclerosis spinal cord tissue. Neuroscience 2011, 179, 233–243. [Google Scholar] [CrossRef] [PubMed]
- Rice, T.W.; Wheeler, A.P.; Bernard, G.R.; Vincent, J.L.; Angus, D.C.; Aikawa, N.; Demeyer, I.; Sainati, S.; Amlot, N.; Cao, C.; et al. A randomized, double-blind, placebo-controlled trial of TAK-242 for the treatment of severe sepsis. Crit. Care Med. 2010, 38, 1685–1694. [Google Scholar] [CrossRef] [PubMed]
- Hensley, K.; Floyd, R.A.; Gordon, B.; Mou, S.; Pye, Q.N.; Stewart, C.; West, M.; Williamson, K. Temporal patterns of cytokine and apoptosis-related gene expression in spinal cords of the G93A-SOD1 mouse model of amyotrophic lateral sclerosis. J. Neurochem. 2002, 82, 365–374. [Google Scholar] [CrossRef] [PubMed]
- Yoshihara, T.; Ishigaki, S.; Yamamoto, M.; Liang, Y.; Niwa, J.; Takeuchi, H.; Doyu, M.; Sobue, G. Differential expression of inflammation- and apoptosis-related gene in spinal cords of a mutant SOD1 transgenic mouse model of familial amyotrophic lateral sclerosis. J. Neurochem. 2002, 80, 158–167. [Google Scholar] [CrossRef] [PubMed]
- Nguyen, M.D.; Julien, J.P.; Rivest, S. Induction of proinflammatory molecules in mice with amyotrophic lateral sclerosis: No requirement for proapoptotic interleukin-1beta in neurodeneration. Ann. Neurol. 2001, 50, 630–639. [Google Scholar] [CrossRef] [PubMed]
- Butovski, O.; Siddiqui, S.; Gabrieli, G.; Lanser, A.J.; Dake, B.; Murugaiyan, G.; Doykan, C.E.; Wu, P.M.; Gali, R.R.; Iyer, L.K.; et al. Modulating inflammatory monocytes with a unique microRNA gene expression ameliorates murine ALS. J. Clin. Investig. 2012, 122, 3063–3087. [Google Scholar] [CrossRef] [PubMed]
- Dadon-Nachum, M.; Melamed, E.; Offen, D. The “dying-back” phenomenon of motor neurons in ALS. J. Mol. Neurosci. 2011, 43, 470–477. [Google Scholar] [CrossRef] [PubMed]
- Benkler, C.; Barhum, Y.; Ben-Zur, T.; Offen, D. Multifactorial gene therapy enhancing the glutamate uptake system and reducing oxidative stress delays symptom onset and prolongs survival in the SOD1-G93A ALS mouse model. J. Mol. Neurosci. 2016, 58, 46–58. [Google Scholar] [CrossRef] [PubMed]
- Knippenberg, S.; Thau, N.; Dengler, R.; Petri, S. Significance of behavioral tests in transgenic mouse model of amyotrophic lateral sclerosis (ALS). Behav. Brain Res. 2010, 213, 82–87. [Google Scholar] [CrossRef] [PubMed]
- Seo, J.S.; Baek, I.S.; Leem, Y.H.; Kim, T.K.; Cho, Y.; Lee, S.M.; Park, Y.H.; Han, P.L. SK-PC-B70M alleviates neurologic symptoms in G93A-SOD1 amyotrophic lateral sclerosis mice. Brain Res. 2011, 1368, 299–307. [Google Scholar] [CrossRef] [PubMed]
- Lev, N.; Barhum, Y.; Pilosof, N.S.; Ickowicz, D.; Cohen, H.Y.; Melamed, E.; Offen, D. DJ-1 protects against dopamine toxicity: Implications for Parkinson’s disease and aging. J. Gerontol. A Biol. Sci. Med. Sci. 2013, 68, 215–225. [Google Scholar] [CrossRef] [PubMed]
- li, M.; Matsunaga, N.; Hazeki, K.; Nakamura, K.; Takashima, K.; Seya, T.; Hazeki, O.; Kitazaki, T.; Iizawa, Y. A novel cyclohexene derivative, ethyl (6R)-6-[N-(2-chloro-4-fluorophenyl)sulfamoyl]cyclohex-1-ene-1-carboxylate (TAK-242), selectively inhibits toll-like receptor 4-mediated cytokine production through suppression of intracellular signaling. Mol. Pharmacol. 2006, 69, 1288–1295. [Google Scholar]
Gene | Forward Primer | Reverse Primer |
---|---|---|
hSOD1G93A | CATCAGCCCTAATCCATCTGA | CGCGACTAACAATCAAAGTGA |
IL2 | CTAGGCCACAGAATTGAAAGATCT | GTAGGTGGAAATTCTAGCATCATCC |
Score | Behavioral Manifestation |
---|---|
12 | Pre-symptomatic, no visible difficulties climbing the ladder. |
11 | Early stage tremors, climbing speed not effected. |
10 | Increased tremors, difficulty in closing hind leg fingers around the stages of the ladder. |
9 | One of the hind legs begins to occasionally miss the stages of the ladder, climbing speed not affected. |
8 | Both of the hind legs begin to occasionally miss the stages of the ladder, climbing speed not affected. |
7 | One of the hind legs occasionally misses the stages of the ladder, climbing speed affected. |
6 | Both of the hind legs occasionally miss the stages of the ladder, climbing speed affected. |
5 | Climbing speed clearly affected, medium to slow speed, hind legs show symptoms. |
4 | Slow climbing speed, symptoms clearly visible in hind legs but not in front legs. |
3 | Slow climbing speed, symptoms visible in hind legs as well as in front legs. |
2 | The mouse climbs up the ladder very slowly and misses the stages of the ladder with all legs. |
1 | The mouse barely climbs up the ladder. |
0 | The mouse does not move once placed on the ladder. |
Gene | Forward Primer | Reverse Primer |
---|---|---|
IL1-β | CCACCTCAATGGACAGAATATCA | CCCAAGGCCACAGGTATTT |
TNF-α | GTCTCAGAATGAGGCTGGATAAG | CATTGCACCTCAGGGAAGAA |
GAPDH | CGACAGTCAGCCGCATCTT | CCAATACGACCAAATCCGTTG |
© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Fellner, A.; Barhum, Y.; Angel, A.; Perets, N.; Steiner, I.; Offen, D.; Lev, N. Toll-Like Receptor-4 Inhibitor TAK-242 Attenuates Motor Dysfunction and Spinal Cord Pathology in an Amyotrophic Lateral Sclerosis Mouse Model. Int. J. Mol. Sci. 2017, 18, 1666. https://doi.org/10.3390/ijms18081666
Fellner A, Barhum Y, Angel A, Perets N, Steiner I, Offen D, Lev N. Toll-Like Receptor-4 Inhibitor TAK-242 Attenuates Motor Dysfunction and Spinal Cord Pathology in an Amyotrophic Lateral Sclerosis Mouse Model. International Journal of Molecular Sciences. 2017; 18(8):1666. https://doi.org/10.3390/ijms18081666
Chicago/Turabian StyleFellner, Avi, Yael Barhum, Ariel Angel, Nisim Perets, Israel Steiner, Daniel Offen, and Nirit Lev. 2017. "Toll-Like Receptor-4 Inhibitor TAK-242 Attenuates Motor Dysfunction and Spinal Cord Pathology in an Amyotrophic Lateral Sclerosis Mouse Model" International Journal of Molecular Sciences 18, no. 8: 1666. https://doi.org/10.3390/ijms18081666