Effects of Exogenous Melatonin on Methyl Viologen-Mediated Oxidative Stress in Apple Leaf
Abstract
:1. Introduction
2. Results
2.1. The Effect of Melatonin on Phenotypes of Apple Leaves under MV Stress
2.2. The Effect of Melatonin on Physiological State of Apple Leaves under MV Stress
2.3. The Effect of Melatonin on the Activity of Antioxidant Enzymes in Apple Leaves under MV Stress
2.4. The Effect of Melatonin on the Expression of Related Genes in Apple Leaves under MV Stress
3. Discussion
4. Materials and Methods
4.1. Plant Material and Treatments
4.2. Calculations of Fv/Fm, Chlorophyll Levels, and Electrolyte Leakage
4.3. Measurements of H2O2 and MDA
4.4. Extraction and Assays of Antioxidant Enzymes
4.5. RNA Isolation and Quantitative Real-Time RT-PCR
4.6. Statistical Analysis
5. Conclusions
Acknowledgments
Author Contributions
Conflicts of Interest
References
- Toenniessen, G.H.; O’Toole, J.C.; Devries, J. Advances in plant biotechnology and its adoption in developing countries. Curr. Opin. Plant Biol. 2003, 6, 191–198. [Google Scholar] [CrossRef]
- Correa-Aragunde, N.; Foresi, N.; Delledonne, M.; Lamattina, L. Auxin induces redox regulation of ascorbate peroxidase 1 activity by S-nitrosylation/denitrosylation balance resulting in changes of root growth pattern in Arabidopsis. J. Exp. Bot. 2013, 64, 3339–3349. [Google Scholar] [CrossRef] [PubMed]
- Setif, P. Electron-transfer kinetics in cyanobacterial cells: Methyl viologen is a poor inhibitor of linear electron flow. Biochim. Biophys. Acta 2015, 1847, 212–222. [Google Scholar] [CrossRef] [PubMed]
- Moustakas, M.; Malea, P.; Zafeirakoglou, A.; Sperdouli, I. Photochemical changes and oxidative damage in the aquatic macrophyte Cymodocea nodosa exposed to paraquat-induced oxidative stress. Pestic. Biochem. Phys. 2016, 126, 28–34. [Google Scholar] [CrossRef] [PubMed]
- Varadi, G.; Darko, E.; Lehoczki, E. Changes in the xanthophyll cycle and fluorescence quenching indicate light-dependent early events in the action of paraquat and the mechanism of resistance to paraquat in Erigeron canadensis (L.) Cronq. Plant Physiol. 2000, 123, 1459–1469. [Google Scholar] [CrossRef] [PubMed]
- Verma, K.; Mehta, S.K.; Shekhawat, G.S. Nitric oxide (NO) counteracts cadmium induced cytotoxic processes mediated by reactive oxygen species (ROS) in Brassica juncea: Cross-talk between ROS, NO and antioxidant responses. Biometals 2013, 26, 255–269. [Google Scholar] [CrossRef] [PubMed]
- Beligni, M.V.; Lamattina, L. Nitric oxide protects against cellular damage produced by methylviologen herbicides in potato plants. Nitric Oxide 1999, 3, 199–208. [Google Scholar] [CrossRef] [PubMed]
- Gong, X.Q.; Shi, S.T.; Dou, F.F.; Song, Y.; Ma, F.W. Exogenous melatonin alleviates alkaline stress in Malus hupehensis Rehd. by regulating the biosynthesis of polyamines. Molecules 2017, 22, 1542. [Google Scholar] [CrossRef] [PubMed]
- Casano, L.M.; Martin, M.; Zapata, J.M.; Sabater, B. Leaf age- and paraquat concentration-dependent effects on the levels of enzymes protecting against photooxidative stress. Plant Sci. 1999, 149, 13–22. [Google Scholar] [CrossRef]
- Arnao, M.B.; Hernandez-Ruiz, J. Functions of melatonin in plants: A review. J. Pineal Res. 2015, 59, 133–150. [Google Scholar] [CrossRef] [PubMed]
- Posmyk, M.M.; Janas, K.M. Melatonin in plants. Acta Physiol. Plant. 2009, 31, 1–11. [Google Scholar] [CrossRef]
- Dubbels, R.; Reiter, R.J.; Klenke, E.; Goebel, A.; Schnakenberg, E.; Ehlers, C.; Schiwara, H.W.; Schloot, W. Melatonin in edible plants identified by radioimmunoassay and by high-performance liquid chromatography-mass spectrometry. J. Pineal Res. 1995, 18, 28–31. [Google Scholar] [CrossRef] [PubMed]
- Hattori, A.; Migitaka, H.; Iigo, M.; Itoh, M.; Yamamoto, K.; Ohtanikaneko, R.; Hara, M.; Suzuki, T.; Reiter, R.J. Identification of melatonin in plants and its effects on plasma melatonin levels and binding to melatonin receptors in vertebrates. Biochem. Mol. Biol. Int. 1995, 35, 627–634. [Google Scholar] [PubMed]
- Szafranska, K.; Glinska, S.; Janas, K.M. Ameliorative effect of melatonin on meristematic cells of chilled and re-warmed Vigna radiata roots. Biol. Plant. 2013, 57, 91–96. [Google Scholar] [CrossRef]
- Posmyk, M.M.; Kuran, H.; Marciniak, K.; Janas, K.M. Presowing seed treatment with melatonin protects red cabbage seedlings against toxic copper ion concentrations. J. Pineal Res. 2008, 45, 24–31. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Wang, P.; Wei, Z.W.; Liang, D.; Liu, C.H.; Yin, L.H.; Jia, D.F.; Fu, M.Y.; Ma, F.W. The mitigation effects of exogenous melatonin on salinity-induced stress in Malus hupehensis. J. Pineal Res. 2012, 53, 298–306. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Sun, X.; Li, C.; Wei, Z.; Liang, D.; Ma, F. Long-term exogenous application of melatonin delays drought-induced leaf senescence in apple. J. Pineal Res. 2013, 54, 292–302. [Google Scholar] [CrossRef] [PubMed]
- Yin, L.; Wang, P.; Li, M.; Ke, X.; Li, C.; Liang, D.; Wu, S.; Ma, X.; Li, C.; Zou, Y.; et al. Exogenous melatonin improves Malus resistance to Marssonina apple blotch. J. Pineal Res. 2013, 54, 426–434. [Google Scholar] [CrossRef] [PubMed]
- Tan, D.X.; Zheng, X.; Kong, J.; Manchester, L.C.; Hardeland, R.; Kim, S.J.; Xu, X.; Reiter, R.J. Fundamental issues related to the origin of melatonin and melatonin isomers during evolution: Relation to their biological functions. Int. J. Mol. Sci. 2014, 15, 15858–15890. [Google Scholar] [CrossRef] [PubMed]
- Kang, K.; Kong, K.; Park, S.; Natsagdorj, U.; Kim, Y.S.; Back, K. Molecular cloning of a plant N-acetylserotonin methyltransferase and its expression characteristics in rice. J. Pineal Res. 2011, 50, 304–309. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Kang, K.; Lee, K.; Back, K. Characterization of rice tryptophan decarboxylases and their direct involvement in serotonin biosynthesis in transgenic rice. Planta 2007, 227, 263–272. [Google Scholar] [CrossRef] [PubMed]
- Kang, S.; Kang, K.; Lee, K.; Back, K. Characterization of tryptamine 5-hydroxylase and serotonin synthesis in rice plants. Plant Cell Rep. 2007, 26, 2009–2015. [Google Scholar] [CrossRef] [PubMed]
- Okazaki, M.; Higuchi, K.; Hanawa, Y.; Shiraiwa, Y.; Ezura, H. Cloning and characterization of a Chlamydomonas reinhardtii cDNA arylalkylamine N-acetyltransferase and its use in the genetic engineering of melatonin content in the Micro-Tom tomato. J. Pineal Res. 2009, 46, 373–382. [Google Scholar] [CrossRef] [PubMed]
- Park, S.; Lee, K.; Kim, Y.S.; Back, K. Tryptamine 5-hydroxylase-deficient Sekiguchi rice induces synthesis of 5-hydroxytryptophan and N-acetyltryptamine but decreases melatonin biosynthesis during senescence process of detached leaves. J. Pineal Res. 2012, 52, 211–216. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Sun, X.; Wang, N.; Tan, D.X.; Ma, F. Melatonin enhances the occurrence of autophagy induced by oxidative stress in Arabidopsis seedlings. J. Pineal Res. 2015, 58, 479–489. [Google Scholar] [CrossRef] [PubMed]
- Li, H.; He, J.; Yang, X.; Li, X.; Luo, D.; Wei, C.; Ma, J.; Zhang, Y.; Yang, J.; Zhang, X. Glutathione-dependent induction of local and systemic defense against oxidative stress by exogenous melatonin in cucumber (Cucumis sativus L.). J. Pineal Res. 2016, 60, 206–216. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Yin, L.; Liang, D.; Li, C.; Ma, F.; Yue, Z. Delayed senescence of apple leaves by exogenous melatonin treatment: Toward regulating the ascorbate-glutathione cycle. J. Pineal Res. 2012, 53, 11–20. [Google Scholar] [CrossRef] [PubMed]
- Baxter, A.; Mittler, R.; Suzuki, N. ROS as key players in plant stress signalling. J. Exp. Bot. 2014, 65, 1229–1240. [Google Scholar] [CrossRef] [PubMed]
- Li, C.; Tan, D.X.; Liang, D.; Chang, C.; Jia, D.; Ma, F. Melatonin mediates the regulation of ABA metabolism, free-radical scavenging, and stomatal behaviour in two Malus species under drought stress. J. Exp. Bot. 2015, 66, 669–680. [Google Scholar] [CrossRef] [PubMed]
- Liu, N.; Gong, B.; Jin, Z.; Wang, X.; Wei, M.; Yang, F.; Li, Y.; Shi, Q. Sodic alkaline stress mitigation by exogenous melatonin in tomato needs nitric oxide as a downstream signal. J. Plant Physiol. 2015, 186–187, 68–77. [Google Scholar] [CrossRef] [PubMed]
- Dalal, A.; Kumar, A.; Yadav, D.; Gudla, T.; Viehhauser, A.; Dietz, K.J.; Kirti, P.B. Alleviation of methyl viologen-mediated oxidative stress by Brassica juncea annexin-3 in transgenic Arabidopsis. Plant Sci. 2014, 219–220, 9–18. [Google Scholar] [CrossRef] [PubMed]
- Kusaba, M.; Ito, H.; Morita, R.; Iida, S.; Sato, Y.; Fujimoto, M.; Kawasaki, S.; Tanaka, R.; Hirochika, H.; Nishimura, M.; et al. Rice NON-YELLOW COLORING1 is involved in light-harvesting complex II and grana degradation during leaf senescence. Plant Cell 2007, 19, 1362–1375. [Google Scholar] [CrossRef] [PubMed]
- Tal, O.; Haim, A.; Harel, O.; Gerchman, Y. Melatonin as an antioxidant and its semi-lunar rhythm in green macroalga Ulva sp. J. Exp. Bot. 2011, 62, 1903–1910. [Google Scholar] [CrossRef] [PubMed]
- Weeda, S.; Zhang, N.; Zhao, X.; Ndip, G.; Guo, Y.; Buck, G.A.; Fu, C.; Ren, S. Arabidopsis transcriptome analysis reveals key roles of melatonin in plant defense systems. PLoS ONE 2014, 9, e93462. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Zhou, Z.; Cruz, M.H.; Fuentes-Broto, L.; Galano, A. Phytomelatonin: Assisting plants to survive and thrive. Molecules 2015, 20, 7396–7437. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Shigeoka, S. Understanding oxidative stress and antioxidant functions to enhance photosynthesis. Plant Physiol. 2011, 155, 93–100. [Google Scholar] [CrossRef] [PubMed]
- Reiter, R.J.; Tan, D.X.; Terron, M.P.; Flores, L.J.; Czarnocki, Z. Melatonin and its metabolites: New findings regarding their production and their radical scavenging actions. Acta Biochim. Pol. 2007, 54, 1–9. [Google Scholar] [PubMed]
- Galano, A.; Tan, D.X.; Reiter, R.J. On the free radical scavenging activities of melatonin’s metabolites, AFMK and AMK. J. Pineal Res. 2013, 54, 245–257. [Google Scholar] [CrossRef] [PubMed]
- Lei, Q.; Wang, L.; Tan, D.X.; Zhao, Y.; Zheng, X.D.; Chen, H.; Li, Q.T.; Zuo, B.X.; Kong, J. Identification of genes for melatonin synthetic enzymes in ‘Red Fuji’ apple (Malus domestica Borkh. cv. Red) and their expression and melatonin production during fruit development. J. Pineal Res. 2013, 55, 443–451. [Google Scholar] [PubMed]
- Lichtenthaler, H.K.; Wellburn, A.R. Determination of total carotenoids and chlorophylls a and b of leaf in different solvents. Biochem. Soc. Trans. 1983, 11, 591–592. [Google Scholar] [CrossRef]
- Dionisio-Sese, M.L.; Tobita, S. Antioxidant responses of rice seedlings to salinity stress. Plant Sci. 1998, 135, 1–9. [Google Scholar] [CrossRef]
- Patterson, B.D.; MacRae, E.A.; Ferguson, I.B. Estimation of hydrogen peroxide in plant extracts using titanium(IV). Anal. Biochem. 1984, 139, 487–492. [Google Scholar] [CrossRef]
- Hodges, D.M.; DeLong, J.M.; Forney, C.F.; Prange, R.K. Improving the thiobarbituric acid-reactive-substances assay for estimating lipid peroxidation in plant tissues containing anthocyanin and other interfering compounds. Planta 1999, 207, 604–611. [Google Scholar] [CrossRef]
- Ma, F.W.; Cheng, L.L. The sun-exposed peel of apple fruit has higher xanthophyll cycle-dependent thermal dissipation and antioxidants of the ascorbate-glutathione pathway than the shaded peel. Plant Sci. 2003, 165, 819–827. [Google Scholar] [CrossRef]
- Nakano, Y.; Asada, K. Hydrogen peroxide is scavenged by ascorbate-specific peroxidase in spinach chloroplasts. Plant Cell Physiol. 1981, 22, 867–880. [Google Scholar]
- Rao, M.V.; Paliyath, G.; Ormrod, D.P. Ultraviolet-B- and ozone-induced biochemical changes in antioxidant enzymes of Arabidopsis thaliana. Plant Physiol. 1996, 110, 125–136. [Google Scholar] [CrossRef] [PubMed]
- Giannopolitis, C.N.; Ries, S.K. Superoxide dismutases: I. Occurrence in higher plants. Plant Physiol. 1977, 59, 309–314. [Google Scholar] [CrossRef] [PubMed]
Gene | Primer Sequence (5′–3′) |
---|---|
PAO | F: ACCCGAGTGGTTTGGTACTTGTGA |
R: TACACGAGGAGCATTTGAGGGTGT | |
CAT | F: TGAAACCAAATCCAAAGACCA |
R: TTCCATGTGCCTGTAGTTGAGTG | |
POD | F: CCAACAAATGTGTCCCAAAAATG |
R: CCTGGTCCGAGGTAAATAATCC | |
cAPX | F: AACTACAAGGGATGAAGCC |
R: CAACGAGGATGATAACCAG | |
cGR | F: GTTCAGCGACAAGGCGTAT |
R: TCAACCGATTTCCATTTCC | |
MDAR | F: CCATACTTCTATTCCCGCTCCT |
R: CGACCACCTTCCCGTCTTT | |
DHAR | F: AGTGGACGGTTCCAGCAGA |
R: TTCCCATCCCGCAATCAC | |
MdTDC1 | F: TCACGCTGTGGTTGGAGGT |
R: CTGCATGCTCCTGAACCAAC | |
MdT5H4 | F: TCGGTGACATGTTTGCTGC |
R: GGAAACCTTGGTCTGGCG | |
MdAANAT2 | F: GAATCACCGTCCACGCTCC |
R: GAAATGCTTCCGATGTCCC | |
MdASMT1 | F: AGAGGAGCGAGAAAGACTGGA |
R: CTAAAGAAAAACTTCAATGAGGGAT | |
EF-1α | F: ATTCAAGTATGCCTGGGTGC |
R: CAGTCAGCCTGTGATGTTCC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wei, Z.; Gao, T.; Liang, B.; Zhao, Q.; Ma, F.; Li, C. Effects of Exogenous Melatonin on Methyl Viologen-Mediated Oxidative Stress in Apple Leaf. Int. J. Mol. Sci. 2018, 19, 316. https://doi.org/10.3390/ijms19010316
Wei Z, Gao T, Liang B, Zhao Q, Ma F, Li C. Effects of Exogenous Melatonin on Methyl Viologen-Mediated Oxidative Stress in Apple Leaf. International Journal of Molecular Sciences. 2018; 19(1):316. https://doi.org/10.3390/ijms19010316
Chicago/Turabian StyleWei, Zhiwei, Tengteng Gao, Bowen Liang, Qi Zhao, Fengwang Ma, and Chao Li. 2018. "Effects of Exogenous Melatonin on Methyl Viologen-Mediated Oxidative Stress in Apple Leaf" International Journal of Molecular Sciences 19, no. 1: 316. https://doi.org/10.3390/ijms19010316