Quality Assessment of Surgical Disc Samples Discriminates Human Annulus Fibrosus and Nucleus Pulposus on Tissue and Molecular Level
Abstract
:1. Introduction
2. Results
2.1. Quality Assessment of AF and NP Tissue Samples with a Novel Scoring System: IVD and DD Score
2.2. Correlation of Scoring Outcome with Donor Age and MRI Grade of Degeneration
2.3. Genome-Wide Expression Analysis Revealed Distinct AF and NP Transcriptomes
2.4. Screening for Marker Genes Differentially Expressed in AF and NP Tissue
2.5. AF and NP Marker Expression in Clear and Unknown Disc Tissue Samples
3. Discussion
4. Materials and Methods
4.1. Human Tissue Material and Tissue Harvesting
4.2. Sample Preparation and RNA Isolation
4.3. Histological Analysis
4.4. Microarray Analysis
4.5. Quantitative Gene Expression Analysis
4.6. Statistical Analysis
5. Conclusions
6. Patents
Supplementary Materials
Author Contributions
Acknowledgments
Conflicts of Interest
Abbreviations
AC | articular cartilage |
ACAN | aggrecan |
ATP5F1B | ATP synthase F1 subunit beta |
ADGRL4 | adhesion G protein-coupled receptor L4 |
AF | annulus fibrosus |
ANKRD29 | ankyrin repeat domain 29 |
ARAP2 | ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2 |
aRNA | amplified RNA |
BCAN | biglycan |
BGLAP | bone gamma-carboxyglutamate protein |
CA12 | carbonic anhydrase 12 |
CD12 | cluster of differentiation 12 |
cDNA | complementary deoxyribonucleic acid |
CDKN2B | cyclin dependent kinase inhibitor 2B |
CEP | cartilage endplate |
CEL | Affymetrix data file format |
COL2A1 | collagen type I |
COMP | cartilage oligomeric matrix protein |
DCN | decorin |
DD | disc degeneration |
DDD | disc degenerative disease |
DEFB1 | defensin beta 1 |
DEG | differentially expressed gene |
DSC2 | desmocollin 2 |
DSC3 | desmocollin 3 |
ECM | extracellular matrix |
EMCN | endomucin |
ERFE | erythroferrin |
FC | fold change |
FMOD | fibromodulin |
FOXF1 | forkhead box F1 |
GCOS | GeneChip Operating Software (Affymetrix) |
GLUT-1 | glucose transporter 1 |
GAG | glycosaminoglycan, aGAG and sGAG are acid and sulphated glycosaminoglycans, respectively |
HIF1α | hypoxia inducible factor 1 alpha subunit |
IVD | intervertebral disc |
KRT8 | keratin 8 |
KRT18 | keratin 18 |
KRT19 | keratin 19 |
LDB2 | LIM domain binding 2 |
MRI | magnetic resonance imaging |
NC | notochordal |
NP | nucleus pulposus |
OLFML2A | olfactomedin-like 2A |
PCA | principle component analysis |
qPCR | quantitative polymerase chain reaction (quantitative gene expression analysis) |
RMA | Robust Multi-array Average |
RPL13A | ribosomal protein L13a |
S100A | S100 calcium binding protein A |
SB | subchondral bone |
SHH | sonic hedgehog |
SLC2A1 | solute carrier family 2 member 1 |
SLR | signal log ratio |
SOSTDC1 | sclerostin domain containing 1 |
SPARCL1 | SPARC (secreted protein acidic and cysteine rich) like 1 |
SPTLC3 | serine palmitoyltransferase long chain base subunit 3 |
TEK | TEK receptor tyrosine kinase |
TGF | transforming growth factor |
TNMD | tenomodulin |
UPL | Universal ProbeLibrary (Roche) |
VCAN | versican |
References
- Urban, J.P.; Roberts, S. Degeneration of the intervertebral disc. Arthritis Res. Ther. 2003, 5, 120–130. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Vernon-Roberts, B.; Moore, R.J.; Fraser, R.D. The natural history of age-related disc degeneration: The influence of age and pathology on cell populations in the L4-L5 disc. Spine 2008, 33, 2767–2773. [Google Scholar] [CrossRef] [PubMed]
- Oehme, D.; Goldschlager, T.; Ghosh, P.; Rosenfeld, J.V.; Jenkin, G. Cell-based therapies used to treat lumbar degenerative disc disease: A systematic review of animal studies and human clinical trials. Stem Cells Int. 2015, 2015. [Google Scholar] [CrossRef] [PubMed]
- Smith, L.J.; Nerurkar, N.L.; Choi, K.S.; Harfe, B.D.; Elliott, D.M. Degeneration and regeneration of the intervertebral disc: Lessons from development. Dis. Model Mech. 2011, 4, 31–41. [Google Scholar] [CrossRef] [PubMed]
- Iatridis, J.C.; Nicoll, S.B.; Michalek, A.J.; Walter, B.A.; Gupta, M.S. Role of biomechanics in intervertebral disc degeneration and regenerative therapies: What needs repairing in the disc and what are promising biomaterials for its repair? Spine J. 2013, 13, 243–262. [Google Scholar] [CrossRef] [PubMed]
- Pattappa, G.; Li, Z.; Peroglio, M.; Wismer, N.; Alini, M.; Grad, S. Diversity of intervertebral disc cells: Phenotype and function. J. Anat. 2012, 221, 480–496. [Google Scholar] [CrossRef] [PubMed]
- Ludwinski, F.E.; Gnanalingham, K.; Richardson, S.M.; Hoyland, J.A. Understanding the native nucleus pulposus cell phenotype has important implications for intervertebral disc regeneration strategies. Regen. Med. 2013, 8, 75–87. [Google Scholar] [CrossRef] [PubMed]
- Lee, C.R.; Sakai, D.; Nakai, T.; Toyama, K.; Mochida, J.; Alini, M.; Grad, S. A phenotypic comparison of intervertebral disc and articular cartilage cells in the rat. Eur. Spine J. 2007, 16, 2174–2185. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakai, D.; Nakai, T.; Mochida, J.; Alini, M.; Grad, S. Differential phenotype of intervertebral disc cells: Microarray and immunohistochemical analysis of canine nucleus pulposus and anulus fibrosus. Spine 2009, 34, 1448–1456. [Google Scholar] [CrossRef] [PubMed]
- Minogue, B.M.; Richardson, S.M.; Zeef, L.A.; Freemont, A.J.; Hoyland, J.A. Transcriptional profiling of bovine intervertebral disc cells: Implications for identification of normal and degenerate human intervertebral disc cell phenotypes. Arthritis Res. Ther. 2010, 12. [Google Scholar] [CrossRef] [PubMed]
- Tang, X.; Jing, L.; Chen, J. Changes in the molecular phenotype of nucleus pulposus cells with intervertebral disc aging. PLoS ONE 2012, 7. [Google Scholar] [CrossRef] [PubMed]
- Mern, D.S.; Beierfuss, A.; Thome, C.; Hegewald, A.A. Enhancing human nucleus pulposus cells for biological treatment approaches of degenerative intervertebral disc diseases: A systematic review. J. Tissue Eng. Regen. Med. 2014, 8, 925–936. [Google Scholar] [CrossRef] [PubMed]
- Urban, J.P.G.; Roberts, S.; Ralphs, J.R. The nucleus of the intervertebral disc from development to degeneration. Am. Zool. 2000, 40, 53–61. [Google Scholar] [CrossRef]
- Weiler, C.; Nerlich, A.G.; Schaaf, R.; Bachmeier, B.E.; Wuertz, K.; Boos, N. Immunohistochemical identification of notochordal markers in cells in the aging human lumbar intervertebral disc. Eur. Spine J. 2010, 19, 1761–1770. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Risbud, M.V.; Shapiro, I.M. Notochordal cells in the adult intervertebral disc: New perspective on an old question. Crit. Rev. Eukaryot. Gene Exp. 2011, 21, 29–41. [Google Scholar] [CrossRef]
- Gilson, A.; Dreger, M.; Urban, J.P. Differential expression level of cytokeratin 8 in cells of the bovine nucleus pulposus complicates the search for specific intervertebral disc cell markers. Arthritis Res. Ther. 2010, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gruber, H.E.; Mougeot, J.L.; Hoelscher, G.; Ingram, J.A.; Hanley, E.N., Jr. Microarray analysis of laser capture microdissected-anulus cells from the human intervertebral disc. Spine 2007, 32, 1181–1187. [Google Scholar] [CrossRef] [PubMed]
- Gruber, H.E.; Hoelscher, G.L.; Ingram, J.A.; Hanley, E.N., Jr. Genome-wide analysis of pain-, nerve- and neurotrophin -related gene expression in the degenerating human annulus. Mol. Pain 2012, 8, 63. [Google Scholar] [CrossRef] [PubMed]
- Kazezian, Z.; Gawri, R.; Haglund, L.; Ouellet, J.; Mwale, F.; Tarrant, F.; O’Gaora, P.; Pandit, A.; Alini, M.; Grad, S. Gene expression profiling identifies interferon signalling molecules and IGFBP3 in human degenerative annulus fibrosus. Sci. Rep. 2015, 5. [Google Scholar] [CrossRef] [PubMed]
- Guo, W.; Zhang, B.; Li, Y.; Duan, H.Q.; Sun, C.; Xu, Y.Q.; Feng, S.Q. Gene expression profile identifies potential biomarkers for human intervertebral disc degeneration. Mol. Med. Rep. 2017, 16, 8665–8672. [Google Scholar] [CrossRef] [PubMed]
- Ji, S.C.; Han, N.; Liu, Y.; Li, G.; Sun, Z.; Li, Z. Identification of genes associated with disc degeneration using bioinformatics. Biotech. Histochem. 2015, 90, 353–360. [Google Scholar] [CrossRef] [PubMed]
- Risbud, M.V.; Schoepflin, Z.R.; Mwale, F.; Kandel, R.A.; Grad, S.; Iatridis, J.C.; Sakai, D.; Hoyland, J.A. Defining the phenotype of young healthy nucleus pulposus cells: Recommendations of the Spine Research Interest Group at the 2014 annual ORS meeting. J. Orthop. Res. 2015, 33, 283–293. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Thorpe, A.A.; Binch, A.L.; Creemers, L.B.; Sammon, C.; Le Maitre, C.L. Nucleus pulposus phenotypic markers to determine stem cell differentiation: Fact or fiction? Oncotarget 2016, 7, 2189–2200. [Google Scholar] [CrossRef] [PubMed]
- Richardson, S.M.; Knowles, R.; Tyler, J.; Mobasheri, A.; Hoyland, J.A. Expression of glucose transporters GLUT-1, GLUT-3, GLUT-9 and HIF-1alpha in normal and degenerate human intervertebral disc. Histochem. Cell Biol. 2008, 129, 503–511. [Google Scholar] [CrossRef] [PubMed]
- Boos, N.; Weissbach, S.; Rohrbach, H.; Weiler, C.; Spratt, K.F.; Nerlich, A.G. Classification of age-related changes in lumbar intervertebral discs: 2002 Volvo Award in basic science. Spine 2002, 27, 2631–2644. [Google Scholar] [CrossRef] [PubMed]
- Rutges, J.P.; Duit, R.A.; Kummer, J.A.; Bekkers, J.E.; Oner, F.C.; Castelein, R.M.; Dhert, W.J.; Creemers, L.B. A validated new histological classification for intervertebral disc degeneration. Osteoarthr. Cartil. 2013, 21, 2039–2047. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Miyazaki, M.; Hong, S.W.; Yoon, S.H.; Morishita, Y.; Wang, J.C. Reliability of a magnetic resonance imaging-based grading system for cervical intervertebral disc degeneration. J. Spinal Disord. Tech. 2008, 21, 288–292. [Google Scholar] [CrossRef] [PubMed]
- Tang, Y.; Wang, S.; Liu, Y.; Wang, X. Microarray analysis of genes and gene functions in disc degeneration. Exp. Ther. Med. 2014, 7, 343–348. [Google Scholar] [CrossRef] [PubMed]
- Cheung, K.M.; Karppinen, J.; Chan, D.; Ho, D.W.; Song, Y.Q.; Sham, P.; Cheah, K.S.; Leong, J.C.; Luk, K.D. Prevalence and pattern of lumbar magnetic resonance imaging changes in a population study of one thousand forty-three individuals. Spine 2009, 34, 934–940. [Google Scholar] [CrossRef] [PubMed]
- Menssen, A.; Haupl, T.; Sittinger, M.; Delorme, B.; Charbord, P.; Ringe, J. Differential gene expression profiling of human bone marrow-derived mesenchymal stem cells during adipogenic development. BMC Genom. 2011, 12. [Google Scholar] [CrossRef] [PubMed]
- Karlsson, C.; Dehne, T.; Lindahl, A.; Brittberg, M.; Pruss, A.; Sittinger, M.; Ringe, J. Genome-wide expression profiling reveals new candidate genes associated with osteoarthritis. Osteoarthr. Cartil. 2010, 18, 581–592. [Google Scholar] [CrossRef] [PubMed]
- Minogue, B.M.; Richardson, S.M.; Zeef, L.A.; Freemont, A.J.; Hoyland, J.A. Characterization of the human nucleus pulposus cell phenotype and evaluation of novel marker gene expression to define adult stem cell differentiation. Arthritis Rheum. 2010, 62, 3695–3705. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Teraguchi, M.; Yoshimura, N.; Hashizume, H.; Muraki, S.; Yamada, H.; Minamide, A.; Oka, H.; Ishimoto, Y.; Nagata, K.; Kagotani, R.; et al. Prevalence and distribution of intervertebral disc degeneration over the entire spine in a population-based cohort: The Wakayama Spine Study. Osteoarthr. Cartil. 2014, 22, 104–110. [Google Scholar] [CrossRef] [PubMed]
- Nerlich, A.G.; Boos, N.; Wiest, I.; Aebi, M. Immunolocalization of major interstitial collagen types in human lumbar intervertebral discs of various ages. Virchows Arch. 1998, 432, 67–76. [Google Scholar] [CrossRef] [PubMed]
- Koerner, J.D.; Markova, D.Z.; Yadla, S.; Mendelis, J.; Hilibrand, A.; Vaccaro, A.R.; Risbud, M.V.; Albert, T.J.; Anderson, D.G.; Kepler, C.K. Differential gene expression in anterior and posterior annulus fibrosus. Spine 2014, 39, 1917–1923. [Google Scholar] [CrossRef] [PubMed]
- Maroudas, A.; Stockwell, R.A.; Nachemson, A.; Urban, J. Factors involved in the nutrition of the human lumbar intervertebral disc: Cellularity and diffusion of glucose in vitro. J. Anat. 1975, 120, 113–130. [Google Scholar] [PubMed]
- Sive, J.I.; Baird, P.; Jeziorsk, M.; Watkins, A.; Hoyland, J.A.; Freemont, A.J. Expression of chondrocyte markers by cells of normal and degenerate intervertebral discs. Mol. Pathol. 2002, 55, 91–97. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Bergknut, N.; Meij, B.P.; Hagman, R.; de Nies, K.S.; Rutges, J.P.; Smolders, L.A.; Creemers, L.B.; Lagerstedt, A.S.; Hazewinkel, H.A.; Grinwis, G.C. Intervertebral disc disease in dogs—Part 1: A new histological grading scheme for classification of intervertebral disc degeneration in dogs. Vet. J. 2013, 195, 156–163. [Google Scholar] [CrossRef] [PubMed]
- Yu, J.; Schollum, M.L.; Wade, K.R.; Broom, N.D.; Urban, J.P. ISSLS prize winner: A detailed examination of the elastic network leads to a new understanding of annulus fibrosus organization. Spine 2015, 40, 1149–1157. [Google Scholar] [CrossRef] [PubMed]
- Inkinen, R.I.; Lammi, M.J.; Agren, U.; Tammi, R.; Puustjarvi, K.; Tammi, M.I. Hyaluronan distribution in the human and canine intervertebral disc and cartilage endplate. Histochem. J. 1999, 31, 579–587. [Google Scholar] [CrossRef] [PubMed]
- Rutges, J.; Creemers, L.B.; Dhert, W.; Milz, S.; Sakai, D.; Mochida, J.; Alini, M.; Grad, S. Variations in gene and protein expression in human nucleus pulposus in comparison with annulus fibrosus and cartilage cells: Potential associations with aging and degeneration. Osteoarthr. Cartil. 2010, 18, 416–423. [Google Scholar] [CrossRef] [PubMed]
- Cheung, K.M.; Samartzis, D.; Karppinen, J.; Mok, F.P.; Ho, D.W.; Fong, D.Y.; Luk, K.D. Intervertebral disc degeneration: New insights based on “skipped” level disc pathology. Arthritis Rheum. 2010, 62, 2392–2400. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Davies, B.M.; Atkinson, R.A.; Ludwinski, F.; Freemont, A.J.; Hoyland, J.A.; Gnanalingham, K.K. Qualitative grading of disc degeneration by magnetic resonance in the lumbar and cervical spine: Lack of correlation with histology in surgical cases. Br. J. Neurosurg. 2016, 30, 414–421. [Google Scholar] [CrossRef] [PubMed]
- Chen, K.; Wu, D.; Zhu, X.; Ni, H.; Wei, X.; Mao, N.; Xie, Y.; Niu, Y.; Li, M. Gene expression profile analysis of human intervertebral disc degeneration. Genet. Mol. Biol. 2013, 36, 448–454. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Fontes, R.B.; Baptista, J.S.; Rabbani, S.R.; Traynelis, V.C.; Liberti, E.A. Structural and ultrastructural analysis of the cervical discs of young and elderly humans. PLoS ONE 2015, 10. [Google Scholar] [CrossRef] [PubMed]
- Power, K.A.; Grad, S.; Rutges, J.P.; Creemers, L.B.; van Rijen, M.H.; O’Gaora, P.; Wall, J.G.; Alini, M.; Pandit, A.; Gallagher, W.M. Identification of cell surface-specific markers to target human nucleus pulposus cells: Expression of carbonic anhydrase XII varies with age and degeneration. Arthritis Rheum. 2011, 63, 3876–3886. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Gruber, H.E.; Bornstein, P.; Sage, E.H.; Ingram, J.A.; Zinchenko, N.; Norton, H.J.; Hanley, E.N., Jr. Disruption of the thrombospondin-2 gene alters the lamellar morphology but does not permit vascularization of the adult mouse lumbar disc. Arthritis Res. Ther. 2008, 10. [Google Scholar] [CrossRef] [PubMed]
- Gruber, H.E.; Norris, R.A.; Kern, M.J.; Hoelscher, G.L.; Ingram, J.A.; Zinchenko, N.; Hanley, E.N., Jr. Periostin is expressed by cells of the human and sand rat intervertebral discs. Biotech. Histochem. 2011, 86, 199–206. [Google Scholar] [CrossRef] [PubMed]
- Risbud, M.V.; Schaer, T.P.; Shapiro, I.M. Toward an understanding of the role of notochordal cells in the adult intervertebral disc: From discord to accord. Dev. Dyn. 2010, 239, 2141–2148. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Van den Akker, G.G.H.; Koenders, M.I.; van de Loo, F.A.J.; van Lent, P.; Blaney Davidson, E.; van der Kraan, P.M. Transcriptional profiling distinguishes inner and outer annulus fibrosus from nucleus pulposus in the bovine intervertebral disc. Eur. Spine J. 2017, 26, 2053–2062. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Sakai, D.; Nakamura, Y.; Nakai, T.; Mishima, T.; Kato, S.; Grad, S.; Alini, M.; Risbud, M.V.; Chan, D.; Cheah, K.S.; et al. Exhaustion of nucleus pulposus progenitor cells with ageing and degeneration of the intervertebral disc. Nat. Commun. 2012, 3. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rajpurohit, R.; Risbud, M.V.; Ducheyne, P.; Vresilovic, E.J.; Shapiro, I.M. Phenotypic characteristics of the nucleus pulposus: Expression of hypoxia inducing factor-1, glucose transporter-1 and MMP-2. Cell Tissue Res. 2002, 308, 401–407. [Google Scholar] [CrossRef] [PubMed]
- Fujita, N.; Miyamoto, T.; Imai, J.; Hosogane, N.; Suzuki, T.; Yagi, M.; Morita, K.; Ninomiya, K.; Miyamoto, K.; Takaishi, H.; et al. CD24 is expressed specifically in the nucleus pulposus of intervertebral discs. Biochem. Biophys. Res. Commun. 2005, 338, 1890–1896. [Google Scholar] [CrossRef] [PubMed]
- Rodrigues-Pinto, R.; Richardson, S.M.; Hoyland, J.A. Identification of novel nucleus pulposus markers: Interspecies variations and implications for cell-based therapiesfor intervertebral disc degeneration. Bone Jt. Res. 2013, 2, 169–178. [Google Scholar] [CrossRef] [PubMed]
- Balakrishnan, L.; Nirujogi, R.S.; Ahmad, S.; Bhattacharjee, M.; Manda, S.S.; Renuse, S.; Kelkar, D.S.; Subbannayya, Y.; Raju, R.; Goel, R.; et al. Proteomic analysis of human osteoarthritis synovial fluid. Clin. Proteom. 2014, 11. [Google Scholar] [CrossRef] [PubMed]
- Snelling, S.; Rout, R.; Davidson, R.; Clark, I.; Carr, A.; Hulley, P.A.; Price, A.J. A gene expression study of normal and damaged cartilage in anteromedial gonarthrosis, a phenotype of osteoarthritis. Osteoarthr. Cartil. 2014, 22, 334–343. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Molinos, M.; Cunha, C.; Almeida, C.R.; Goncalves, R.M.; Pereira, P.; Silva, P.S.; Vaz, R.; Barbosa, M.A. Age-correlated phenotypic alterations in cells isolated from human degenerated intervertebral discs with contained hernias. Spine 2017, 43, E274–E284. [Google Scholar] [CrossRef] [PubMed]
- Chan, W.C.; Au, T.Y.; Tam, V.; Cheah, K.S.; Chan, D. Coming together is a beginning: The making of an intervertebral disc. Birth Defects Res. Part C 2014, 102, 83–100. [Google Scholar] [CrossRef] [PubMed]
- Choi, H.; Johnson, Z.I.; Risbud, M.V. Understanding nucleus pulposus cell phenotype: A prerequisite for stem cell based therapies to treat intervertebral disc degeneration. Curr. Stem Cell Res. Ther. 2015, 10, 307–316. [Google Scholar] [CrossRef] [PubMed]
- Benjamin, M.; Ralphs, J.R. Biology of fibrocartilage cells. Int. Rev. Cytol. 2004, 233, 1–45. [Google Scholar] [PubMed]
- Colombier, P.; Clouet, J.; Hamel, O.; Lescaudron, L.; Guicheux, J. The lumbar intervertebral disc: From embryonic development to degeneration. Jt. Bone Spine 2014, 81, 125–129. [Google Scholar] [CrossRef] [PubMed]
- Endres, M.; Abbushi, A.; Thomale, U.W.; Cabraja, M.; Kroppenstedt, S.N.; Morawietz, L.; Casalis, P.A.; Zenclussen, M.L.; Lemke, A.J.; Horn, P.; et al. Intervertebral disc regeneration after implantation of a cell-free bioresorbable implant in a rabbit disc degeneration model. Biomaterials 2010, 31, 5836–5841. [Google Scholar] [CrossRef] [PubMed]
- Hegewald, A.A.; Neumann, K.; Kalwitz, G.; Freymann, U.; Endres, M.; Schmieder, K.; Kaps, C.; Thome, C. The chemokines CXCL10 and XCL1 recruit human annulus fibrosus cells. Spine 2012, 37, 101–107. [Google Scholar] [CrossRef] [PubMed]
- Liu, W.; Liu, D.; Zheng, J.; Shi, P.; Chou, P.H.; Oh, C.; Chen, D.; An, H.S.; Chee, A. Annulus fibrosus cells express and utilize C-C chemokine receptor 5 (CCR5) for migration. Spine J. 2017, 17, 720–726. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Feng, C.; Zhang, Y.; Yang, M.; Huang, B.; Zhou, Y. Collagen-derived n-acetylated proline-glycine-proline in intervertebral discs modulates CXCR1/2 expression and activation in cartilage endplate stem cells to induce migration and differentiation toward a pro-inflammatory phenotype. Stem Cells 2015, 33, 3558–3568. [Google Scholar] [CrossRef] [PubMed]
- Grad, S.; Peroglio, M.; Li, Z.; Alini, M. Endogenous cell homing for intervertebral disk regeneration. J. Am. Acad. Orthop. Surg. 2015, 23, 264–266. [Google Scholar] [CrossRef] [PubMed]
- Liu, S.; Liang, H.; Lee, S.M.; Li, Z.; Zhang, J.; Fei, Q. Isolation and identification of stem cells from degenerated human intervertebral discs and their migration characteristics. Acta Biochim. Biophys. Sin. 2017, 49, 101–109. [Google Scholar] [CrossRef] [PubMed]
- Feng, C.; Liu, H.; Yang, M.; Zhang, Y.; Huang, B.; Zhou, Y. Disc cell senescence in intervertebral disc degeneration: Causes and molecular pathways. Cell Cycle 2016, 15, 1674–1684. [Google Scholar] [CrossRef] [PubMed]
- Diaz-Romero, J.; Quintin, A.; Schoenholzer, E.; Pauli, C.; Despont, A.; Zumstein, M.A.; Kohl, S.; Nesic, D. S100A1 and S100B expression patterns identify differentiation status of human articular chondrocytes. J. Cell. Physiol. 2014, 229, 1106–1117. [Google Scholar] [CrossRef] [PubMed]
- Neve, A.; Corrado, A.; Cantatore, F.P. Osteocalcin: Skeletal and extra-skeletal effects. J. Cell. Physiol. 2013, 228, 1149–1153. [Google Scholar] [CrossRef] [PubMed]
- Jelinsky, S.A.; Archambault, J.; Li, L.; Seeherman, H. Tendon-selective genes identified from rat and human musculoskeletal tissues. J. Orthop. Res. 2010, 28, 289–297. [Google Scholar] [CrossRef] [PubMed]
- Liu, C.; Fei, H.D.; Sun, Z.Y.; Tian, J.W. Bioinformatic analysis of the microarray gene expression profile in degenerative intervertebral disc cells exposed to TNF-alpha. Eur. Rev. Med. Pharmacol. Sci. 2015, 19, 3332–3339. [Google Scholar] [PubMed]
- Kinoshita, M.; Nakamura, T.; Ihara, M.; Haraguchi, T.; Hiraoka, Y.; Tashiro, K.; Noda, M. Identification of human endomucin-1 and -2 as membrane-bound O-sialoglycoproteins with anti-adhesive activity. FEBS Lett. 2001, 499, 121–126. [Google Scholar] [CrossRef]
- Tomarev, S.I.; Nakaya, N. Olfactomedin domain-containing proteins: Possible mechanisms of action and functions in normal development and pathology. Mol. Neurobiol. 2009, 40, 122–138. [Google Scholar] [CrossRef] [PubMed]
- Menicanin, D.; Bartold, P.M.; Zannettino, A.C.; Gronthos, S. Identification of a common gene expression signature associated with immature clonal mesenchymal cell populations derived from bone marrow and dental tissues. Stem Cells Dev. 2010, 19, 1501–1510. [Google Scholar] [CrossRef] [PubMed]
- Nanda, V.; Downing, K.P.; Ye, J.; Xiao, S.; Kojima, Y.; Spin, J.M.; DiRenzo, D.; Nead, K.T.; Connolly, A.J.; Dandona, S.; et al. CDKN2B regulates TGFbeta signaling and smooth muscle cell investment of hypoxic neovessels. Circ. Res. 2016, 118, 230–240. [Google Scholar] [CrossRef] [PubMed]
- Hegewald, A.A.; Cluzel, J.; Kruger, J.P.; Endres, M.; Kaps, C.; Thome, C. Effects of initial boost with TGF-beta 1 and grade of intervertebral disc degeneration on 3D culture of human annulus fibrosus cells. J. Orthop. Surg. Res. 2014, 9. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Park, J.Y.; Yoon, Y.S.; Park, H.S.; Kuh, S.U. Molecular response of human cervical and lumbar nucleus pulposus cells from degenerated discs following cytokine treatment. Genet. Mol. Res. 2013, 12, 838–851. [Google Scholar] [CrossRef] [PubMed]
- Stich, S.; Stolk, M.; Girod, P.P.; Thome, C.; Sittinger, M.; Ringe, J.; Seifert, M.; Hegewald, A.A. Regenerative and immunogenic characteristics of cultured nucleus pulposus cells from human cervical intervertebral discs. PLoS ONE 2015, 10, e0126954. [Google Scholar] [CrossRef] [PubMed]
- Hegewald, A.A.; Endres, M.; Abbushi, A.; Cabraja, M.; Woiciechowsky, C.; Schmieder, K.; Kaps, C.; Thome, C. Adequacy of herniated disc tissue as a cell source for nucleus pulposus regeneration. J. Neurosurg. Spine 2011, 14, 273–280. [Google Scholar] [CrossRef] [PubMed]
- Vedicherla, S.; Buckley, C.T. Cell-based therapies for intervertebral disc and cartilage regeneration- Current concepts, parallels, and perspectives. J. Orthop. Res. 2017, 35, 8–22. [Google Scholar] [CrossRef] [PubMed]
- Moore, R.J.; Vernon-Roberts, B.; Fraser, R.D.; Osti, O.L.; Schembri, M. The origin and fate of herniated lumbar intervertebral disc tissue. Spine 1996, 21, 2149–2155. [Google Scholar] [CrossRef] [PubMed]
- Rajasekaran, S.; Bajaj, N.; Tubaki, V.; Kanna, R.M.; Shetty, A.P. ISSLS Prize winner: The anatomy of failure in lumbar disc herniation: An in vivo, multimodal, prospective study of 181 subjects. Spine 2013, 38, 1491–1500. [Google Scholar] [CrossRef] [PubMed]
Estimation of Correct Tissue Type | ||||
---|---|---|---|---|
AF | NP | |||
macroscopic/haptic | dense, annular fibres in multilayer | 2 | spongy | 2 |
less defined fibres | 1 | less spongy | 1 | |
no fibres visible | 0 | disorganised | 0 | |
HE/safranin O staining | well defined half-ring shaped fibres | 2 | well organised matrix | 2 |
less defined fibres | 1 | partly disorganised matrix | 1 | |
no fibres visible | 0 | loss of nucleus matrix | 0 | |
Correct Expression of Extracellular Matrix Proteins | ||||
AF | NP | |||
safranin O staining | red dominates, green among lamellae | 2 | intense red, no green | 2 |
mixture of red and green | 1 | reduced red, in parts green | 1 | |
red only, no green | 0 | faint red, green dominates | 0 | |
alcian blue staining | blue dominates, white in lamellae | 2 | intense blue | 2 |
reduced blue | 1 | faint blue | 1 | |
no blue | 0 | no blue | 0 | |
Evidence of Sample Impurity | ||||
macroscopic/haptic | not visible | 2 | ||
bloody | 1 | |||
obviously irregular tissue parts | 0 | |||
HE/safranin O/alcian blue staining | not visible | 2 | ||
tissue structure slightly irregular | 1 | |||
any sign of other tissue structure or unusual cell accumulation | 0 | |||
maximum IVD score | 12 |
macroscopic/haptic | normal and white coloured | 0 |
slightly harder or yellowish | 1 | |
sclerotic or greyish | 2 | |
cellularity (alcian blue staining) | normal, no cell clusters | 0 |
mixed cellularity, some cell clusters or enlarged cells | 1 | |
mainly clustered cells, chondroid nests present | 2 | |
calcification (von Kossa staining) | no sign of calcification | 0 |
small spots of black staining or extensive greyish staining | 1 | |
intense black staining | 2 | |
maximum DD score | 6 |
Donor | Gender | Age | # | Disc | MRI | Scoring AF | Scoring NP | ||||
---|---|---|---|---|---|---|---|---|---|---|---|
Level | Grade | IVD | DD | IVD | DD | ||||||
1 | m | 55 | 1 | C4/5 | 4 | 10 | 0 | § | 9 | 1 | § |
2 | C5/6 | 4 | 9 | 1 | 7 | 4 * | + | ||||
2 | f | 43 | 3 | C4/5 | 3 | 10 | 2 | § | 7 | 1 | § |
4 | C5/6 | 3 | 5 * | 3 * | + | 9 | 2 | + | |||
5 | C6/7 | 3 | 10 | 3 * | 7 | 2 * | |||||
3 | m | 59 | 6 | C4/5 | 3 | 6 * | 1 | 4 * | 4 * | + | |
7 | C5/6 | 3 | 7 | 2 | §+ | 3 * | 4 * | + | |||
8 | C6/7 | 3 | 9 | 1 | + | 4 * | 3 | ||||
4 | f | 45 | 9 | C5/6 | 3 | 11 | 2 | § | 9 | 2 | § |
5 | m | 62 | 10 | C3/4 | 4 | 2 * | 3 * | + | 8 | 2 | + |
11 | C4/5 | 4 | 5 * | 1 | 6 | 2 | § | ||||
6 | f | 76 | 12 | C4/5 | 3 | 10 | 0 | § | 6 * | 3 | + |
7 | m | 36 | 13 | C4/5 | 4 | 8 | 1 | § | 11 | 1 | § |
14 | C5/6 | 4 | 7 * | 3 * | + | 9 * | 3 * | ||||
15 | C6/7 | 4 | 9 | 3 | + | 9 | 2 | + | |||
8 | m | 45 | 16 | C3/4 | 4 | 7 | 4 * | + | 7 | 3 * | + |
9 | f | 76 | 17 | C4/5 | 4 | 6 * | 4 * | + | 7 | 4 * | |
10 | f | 42 | 18 | C5/6 | 4 | 9 * | 4 * | + | 7 | 4 * | |
19 | C6/7 | 3 | 7 * | 2 | 7 * | 2 | + | ||||
11 | m | 55 | 20 | C4/5 | 4 | 2 * | 2 | + | 6 * | 1 | + |
21 | C5/6 | 4 | 8 | 2 | § | 7 | 2 | § | |||
12 | f | 64 | 22 | C3/4 | 4 | 11 | 2 | §+ | 5 * | 2 | |
13 | f | 77 | 23 | C6/7 | 4 | 4 * | 3 * | §+ | 6 * | 3 * | + |
14 | m | 47 | 24 | C5/6 | 4 | 9 | 2 | §+ | 5 * | 1 | + |
15 | f | 46 | 25 | C4/5 | 4 | 1 * | 1 | + | 7 | 2 | § |
16 | m | 59 | 26 | C5/6 | 4 | 9 | 1 | 5 * | 3 * | + | |
27 | C6/7 | 3 | 8 | 2 | §+ | 9 | 2 | § | |||
17 | f | 46 | 28 | C5/6 | 3 | 9 | 2 | §+ | 7 | 1 | § |
Score | Sample Origin | Donor Age | MRI Grade | ||
---|---|---|---|---|---|
r | p-Value | r | p-Value | ||
IVD | AF | −0.16 | 0.424 | −0.25 | 0.196 |
NP | −0.57 | 0.001 | −0.07 | 0.706 | |
DD | AF | −0.25 | 0.197 | +0.13 | 0.504 |
NP | +0.21 | 0.280 | +0.03 | 0.885 |
Sample Origin | # | AF Marker | NP Marker | Marker Match | |||||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
AF1 | AF2 | AF3 | AF4 | AF5 | NP1 | NP2 | NP3 | NP4 | NP5 | NP6 | AF | NP | |||||
AF | 4 | − | − | NA | − | NA | NA | + | − | − | + | − | 0% | 40% | |||
AF | 10 | + | + | NA | + | + | NA | − | − | + | + | − | 100% | 40% | |||
AF | 14 | ++ | + | NA | + | ++ | NA | − | − | − | − | − | 100% | 0% | |||
AF | 17 | − | − | − | − | − | + | − | ++ | + | + | + | 0% | 83% | |||
AF | 18 | − | − | − | + | + | − | − | − | − | + | − | 40% | 17% | |||
AF | 20 | + | + | + | + | + | − | − | − | + | − | − | 100% | 17% | |||
AF | 23 | + | + | + | ++ | ++ | − | − | − | − | − | − | 100% | 0% | |||
AF | 25 | ++ | + | + | + | ++ | − | − | − | − | − | − | 100% | 0% | |||
NP | 6 | − | − | − | − | − | NA | − | − | − | + | − | 0% | 20% | |||
NP | 7 | − | − | − | − | − | − | NA | NA | − | NA | − | 0% | 0% | |||
NP | 12 | − | − | − | − | − | − | − | − | + | − | + | 0% | 33% | |||
NP | 19 | − | − | − | − | NA | ++ | + | ++ | + | + | − | 0% | 83% | |||
NP | 20 | NA | − | − | NA | − | + | + | − | + | − | − | 0% | 50% | |||
NP | 23 | − | − | − | NA | − | − | NA | NA | − | NA | − | 0% | 0% | |||
NP | 24 | − | NA | NA | − | − | − | − | + | + | − | − | 0% | 33% | |||
NP | 26 | − | − | − | − | − | ++ | + | − | + | + | + | 0% | 83% |
Gene Symbol | Accession Number # | Primer Sequence | Probe | |
---|---|---|---|---|
Forward | Reverse | |||
ADGRL4 | NM_022159.3 | tccaaaagaccacagagtttga | atgcagcttttctctttggaa | 58 |
ANKRD29 | NM_173505.2 | gagcaaacatccatgaccaa | ccagcagtaatcgaataacatcc | 44 |
ARAP2 | NM_015230.3 | agacggagtggatgaccagt | cagctggtggccatatatca | 61 |
CDKN2B | NM_004936.3 | gcggggactagtggagaag | ctgcccatcatcatgacct | 17 |
DEFB1 | NM_005218.3 | tgtctgagatggcctcaggt | gggcaggcagaatagagaca | 86 |
DSC3 | NM_001941.3 | cagaagcacctggagacgat | gagttgttggtagtttgggtca | 53 |
EMCN | NM_016242.3 NM_001159694.1 | gaactgcttcaagtgaccattct | aacaagtgaattattagctgcctct | 29 |
ERFE | NM_001291832.1 | ctgctcatctgcatccagtc | gatggtgaagagctcactgct | 80 |
LDB2 | NM_001290.3 NM_001130834.2 NM_001304434.1 NM_001304435.1 | gcctgaagacctgcttgttt | gttgttggttgccttgtgg | 53 |
OLFML2A | NM_182487.2 | acccccaccaccagtctc | ctcacagctcgcctctctg | 19 |
SPTLC3 | NM_018327.2 | gcagagcttggaaaaagattctc | cagatgcacgatggaacct | 22 |
ATP5F1B1 | NM_001686.3 | agaggtcccatcaaaaccaa | tcctgctcaacactcatttcc | 50 |
RPL13A1 | NM_012423.3 | caagcggatgaacaccaac | tgtggggcagcatacctc | 28 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Schubert, A.-K.; Smink, J.J.; Arp, M.; Ringe, J.; Hegewald, A.A.; Sittinger, M. Quality Assessment of Surgical Disc Samples Discriminates Human Annulus Fibrosus and Nucleus Pulposus on Tissue and Molecular Level. Int. J. Mol. Sci. 2018, 19, 1761. https://doi.org/10.3390/ijms19061761
Schubert A-K, Smink JJ, Arp M, Ringe J, Hegewald AA, Sittinger M. Quality Assessment of Surgical Disc Samples Discriminates Human Annulus Fibrosus and Nucleus Pulposus on Tissue and Molecular Level. International Journal of Molecular Sciences. 2018; 19(6):1761. https://doi.org/10.3390/ijms19061761
Chicago/Turabian StyleSchubert, Ann-Kathrin, Jeske J. Smink, Mirko Arp, Jochen Ringe, Aldemar A. Hegewald, and Michael Sittinger. 2018. "Quality Assessment of Surgical Disc Samples Discriminates Human Annulus Fibrosus and Nucleus Pulposus on Tissue and Molecular Level" International Journal of Molecular Sciences 19, no. 6: 1761. https://doi.org/10.3390/ijms19061761