The Role of Matrix Gla Protein (MGP) Expression in Paclitaxel and Topotecan Resistant Ovarian Cancer Cell Lines
Abstract
:1. Introduction
2. Results
2.1. Analyses of MGP Gene Expression in Drug-Resistant Ovarian Cancer and Breast Cancer Cell Lines
2.2. Immunofluorescence Analysis of the MGP Protein Expression
2.3. Western Blot Analysis of MGP Protein Expression
2.4. Early Response to PAC and TOP Treatment in Ovarian Cancer Cell Lines
2.5. Immunohistochemistry
3. Discussion
4. Materials and Methods
4.1. Reagents and Antibodies
4.2. Cell Lines and Cell Culture
4.3. Examination of Gene Expression Using QPCR
4.4. Protein Isolation from Cell Culture and Media
4.5. SDS-PAGE and Western Blot Analysis of MGP
4.6. Immunofluorescence Analysis
4.7. Incubation of Cells with PAC and TOP in Time-Course experiment
4.8. Immunohistochemistry
4.9. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
Abbreviations
TOP | Topotecan |
PAC | Paclitaxel |
MGP | Matrix Gla Protein |
ECM | Extracellular Matrix |
CAM | Cell Adhesion Molecule |
TR | Topotecan Resistance |
PR | Paclitaxel Resistance |
References
- Housman, G.; Byler, S.; Heerboth, S.; Lapinska, K.; Longacre, M.; Snyder, N.; Sarkar, S. Drug resistance in cancer: an overview. Cancers (Basel) 2014, 6, 1769–1792. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Leonard, G.D.; Fojo, T.; Bates, S.E. The role of ABC transporters in clinical practice. Oncologist 2003, 8, 411–424. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Sterzyńska, K.; Zaorska, K.; Sosińska, P.; Klejewski, A.; Brązert, M.; Nowicki, M.; Zabel, M. Analysis of MDR genes expression and cross-resistance in eight drug resistant ovarian cancer cell lines. J. Ovarian Res. 2016, 9, 65. [Google Scholar] [CrossRef] [PubMed]
- Sung, S.Y.; Hsieh, C.L.; Wu, D.; Chung, L.W.; Johnstone, P.A. Tumor microenvironment promotes cancer progression, metastasis, and therapeutic resistance. Curr. Probl. Cancer 2007, 31, 36–100. [Google Scholar] [CrossRef] [PubMed]
- Di Paolo, A.; Bocci, G. Drug distribution in tumors: mechanisms, role in drug resistance, and methods for modification. Curr. Oncol. Rep. 2007, 9, 109–114. [Google Scholar] [CrossRef] [PubMed]
- Tannock, I.F.; Lee, C.M.; Tunggal, J.K.; Cowan, D.S.; Egorin, M.J. Limited penetration of anticancer drugs through tumor tissue: a potential cause of resistance of solid tumors to chemotherapy. Clin. Cancer Res. 2002, 8, 878–884. [Google Scholar] [PubMed]
- Netti, P.A.; Berk, D.A.; Swartz, M.A.; Grodzinsky, A.J.; Jain, R.K. Role of extracellular matrix assembly in interstitial transport in solid tumors. Cancer Res. 2000, 60, 2497–2503. [Google Scholar] [PubMed]
- Lu, P.; Weaver, V.M.; Werb, Z. The extracellular matrix: A dynamic niche in cancer progression. J. Cell. Biol. 2012, 196, 395–406. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- St Croix, B.; Kerbel, R.S. Cell adhesion and drug resistance in cancer. Curr. Opin. Oncol. 1997, 9, 549–556. [Google Scholar] [CrossRef] [PubMed]
- Correia, A.L.; Bissell, M.J. The tumor microenvironment is a dominant force in multidrug resistance. Drug Resist. Updates 2012, 15, 39–49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sethi, T.; Rintoul, R.C.; Moore, S.M.; MacKinnon, A.C.; Salter, D.; Choo, C.; Chilvers, E.R.; Dransfield, I.; Donnelly, S.C.; Strieter, R.; et al. Extracellular matrix proteins protect small cell lung cancer cells against apoptosis: a mechanism for small cell lung cancer growth and drug resistance in vivo. Nat. Med. 1999, 5, 662–668. [Google Scholar] [CrossRef] [PubMed]
- Sherman-Baust, C.A.; Weeraratna, A.T.; Rangel, L.B.; Pizer, E.S.; Cho, K.R.; Schwartz, D.R.; Shock, T.; Morin, P.J. Remodeling of the extracellular matrix through overexpression of collagen VI contributes to cisplatin resistance in ovarian cancer cells. Cancer Cell 2003, 3, 377–386. [Google Scholar] [CrossRef]
- Işeri, O.D.; Kars, M.D.; Arpaci, F.; Gündüz, U. Gene expression analysis of drug-resistant MCF-7 cells: implications for relation to extracellular matrix proteins. Cancer Chemother. Pharmacol. 2010, 65, 447–455. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Świerczewska, M.; Sterzyńska, K.; Wojtowicz, K.; Nowicki, M.; Zabel, M. Increased expression of several collagen genes is associated with drug resistance in ovarian cancer cell lines. J. Cancer 2016, 25, 1295–1310. [Google Scholar] [CrossRef] [PubMed]
- Klejewski, A.; Sterzyńska, K.; Wojtowicz, K.; Świerczewska, M.; Partyka, M.; Brązert, M.; Nowicki, M.; Zabel, M.; Januchowski, R. The significance of lumican expression in ovarian cancer drug-resistant cell lines. Oncotarge 2017, 8, 74466–74478. [Google Scholar] [CrossRef] [PubMed]
- Price, P.A.; Williamson, M.K. Primary structure of bovine matrix Gla protein, a new vitamin K-dependent bone protein. J. Biol. Chem. 1985, 260, 14971–14975. [Google Scholar] [PubMed]
- Price, P.A.; Urist, M.R.; Otaeara, Y. Matrix Gla protein, a new g-carboxyglutamic acid-containing protein which is associated with the organic matrix of bone. Biochem. Biophys. Res. Commun. 1983, 117, 765–771. [Google Scholar] [CrossRef]
- Hale, E.; Fraser, J.D.; Price, P.A. The identification of matrix Gla protein in cartilage. J. Biol. Chem. 1988, 263, 5820–5824. [Google Scholar] [PubMed]
- Cancela, L.; Hsieh, C.L.; Francke, U.; Price, P.A. Molecular structure, chromosome assignment, and promoter organization of the human matrix Gla protein gene. J. Biol. Chem. 1990, 265, 15040–15048. [Google Scholar] [PubMed]
- Luo, G.; Ducy, P.; McKee, M.D.; Pinero, G.J.; Loyer, E.; Behringer, R.R.; Karsenty, G. Spontaneous calcification of arteries and cartilage in mice lacking matrix GLA protein. Nature 1997, 386, 78–81. [Google Scholar] [CrossRef] [PubMed]
- Theuwissen, E.; Smit, E.; Vermeer, C. The role of vitamin K in soft-tissue calcification. Adv. Nutr. 2012, 3, 166–173. [Google Scholar] [CrossRef] [PubMed]
- Sharma, B.; Albig, A.R. Matrix Gla protein reinforces angiogenic resolution. Microvasc. Res. 2013, 85, 24–33. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zhao, J.; Warburton, D. Matrix Gla protein gene expression is induced by transforming growth factor-b in embryonic lung culture. Am. J. Physiol. 1997, 273, 282–287. [Google Scholar] [CrossRef] [PubMed]
- Yoshimura, K.; Takeuchi, K.; Nagasaki, K.; Ogishima, S.; Tanaka, H.; Iwase, T.; Akiyama, F.; Kuroda, Y.; Miki, Y. Prognostic value of matrix Gla protein in breast cancer. Mol. Med. Rep. 2009, 2, 549–553. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Levedakou, E.N.; Strohmeyer, T.G.; Effert, P.J.; Liu, E.T. Expression of the matrix Gla protein in urogenital malignancies. Int. J. Cancer 1992, 52, 534–537. [Google Scholar] [CrossRef] [PubMed]
- Mertsch, S.; Schurgers, L.J.; Weber, K.; Paulus, W.; Senner, V. Matrix gla protein (MGP): An overexpressed and migrationpromoting mesenchymal component in glioblastoma. BMC Cancer 2009, 9, 302. [Google Scholar] [CrossRef] [PubMed]
- Nishimoto, S.K.; Nishimoto, M. Matrix Gla Protein Binds to Fibronectin and Enhances Cell Attachment and Spreading on Fibronectin. Int J. Cell. Biol. 2014. [Google Scholar] [CrossRef] [PubMed]
- Zandueta, C.; Ormazábal, C.; Perurena, N.; Martínez-Canarias, S.; Zalacaín, M.; San Julián, M.; Grigoriadis, A.E.; Valencia, K.; Campos-Laborie, F.J.; De Las Rivas, J.; et al. Matrix-Gla protein promotes osteosarcoma lung metastasis and associates with poor prognosis. J. Pathol. 2016, 239, 438–449. [Google Scholar] [CrossRef] [PubMed]
- Hennessy, B.T.; Coleman, R.L.; Markman, M. Ovarian cancer. Lancet 2009, 374, 1371–1382. [Google Scholar] [CrossRef]
- Gordon, A.N.; Tonda, M.; Sun, S.; Rackoff, W. Doxil Study 30-49 Investigators. Long-term survival advantage for women treated with pegylated liposomal doxorubicin compared with topotecan in a phase III randomized study of recurrent and refractory epithelial ovarian cancer. Gynecol. Oncol. 2004, 95, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Jordan, A.; Hadfield, J.A.; Lawrence, N.J.; McGown, A.T. Tubulin as a target for anticancer drugs: Agents which interact with the mitotic spindle. Med. Res. Rev. 1998, 18, 259–296. [Google Scholar] [CrossRef]
- Pommier, Y.; Leo, E.; Zhang, H.; Marchand, C. DNA topoisomerases and their poisoning by anticancer and antibacterial drugs. Chem. Biol. 2010, 17, 421–433. [Google Scholar] [CrossRef] [PubMed]
- Staker, B.L.; Hjerrild, K.; Feese, M.D.; Behnke, C.A.; Burgin, A.B., Jr.; Stewart, L. The mechanism of topoisomerase I poisoning by a camptothecin analog. Proc. Natl. Acad. Sci. USA 2002, 99, 15387–15392. [Google Scholar] [CrossRef] [PubMed]
- Derry, W.B.; Wilson, L.; Khan, I.A.; Luduena, R.F.; Jordan, M.A. Taxol Differentially Modulates the Dynamics of Microtubules Assembled from Unfractionated and Purified Beta-Tubulin Isotypes. Biochemistry 1997, 36, 3554–3562. [Google Scholar] [CrossRef] [PubMed]
- Rubin, EH.; Li, T.; Duan, P.; Liu, L.F. Cellular resistance to topoisomerase poisons. Cancer Treat. Res. 1996. [Google Scholar] [CrossRef]
- Januchowski, R.; Wojtowicz, K.; Andrzejewska, M.; Zabel, M. Expression of MDR1 and MDR3 gene products in paclitaxel-, doxorubicin- and vincristine-resistant cell lines. Biomed. Pharmacother. 2014, 68, 111–117. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Zawierucha, P.; Ruciński, M.; Nowicki, M.; Zabel, M. Extracellular matrix proteins expression profiling in chemoresistant variants of the A2780 ovarian cancer cell line. Biomed. Res. Int. 2014. [Google Scholar] [CrossRef] [PubMed]
- Sheikh, M.S.; Shao, Z.M.; Chen, J.C.; Fontana, J.A. Differential regulation of matrix Gla protein (MGP) gene expression by retinoic acid and estrogen in human breast carcinoma cells. Mol. Cell. Endocrinol. 1993, 92, 153–160. [Google Scholar] [CrossRef]
- Dalton, W.S. The tumor microenvironment as a determinant of drug response and resistance. Drug Resist. Updates 1999, 2, 285–288. [Google Scholar] [CrossRef] [PubMed]
- Januchowski, R.; Sterzyńska, K.; Zawierucha, P.; Ruciński, M.; Świerczewska, M.; Partyka, M.; Bednarek-Rajewska, K.; Brązert, M.; Nowicki, M.; Zabel, M.; et al. Microarray-based detection and expression analysis of new genes associated with drug resistance in ovarian cancer cell lines. Oncotarget 2017, 8, 49944–49958. [Google Scholar] [CrossRef] [PubMed]
- Morin, P.J. Drug resistance and the microenvironment: Nature and nurture. Drug Resist. Updates 2003, 6, 169–172. [Google Scholar] [CrossRef]
- Januchowski, R.; Zawierucha, P.; Ruciński, M.; Zabel, M. Microarray-based detection and expression analysis of extracellular matrix proteins in drug-resistant ovarian cancer cell lines. Oncol. Rep. 2014, 32, 1981–1990. [Google Scholar] [CrossRef] [PubMed]
- Fu, M.H.; Wang, C.Y.; Hsieh, Y.T.; Fang, K.M.; Tzeng, S.F. Functional Role of Matrix gla Protein In Glioma Cell Migration. Mol. Neurobiol. 2018, 55, 4624–4636. [Google Scholar] [CrossRef] [PubMed]
- Chauhan, V.P.; Stylianopoulos, T.; Boucher, Y.; Jain, R.K. Delivery of molecular and nanoscale medicine to tumors: transport barriers and strategies. Annu. Rev. Chem. Biomol. Eng. 2011, 2, 281–298. [Google Scholar] [CrossRef] [PubMed]
- Stylianopoulos, T.; Diop-Frimpong, B.; Munn, L.L.; Jain, R.K. Diffusion anisotropy in collagen gels and tumors: the effect of fiber network orientation. Biophys. J. 2010, 99, 3119–3128. [Google Scholar] [CrossRef] [PubMed]
- Gurler, H.; Yu, Y.; Choi, J.; Kajdacsy-Balla, A.A.; Barbolina, M.V. Three-dimensional collagen type I matrix up-regulates nuclear isoforms of the microtubule associated protein tau implicated in resistance to paclitaxel therapy in ovarian carcinoma. Int. J. Mol. Sci. 2015, 16, 3419–3433. [Google Scholar] [CrossRef] [PubMed]
- Miyamoto, H.; Murakami, T.; Tsuchida, K.; Sugino, H.; Miyake, H.; Tashiro, S. Tumor-stroma interaction of human pancreatic cancer: acquired resistance to anticancer drugs and proliferation regulation is dependent on extracellular matrix proteins. Pancreas 2004, 28, 38–44. [Google Scholar] [CrossRef] [PubMed]
- Aoudjit, F.; Vuori, K. Integrin signaling inhibits paclitaxel-induced apoptosis in breast cancer cells. Oncogene 2001, 20, 4995–5004. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Świerczewska, M.; Klejewski, A.; Brązert, M.; Kaźmierczak, D.; Iżycki, D.; Nowicki, M.; Zabel, M.; Januchowski, R. New and Old Genes Associated with Primary and Established Responses to Paclitaxel Treatment in Ovarian Cancer Cell Lines. Molecules 2018, 23, 891. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Klejewski, A.; Świerczewska, M.; Zaorska, K.; Brązert, M.; Nowicki, M.; Zabel, M.; Januchowski, R. New and Old Genes Associated with Topotecan Resistance Development in Ovarian Cancer Cell Lines. Anticancer Res. 2017, 37, 1625–1636. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Świerczewska, M.; Klejewski, A.; Wojtowicz, K.; Brązert, M.; Iżycki, D.; Nowicki, M.; Zabel, M.; Januchowski, R. New and Old Genes Associated with Primary and Established Responses to Cisplatin and Topotecan Treatment in Ovarian Cancer Cell Lines. Molecules 2017, 22, 1717. [Google Scholar] [CrossRef] [PubMed]
- Hough, C.D.; Cho, K.R.; Zonderman, A.B.; Schwartz, D.R.; Morin, P.J. Coordinately up-regulated genes in ovarian cancer. Cancer Res. 2001, 61, 3869–3876. [Google Scholar] [PubMed]
- de Wilde, J.; Wilting, S.M.; Meijer, C.J.; van de Wiel, M.A.; Ylstra, B.; Snijders, P.J.; Steenbergen, R.D. Gene expression profiling to identify markers associated with deregulated hTERT in HPV transformed keratinocytes and cervical cancer. Int. J. Cancer 2008, 122, 877–888. [Google Scholar] [CrossRef] [PubMed]
- Chen, L.; O’Bryan, J.P.; Smith, H.S.; Liu, E. Overexpression of matrix Gla protein mRNA in malignant human breast cells: isolation by differential cDNA hybridization. Oncogene 1990, 5, 1391–1395. [Google Scholar] [PubMed]
- Chen, Y.; Miller, C.; Mosher, R.; Zhao, X.; Deeds, J.; Morrissey, M.; Bryant, B.; Yang, D.; Meyer, R.; Cronin, F.; et al. Identification of cervical cancer markers by cDNA and tissue microarrays. Cancer Res. 2003, 63, 1927–1935. [Google Scholar] [PubMed]
- Micke, P.; Kappert, K.; Ohshima, M.; Sundquist, C.; Scheidl, S.; Lindahl, P.; Heldin, C.H.; Botling, J.; Ponten, F.; Ostman, A. In situ identification of genes regulated specifically in fibroblasts of human basal cell carcinoma. J. Investig. Dermatol. 2007, 127, 1516–1523. [Google Scholar] [CrossRef] [PubMed]
- Sabattini, E.; Bisgaard, K.; Ascani, S.; Poggi, S.; Piccioli, M.; Ceccarelli, C.; Pieri, F.; Fraternali-Orcioni, G.; Pileri, S.A. The EnVision++ system: A new immunohistochemical method for diagnostics and research. Critical comparison with the APAAP, ChemMate, CSA, LABC, and SABC techniques. J. Clin. Pathol. 1998, 51, 506–511. [Google Scholar] [CrossRef] [PubMed]
Transcript | Sequence (5′-3′ direction) | ENST Number http://www.ensembl.org | Product Size (bp) |
---|---|---|---|
MGP | CTGATCCTTCTTGCCATCCT CCATCTCTGCTGAGGGGATA | 00000228938.5 00000539261.5 | 141 bp |
MGP-201 | GTGCCCAGGAATCACATGAAAG ACAGGCTTAGAGCGTTCTCG | 00000228938.5 | 142 bp |
MGP-203 | AAGAGAGGATCCGAGAACGCC AGCGTTCGCAAAGTCTGTAG | 00000539261.5 | 81 bp |
GADPH | GAAGGTGAAGGTCGGAGTCA GACAAGCTTCCCGTTCTCAG | 00000229239 | 199 bp |
β-actin | TCTGGCACCACACCTTCTAC GATAGCACAGCCTGGATAGC | 00000331789 | 169 bp |
HRPT1 | CTGAGGATTTGGAAAGGGTG AATCCAGCAGGTCAGCAAAG | 00000298556 | 156 bp |
β2M | CGCTACTCTCTCTTTCTGGC ATGTCGGATGGATGAAACCC | 00000558401 | 133 bp |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Sterzyńska, K.; Klejewski, A.; Wojtowicz, K.; Świerczewska, M.; Andrzejewska, M.; Rusek, D.; Sobkowski, M.; Kędzia, W.; Brązert, J.; Nowicki, M.; et al. The Role of Matrix Gla Protein (MGP) Expression in Paclitaxel and Topotecan Resistant Ovarian Cancer Cell Lines. Int. J. Mol. Sci. 2018, 19, 2901. https://doi.org/10.3390/ijms19102901
Sterzyńska K, Klejewski A, Wojtowicz K, Świerczewska M, Andrzejewska M, Rusek D, Sobkowski M, Kędzia W, Brązert J, Nowicki M, et al. The Role of Matrix Gla Protein (MGP) Expression in Paclitaxel and Topotecan Resistant Ovarian Cancer Cell Lines. International Journal of Molecular Sciences. 2018; 19(10):2901. https://doi.org/10.3390/ijms19102901
Chicago/Turabian StyleSterzyńska, Karolina, Andrzej Klejewski, Karolina Wojtowicz, Monika Świerczewska, Małgorzata Andrzejewska, Damian Rusek, Maciej Sobkowski, Witold Kędzia, Jacek Brązert, Michał Nowicki, and et al. 2018. "The Role of Matrix Gla Protein (MGP) Expression in Paclitaxel and Topotecan Resistant Ovarian Cancer Cell Lines" International Journal of Molecular Sciences 19, no. 10: 2901. https://doi.org/10.3390/ijms19102901