Molecular Cloning and Expression of MnGST-1 and MnGST-2 from Oriental River Prawn, Macrobrachium nipponense, in Response to Hypoxia and Reoxygenation
Abstract
:1. Introduction
2. Results
2.1. Prawn MnGST-1 and MnGST-2 Coding Sequences
2.2. Comparison and Phylogenetic Analysis of M. nipponense GSTs with Other GSTs
2.3. Tissue Distribution of MnGST-1 and MnGST-2
2.4. Expression and Enzyme Activity of MnGST-1 and MnGST-2 in M. nipponense in Response to Acute Hypoxia and Reoxygenation
2.5. Expression and Enzyme Activity of MnGST-1 and MnGST-2 in M. nipponense in Response to Chronic Hypoxia Stress
3. Discussion
4. Materials and Methods
4.1. Experimental Animals and Hypoxic Treatment
4.2. Cloning of MnGST-1 and MnGST-2 cDNAs
4.3. Nucleotide Sequence and Bioinformatics Analyses
4.4. Quantitative Real-Time PCR (QPCR) Analysis of MnGST-1 and MnGST-2 Expression
4.5. Semiquantitative Analysis of MnGST-1 and MnGST-2 Expression
4.6. Enzyme Activity Assay
4.7. Statistical Analysis
Author Contributions
Acknowledgements
Conflicts of Interest
Abbreviations
QPCR | Quantitative real-time reverse transcription PCR |
ORF | Open reading frame |
mRNA | Messenger RNA |
M. nipponense | Macrobrachium nipponense |
GST | Glutathione-S-transferase |
DO | Dissolved oxygen |
ROS | Reactive oxygen species |
SOD | Superoxide dismutase |
CAT | Catalase |
GPx | Glutathione peroxidase |
cDNA | Complementary DNA |
FFRC | Freshwater Fisheries Research Centre |
NJ | Neighbor-joining |
Appendix A
References
- Winn, R.N.; Knott, D.M. An Evaluation of the Survival of Experimental Populations Exposed to Hypoxia in the Savannah River Estuary. Mar. Ecol. Prog. 1992, 4, 161–179. [Google Scholar] [CrossRef]
- Lenihan, H.S.; Peterson, C.H. How habitat degradation through fishery disturbance enhances impacts of hypoxia on oyster reefs. Ecol. Appl. 1998, 1, 128–140. [Google Scholar] [CrossRef]
- Diaz, R.J.; Rosenberg, R. Spreading dead zones and consequences for marine ecosystems. Science 2008, 5891, 926–929. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Xuan, F.; Fu, H.; Ge, X.; Zhu, J.; Qiao, H.; Jin, S.; Zhang, W. Molecular characterization and mRNA expression of hypoxia inducible factor-1 and cognate inhibiting factor in Macrobrachium nipponense in response to hypoxia. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2016, 196–197, 48–56. [Google Scholar] [CrossRef] [PubMed]
- Storey, K.B. Oxidative stress: Animal adaptations in nature. Braz. J. Med. Biol. Res. 1996, 29, 1715–1733. [Google Scholar] [PubMed]
- Li, C.; Jackson, R.M. Reactive species mechanisms of cellular hypoxia-reoxygenation injury. Am. J. Physiol.-Cell Physiol. 2002, 2, C227–C241. [Google Scholar] [CrossRef] [PubMed]
- Sun, S.; Gu, Z.; Fu, H.; Zhu, J.; Ge, X.; Xuan, F. Molecular cloning, characterization, and expression analysis of p53 from the oriental river prawn, Macrobrachium nipponense, in response to hypoxia. Fish Shellfish Immunol. 2016, 54, 68–76. [Google Scholar] [CrossRef] [PubMed]
- Chen, P.; Li, J.; Gao, B.; Liu, P.; Wang, Q.; Li, J. cDNA cloning and characterization of peroxiredoxin gene from the swimming crab Portunus trituberculatus. Aquaculture 2011, 322, 10–15. [Google Scholar] [CrossRef]
- Afonso, V.; Champy, R.; Mitrovic, D.; Collin, P.; Lomri, A. Reactive oxygen species and superoxide dismutases: Role in joint diseases. Joint Bone Spine 2007, 4, 324–329. [Google Scholar] [CrossRef] [PubMed]
- Mu, C.; Zhao, J.; Wang, L.; Song, L.; Zhang, H.; Li, C.; Qiu, L.; Gai, Y. Molecular cloning and characterization of peroxiredoxin 6 from Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 2009, 6, 821–827. [Google Scholar] [CrossRef] [PubMed]
- Duan, Y.; Liu, P.; Li, J.; Chen, P. Expression profiles of selenium dependent glutathione peroxidase and glutathione S-transferase from Exopalaemon carinicauda in response to Vibrio anguillarum and WSSV challenge. Fish Shellfish Immunol. 2013, 3, 661–670. [Google Scholar] [CrossRef] [PubMed]
- Meister, A. Transport and metabolism of glutathione and γ-glutamyl amino acids. Biochem. Soc. Trans. 1983, 11, 793–794. [Google Scholar] [CrossRef] [PubMed]
- Meister, A. Glutathione metabolism and its selective modification. J. Biol. Chem. 1988, 33, 17205–17208. [Google Scholar]
- Frova, C. Glutathione transferases in the genomics era: New insights and perspectives. Biomol. Eng. 2006, 4, 149–169. [Google Scholar] [CrossRef] [PubMed]
- Goto, S.; Kawakatsu, M.; Izumi, S.; Urata, Y.; Kageyama, K.; Ihara, Y.; Koji, T.; Kondo, T. Glutathione S-transferase π localizes in mitochondria and protects against oxidative stress. Free Radic. Biol. Med. 2009, 10, 1392–1403. [Google Scholar] [CrossRef] [PubMed]
- Sheehan, D.; Meade, G.; Foley, V.M. Structure, function and evolution of glutathione transferases: Implications for classification of non-mammalian members of an ancient enzyme superfamily. Biochem. J. 2001, 1, 1–16. [Google Scholar] [CrossRef]
- Zhou, J.; Wang, W.N.; Wang, A.L.; He, W.Y.; Zhou, Q.T.; Liu, Y.; Xu, J. Glutathione S-transferase in the white shrimp Litopenaeus vannamei: Characterization and regulation under pH stress. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 2009, 2, 224–230. [Google Scholar] [CrossRef] [PubMed]
- Huang, Y.; Krell, P.J.; Ladd, T.R.; Feng, Q.; Zheng, S. Cloning, characterization and expression of two glutathione S-transferase cDNAs in the spruce budworm, Choristoneura fumiferana. Arch. Insect Biochem. Physiol. 2009, 1, 44–56. [Google Scholar] [CrossRef] [PubMed]
- Enayati, A.A.; Ranson, H.; Hemingway, J. Insect glutathione transferases and insecticide resistance. Insect Mol. Biol. 2005, 1, 3–8. [Google Scholar] [CrossRef] [PubMed]
- Zhang, L.; Wu, H.; Liu, X.; Chen, L.; Wang, Q.; Zhao, J.; You, L. Molecular cloning and differential expression patterns of sigma and omega glutathione S-transferases from Venerupis philippinarum to heavy metals and benzo pyrene exposure. Chin. J. Oceanol. Limnol. 2012, 3, 413–423. [Google Scholar] [CrossRef]
- Lushchak, V.I.; Lushchak, L.P.; Mota, A.A.; Hermeslima, M. Oxidative stress and antioxidant defenses in goldfish Carassius auratus during anoxia and reoxygenation. Am. J. Physiol.-Reg. I 2001, 1, R100–R107. [Google Scholar] [CrossRef] [PubMed]
- Ma, K.; Feng, J.; Lin, J.; Li, J. The complete mitochondrial genome of Macrobrachium nipponensea. Gene 2011, 2, 160–165. [Google Scholar] [CrossRef] [PubMed]
- Guan, Y.; Li, L.; Wang, H.; Wang, Z. Effects of Hypoxia on Respiratory Metabolism and Antioxidant Capability of Macrobrachium nipponense. J. Hebei Univ. (Nat. Sci. Ed.) 2010, 3, 019. [Google Scholar]
- Blanchette, B.; Feng, X.; Singh, B.R. Marine glutathione S-transferases. Mar. Biotechnol. 2007, 9, 513–542. [Google Scholar] [CrossRef] [PubMed]
- Park, J.H.; Gui, Z.Z.; Sohn, H.D. Molecular Cloning of a Delta-class Glutathione S-transferase Gene from Bombus ignites. Int. J. Ind. Entomol. 2009, 1, 28–32. [Google Scholar]
- Yamamoto, K.; Zhang, P.; Miake, F.; Kashige, N.; Aso, Y.; Banno, Y.; Fujii, H. Cloning, expression and characterization of theta-class glutathione S-transferase from the silkworm, Bombyx mori. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2005, 3, 340–346. [Google Scholar] [CrossRef] [PubMed]
- Gui, Z.Z.; Kim, B.Y.; Lee, K.S.; Wei, Y.D.; Guo, X. Glutathione S-transferases from the larval gut of the silkworm Bombyx mori: CDNA cloning, gene structure, expression and distribution. Eur. J. Entomol. 2008, 105, 567–574. [Google Scholar] [CrossRef]
- Liao, C.Y.; Zhang, K.; Niu, J.Z.; Ding, T.B.; Zhong, R.; Xia, W.K.; Dou, W.; Wang, J.J. Identification and characterization of seven glutathione S-transferase genes from citrus red mite, Panonychus citri (McGregor). Int. J. Mol. Sci. 2013, 12, 24255–24270. [Google Scholar] [CrossRef] [PubMed]
- Dixon, D.P.; Lapthorn, A.; Edwards, R. Plant glutathione transferases. Genome Biol. 2002, 3, reviews3004. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lyu, K.; Gu, L.; Li, B.; Lu, Y.; Wu, C.; Guan, H.; Yang, Z. Stress-responsive expression of a glutathione S-transferase (δ) gene in waterflea Daphnia magna challenged by microcystin-producing and microcystin-free Microcystis aeruginosa. Harmful Algae 2016, 56, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Shan, D.; Fu, H.; Qiao, H.; Sun, S.; Zhang, W.; Jin, S.; Jiang, S.; Gong, Y.; Xiong, Y.; Wu, Y. Molecular cloning, characterization, and expression of crustacean cardioactive peptide in oriental river prawn, Macrobrachium nipponense, during acute hypoxia and reoxygenation. J. World Aquacult. Soc. 2018, 2, 356–365. [Google Scholar] [CrossRef]
- De Oliveira, U.O.; da Rosa Araújo, A.S.; Belló-Klein, A.; Silva, R.S.M.D.; Kucharskil, L.C. Effects of environmental anoxia and different periods of reoxygenation on oxidative balance in gills of the estuarine crab Chasmagnathus granulata. Comp. Biochem. Physiol. Part B Biochem. Mol. Biol. 2005, 1, 51–57. [Google Scholar] [CrossRef] [PubMed]
- Hochachka, P.W.; Lutz, P.L. Mechanism, origin, and evolution of anoxia tolerance in animals. Comp. Biochem. Physiol., Part. B Biochem. Mol. Biol. 2001, 4, 435–459. [Google Scholar] [CrossRef]
- Halliwell, B.; Gutteridge, J.M.C. Free Radicals in Biology and Medicine; Clarendon Press: Oxford, UK, 1985. [Google Scholar]
- Kramer, J.H.; MišÍk, V.; Weglicki, W.B. Lipid Peroxidation-Derived Free Radical Production and Postischemic Myocardial Reperfusion Injurya. Ann. N. Y. Acad. Sci. 1994, 1, 180–196. [Google Scholar] [CrossRef] [PubMed]
- Traystman, R.J.; Kirsch, J.R.; Koehler, R.C. Oxygen radical mechanisms of brain injury following ischemia and reperfusion. J. Appl. Physiol. 1991, 4, 1185–1195. [Google Scholar] [CrossRef] [PubMed]
- Wang, P.; Chen, H.; Qin, H.; Sankarapandi, S.; Becher, M.W.; Wong, P.C.; Zweier, J.L. Overexpression of human copper, zinc-superoxide dismutase (SOD1) prevents postischemic injury. Proc. Natl. Acad. Sci. USA 1998, 8, 4556–4560. [Google Scholar] [CrossRef]
- Parrilla-Taylor, D.P.; Zenteno-Savín, T. Antioxidant enzyme activities in Pacific white shrimp (Litopenaeus vannamei) in response to environmental hypoxia and reoxygenation. Aquaculture 2011, 3–4, 379–383. [Google Scholar] [CrossRef]
- Woo, S.; Denis, V.; Won, H. Expressions of oxidative stress-related genes and antioxidant enzyme activities in Mytilus galloprovincialis (Bivalvia, Mollusca) exposed to hypoxia. Zool. Stud. 2013, 1, 15. [Google Scholar] [CrossRef]
- Choi, J.; Roche, H.; Caquet, T. Effects of physical (hypoxia, hyperoxia) and chemical (potassium dichromate, fenitrothion) stress on antioxidant enzyme activities in Chironomus riparius Mg. (Diptera, Chironomidae) larvae: Potential biomarkers. Environ. Toxicol. Chem. 2000, 2, 495–500. [Google Scholar] [CrossRef]
- Riffel, A.P.K.; Garcia, L.O.; Finamor, I.A.; Saccol, E.M.H.; Meira, M.; Kolberg, C.; Horst, A.; Partata, W.; Llesuy, S.; Baldisserotto, B.; et al. Redox profile in liver of Leporinus macrocephalus exposed to different dissolved oxygen levels. Fish Physiol. Biochem. 2012, 3, 797–805. [Google Scholar] [CrossRef] [PubMed]
- Zhang, G.; Mao, J.; Liang, F.; Chen, J.; Zhao, C.; Yin, S.; Wang, L.; Tang, Z.; Chen, S. Modulated expression and enzymatic activities of Darkbarbel catfish, Pelteobagrus vachelli for oxidative stress induced by acute hypoxia and reoxygenation. Chemosphere 2016, 151, 271–279. [Google Scholar] [CrossRef] [PubMed]
- Bhavan, P.S.; Geraldine, P. Biochemical stress responses in tissues of the prawn Macrobrachium malcolmsonii on exposure to endosulfan. Pest. Biochem. Physiol. 2001, 70, 27–41. [Google Scholar] [CrossRef]
- Tuder, R.M.; Flook, B.E.; Voelkel, N.F. Increased gene expression for VEGF and the VEGF receptors KDR/Flk and Flt in lungs exposed to acute or to chronic hypoxia. Modulation of gene expression by nitric oxide. J. Clin. Investig. 1995, 4, 1798–1807. [Google Scholar] [CrossRef] [PubMed]
- Ye, R.; Zou, E. Hypoxia does not promote naphthalene bioaccumulation in the brown shrimp, Penaeus aztecus. Mar. Pollut. Bull. 2008, 6–12, 307–312. [Google Scholar] [CrossRef] [PubMed]
- Qu, Z. Biological observation of Macrobrachium nipponense. Freshw. Fish. 1990, 1, 3–6. [Google Scholar]
- Yang, F.; Li, X.; Yang, X. Adaptability of Macrobrachium nipponense Juvenile to Water Alkalinity and pH. Chin. J. Zool. 2005, 40, 74–79. [Google Scholar]
- Qiao, H.; Xiong, Y.; Zhang, W.; Fu, H.; Jiang, S.; Sun, S.; Bai, H.; Jin, S.; Gong, Y. Characterization, expression, and function analysis of gonad-inhibiting hormone in Oriental River prawn, Macrobrachium nipponense and its induced expression by temperature. Comp. Biochem. Phys. A Mol. Int. Physiol. 2015, 185, 1–8. [Google Scholar] [CrossRef] [PubMed]
- Zhang, J.; Wei, X.L.; Chen, L.P.; Chen, N.; Li, Y.H.; Wang, W.M. Sequence analysis and expression differentiation of chemokine receptor CXCR4b among three populations of Megalobrama amblycephala. Dev. Comp. Immunol. 2013, 2, 195–201. [Google Scholar] [CrossRef] [PubMed]
- Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods 2001, 4, 402–408. [Google Scholar] [CrossRef] [PubMed]
Primer | Primer Sequence (5′-3′) |
---|---|
MnGST-1-F (Open reading frame) | CAGGTCTGTTATGCTGACTGCTA |
MnGST-1-R (Open reading frame) | AAACTGTACCCACAGCGTTACAA |
MnGST-2-F (Open reading frame) | CCGGGAGAATCCGAGAAGATTT |
MnGST-2-R (Open reading frame) | AACCCTCATTTCTTCACTCGTCT |
3′-MnGST-1 (3′ RACE out primer) | TTAGTGGCTTCAGTTTCCACCTT |
3′-MnGST-1 (3′ RACE in primer) | GGCTTGGCTAGCAAGATGTAAAG |
3′-MnGST-2 (3′ RACE out primer) | TGTCGAACACTACGTCAACATCA |
3′-MnGST-2 (3′ RACE in primer) | TCAACTCTTGGATTGCAAAGTGC |
MnGST-1-F (Real-time PCR primer) | ATTAGTGGCTTCAGTTTCCACCT |
MnGST-1-R (Real-time PCR primer) | TGCCATTTTTCCAAATTCCTGGG |
MnGST-2-F (Real-time PCR primer) | CGAAGCTCTGGAGTGGTTAGATG |
MnGST-2-R (Real-time PCR primer) | AGTTGATGTTGACGTAGTGTTCG |
β-Actin-F (Real-time PCR primer) | TATGCACTTCCTCATGCCAT |
β-Actin-R (Real-time PCR primer) | AGGAGGCGGCAGTGGTCAT |
Species | Gene Name | GenBank Accession Number |
---|---|---|
Aethina tumida | Predicted: glutathione S-transferase 1-like | XP_019870090.1 |
Agrilus planipennis | Predicted: glutathione S-transferase 1-like | XP_018323257.1 |
Anopheles dirus | glutathione S-transferase I | AAB41104.1 |
Anoplophora glabripennis | glutathione S-transferase 1-1 | XP_023311254.1 |
Antheraea pernyi | glutathione S-transferase theta | ACB36909.1 |
Callinectes sapidus | glutathione S-transferase, partial | AJD14729.1 |
Cephus cinctus | glutathione-S-transferase 2 | ARN17841.1 |
Chilo suppressalis | glutathione S-transferase δ 2 | AKS40339.1 |
Choristoneura fumiferana | glutathione S-transferase 3 | ABQ53631.1 |
Cimex lectularius | Predicted: glutathione S-transferase 1, isoform D-like | XP_014260234.1 |
Cnaphalocrocis medinalis | glutathione S-transferase δ 3 | AIZ46898.1 |
Cryptocercus punctulatus | glutathione S-transferase d1 | AFK49803.1 |
Culicoides variipennis | glutathione S transferase-1 | AAB94639.1 |
Delia antiqua | glutathione S-transferase δ 1 | ALF04571.1 |
Dendroctonus ponderosae | Predicted: glutathione S-transferase 1-like | XP_019755130.1 |
Episyrphus balteatus | putative glutahione S-transferase, δ class | CAH58743.1 |
Eriocheir sinensis | δ glutathione S-transferase GST | ACT78699.1 |
Fenneropenaeus chinensis | Delta class glutathione S-transferase | ANH58178.1 |
Hyalella Azteca | Predicted: glutathione S-transferase 1-like | XP_018013809.1 |
Hyalella Azteca | Predicted: glutathione S-transferase 1-like | XP_018010119.1 |
Hyalella Azteca | Predicted: glutathione S-transferase 1-like | XP_018007422.1 |
Leptinotarsa decemlineata | putative glutathione S-transferase δ class member 3 | APX61027.1 |
Leptinotarsa decemlineata | glutathione S-transferase 1-like | XP_023021064.1 |
Locusta migratoria | glutathione S-transferase δ | ADR30117.1 |
Macrobrachium nipponense | MnGST-1 | MG787172 |
Macrobrachium nipponense | MnGST-2 | MG787173 |
Macrobrachium rosenbergii | GST- δ | CCQ19301.1 |
Mayetiola destructor | δ GST | ABG56084.1 |
Palaemon carinicauda | glutathione S-transferase | AGZ89666.1 |
Periplaneta americana | glutathione S transferase class δ variant 1 | AEV23867.1 |
Sogatella furcifea | glutathione S-transferase D2 | AFJ75818.1 |
Stomoxys calcitrans | Predicted: glutathione S-transferase 1-1 | XP_013101447.1 |
Tenebrio molitor | glutathione S-transferase δ | AIL23531.1 |
Tribolium castaneum | Predicted: glutathione S-transferase 1, isoform D-like isoform X1 | XP_974273.1 |
Zootermopsis nevadensis | glutathione S-transferase 1-1-like | XP_021941264.1 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Xu, L.; Yang, M.; Fu, H.; Sun, S.; Qiao, H.; Zhang, W.; Gong, Y.; Jiang, S.; Xiong, Y.; Jin, S.; et al. Molecular Cloning and Expression of MnGST-1 and MnGST-2 from Oriental River Prawn, Macrobrachium nipponense, in Response to Hypoxia and Reoxygenation. Int. J. Mol. Sci. 2018, 19, 3102. https://doi.org/10.3390/ijms19103102
Xu L, Yang M, Fu H, Sun S, Qiao H, Zhang W, Gong Y, Jiang S, Xiong Y, Jin S, et al. Molecular Cloning and Expression of MnGST-1 and MnGST-2 from Oriental River Prawn, Macrobrachium nipponense, in Response to Hypoxia and Reoxygenation. International Journal of Molecular Sciences. 2018; 19(10):3102. https://doi.org/10.3390/ijms19103102
Chicago/Turabian StyleXu, Lei, Ming Yang, Hongtuo Fu, Shengming Sun, Hui Qiao, Wenyi Zhang, Yongsheng Gong, Sufei Jiang, Yiwei Xiong, Shubo Jin, and et al. 2018. "Molecular Cloning and Expression of MnGST-1 and MnGST-2 from Oriental River Prawn, Macrobrachium nipponense, in Response to Hypoxia and Reoxygenation" International Journal of Molecular Sciences 19, no. 10: 3102. https://doi.org/10.3390/ijms19103102