Effects and Mechanism of Nano-Copper Exposure on Hepatic Cytochrome P450 Enzymes in Rats
Abstract
:1. Introduction
2. Results
2.1. Physiochemical Characterization of Nano- and Micro-Copper
2.2. Histopathological Changes
2.3. Inflammation
2.4. Oxidative Stress
2.5. Signaling Pathway
2.6. Nuclear Receptors
2.7. CYP450 mRNA Expression
2.8. Activity Analysis
3. Discussion
4. Materials and Methods
4.1. Test Chemicals and Preparation of Test Chemicals
4.2. Particle Characterization
4.3. Experimental Protocols and Dose Selection
4.4. Sample Collection
4.5. Histology
4.6. Measurements of Cytokines
4.7. Measurements of Oxidative Stress
4.8. Measurements of the Signaling Pathway
4.9. RNA Extraction and Determination of Gene Expression in Liver by Real-Time PCR
4.10. Measurements of CYP1A2, 2C11, 2D6, 2E1 and 3A1 Activity
4.11. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Conflicts of Interest
References
- Santini, C.; Pellei, M.; Gandin, V.; Porchia, M.; Tisato, F.; Marzano, C. Advances in copper complexes as anticancer agents. Chem. Rev. 2013, 114, 815–862. [Google Scholar] [CrossRef] [PubMed]
- Dobrovolný, K.; Ulbrich, P.; Švecová, M.; Rimpelová, S.; Malinčík, J.; Kohout, M.; Bartůněk, V. Copper nanoparticles in glycerol-polyvinyl alcohol matrix: In situ preparation, stabilisation and antimicrobial activity. J. Alloys Compd. 2017, 697, 147–155. [Google Scholar] [CrossRef]
- Ognik, K.; Sembratowicz, I.; Cholewińska, E.; Jankowski, J.; Kozłowski, K.; Juśkiewicz, J.; Zduńczyk, Z. The effect of administration of copper nanoparticles to chickens in their drinking water on the immune and antioxidant status of the blood. Anim. Sci. J. 2017, 89. [Google Scholar] [CrossRef] [PubMed]
- Liu, G.; Li, X.; Qin, B.; Xing, D.; Guo, Y.; Fan, R. Investigation of the mending effect and mechanism of copper nano-particles on a tribologically stressed surface. Tribol. Lett. 2004, 17, 961–966. [Google Scholar] [CrossRef]
- Cioffi, N.; Ditaranto, N.; Torsi, L.; Picca, R.A.; Sabbatini, L.; Valentini, A.; Zambonin, P.G. Analytical characterization of bioactive fluoropolymer ultra-thin coatings modified by copper nanoparticles. Anal. Bioanal. Chem. 2005, 381, 607–616. [Google Scholar] [CrossRef] [PubMed]
- Hoet, P.H.; Brüske-Hohlfeld, I.; Salata, O.V. Nanoparticles–known and unknown health risks. J. Nanobiotechnol. 2004, 2, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Oberdörster, G.; Oberdörster, E.; Oberdörster, J. Nanotoxicology: An emerging discipline evolving from studies of ultrafine particles. Environ. Health Perspect. 2005, 113, 823–839. [Google Scholar] [CrossRef] [PubMed]
- Gamboa, J.M.; Leong, K.W. In vitro and in vivo models for the study of oral delivery of nanoparticles. Adv. Drug Deliv. Rev. 2013, 65, 800–810. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Meng, H.; Chen, Z.; Xing, G.; Yuan, H.; Chen, C.; Zhao, F.; Zhao, Y. Ultrahigh reactivity provokes nanotoxicity: Explanation of oral toxicity of nano-copper particles. Toxicol. Lett. 2007, 175, 102–110. [Google Scholar] [CrossRef] [PubMed]
- Lee, I.C.; Ko, J.W.; Park, S.H.; Shin, N.R.; Shin, I.S.; Moon, C.; Kim, J.C. Comparative toxicity and biodistribution assessments in rats following subchronic oral exposure to copper nanoparticles and microparticles. Part. Fibre Toxicol. 2016, 13, 56. [Google Scholar] [CrossRef] [PubMed]
- Graf, C.; Nordmeyer, D.; Sengstock, C.; Ahlberg, S.; Diendorf, J.; Raabe, J.; Rancan, F. Shape-Dependent Dissolution and Cellular Uptake of Silver Nanoparticles. Langmuir 2018, 34, 1506–1519. [Google Scholar] [CrossRef] [PubMed]
- Prabhu, B.M.; Ali, S.F.; Murdock, R.C.; Hussain, S.M.; Srivatsan, M. Copper nanoparticles exert size and concentration dependent toxicity on somatosensory neurons of rat. Nanotoxicology 2010, 4, 150–160. [Google Scholar] [CrossRef] [PubMed]
- Moriwaki, H.; Osborne, M.R.; Phillips, D.H. Effects of mixing metal ions on oxidative DNA damage mediated by a Fenton-type reduction. Toxicol. In Vitro 2008, 22, 36–44. [Google Scholar] [CrossRef] [PubMed]
- Fahmy, B.; Cormier, S.A. Copper oxide nanoparticles induce oxidative stress and cytotoxicity in airway epithelial cells. Toxicol. In Vitro 2009, 23, 1365–1371. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Lei, R.; Wu, C.; Yang, B.; Ma, H.; Shi, C.; Wang, Q.; Liao, M. Integrated metabolomic analysis of the nano-sized copper particle-induced hepatotoxicity and nephrotoxicity in rats: A rapid in vivo screening method for nanotoxicity. Toxicol. Appl. Pharmacol. 2008, 232, 292–301. [Google Scholar] [CrossRef] [PubMed]
- Reuter, S.; Gupta, S.C.; Chaturvedi, M.M.; Aggarwal, B.B. Oxidative stress, inflammation, and cancer: How are they linked? Free Radic. Biol. Med. 2010, 49, 1603–1616. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Rahman, I.; MacNee, W. Oxidative stress and regulation of glutathione in lung inflammation. Eur. Respir. J. 2000, 16, 534–554. [Google Scholar] [CrossRef] [PubMed]
- Worthington, K.L.; Adamcakova-Dodd, A.; Wongrakpanich, A.; Mudunkotuwa, I.A.; Mapuskar, K.A.; Joshi, V.B.; Guymon, A.C.; Spitz, D.R.; Grassian, V.H.; Thorne, P.S.; et al. Chitosan coating of copper nanoparticles reduces in vitro toxicity and increases inflammation in the lung. Nanotechnology 2013, 24, 395101. [Google Scholar] [CrossRef] [PubMed]
- Braakhuis, H.M.; Gosens, I.; Krystek, P.; Boere, J.A.; Cassee, F.R.; Fokkens, P.H.; Park, M.V. Particle size dependent deposition and pulmonary inflammation after short-term inhalation of silver nanoparticles. Part. Fibre Toxicol. 2014, 11, 49. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Morgan, E.T. Regulation of cytochromes P450 during inflammation and infection. Drug Metab. Rev. 1997, 29, 1129–1188. [Google Scholar] [CrossRef] [PubMed]
- Siewert, E.; Bort, R.; Kluge, R.; Heinrich, P.C.; Castell, J.; Jover, R. Hepatic cytochrome P450 down-regulation during aseptic inflammation in the mouse is interleukin 6 dependent. Hepatology 2000, 32, 49–55. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Barouki, R.; Morel, Y. Repression of cytochrome P450 1A1 gene expression by oxidative stress: Mechanisms and biological implications. Biochem. Pharmacol. 2001, 61, 511–516. [Google Scholar] [CrossRef]
- Feng, Q.; Torii, Y.; Uchida, K.; Nakamura, Y.; Hara, Y.; Osawa, T. Black tea polyphenols, theaflavins, prevent cellular DNA damage by inhibiting oxidative stress and suppressing cytochrome P450 1A1 in cell cultures. J. Agric. Food Chem. 2002, 50, 213–220. [Google Scholar] [CrossRef] [PubMed]
- Genovese, S.; Epifano, F.; Curini, M.; Menger, D.; Zembruski, N.C.L.; Weiss, J. In vitro effects of natural prenyloxycinnamic acids on human cytochrome P450 isozyme activity and expression. Phytomedicine 2011, 18, 586–591. [Google Scholar] [CrossRef] [PubMed]
- Jeong, H.G. Inhibition of cytochrome P450 2E1 expression by oleanolic acid: Hepatoprotective effects against carbon tetrachloride-induced hepatic injury. Toxicol. Lett. 1999, 105, 215–222. [Google Scholar] [CrossRef]
- Goodwin, B.; Hodgson, E.; Liddle, C. The orphan human pregnane X receptor mediates the transcriptional activation of CYP3A4 by rifampicin through a distal enhancer module. Mol. Pharmacol. 1999, 56, 1329–1339. [Google Scholar] [CrossRef] [PubMed]
- Martignoni, M.; Groothuis, G.M.; de Kanter, R. Species differences between mouse, rat, dog, monkey and human CYP-mediated drug metabolism, inhibition and induction. Expert Opin. Drug Metab. Toxicol. 2006, 2, 875–894. [Google Scholar] [CrossRef] [PubMed]
- Obach, R.S.; Walsky, R.L.; Venkatakrishnan, K.; Gaman, E.A.; Houston, J.B.; Tremaine, L.M. The utility of in vitro cytochrome P450 inhibition data in the prediction of drug-drug interactions. J. Pharmacol. Exp. Ther. 2006, 316, 336–348. [Google Scholar] [CrossRef] [PubMed]
- Srinivas, M.; Thirumaleswara, G.; Pratima, S. Cytochrome p450 Enzymes, Drug Transporters and their role in Pharmacokinetic Drug-Drug interactions of Xenobiotics: A Comprehensive Review. Peertechz J. Med. Chem. Res. 2017, 3, 1–11. [Google Scholar] [CrossRef]
- Guengerich, F.P. Intersection of the roles of cytochrome P450 enzymes with xenobiotic and endogenous substrates: Relevance to toxicity and drug interactions. Chem. Res. Toxicol. 2016, 30, 2–12. [Google Scholar] [CrossRef] [PubMed]
- Rashidi, L.; Khosravi-Darani, K. The applications of nanotechnology in food industry. Crit. Rev. Food Sci. Nutr. 2011, 51, 723–730. [Google Scholar] [CrossRef] [PubMed]
- Chun, A.L. Will the public swallow nanofood? Nat. Nanotechnol. 2009, 4, 790–791. [Google Scholar] [CrossRef] [PubMed]
- Karuppath, S.; Pillai, P.; Nair, S.V.; Lakshmanan, V.K. Comparison and Existence of Nanotechnology in Traditional Alternative Medicine: An Onset to Future Medicine. Nanosci. Nanotechnol.-Asia 2018, 8, 13–25. [Google Scholar] [CrossRef]
- Sahoo, S.K.; Labhasetwar, V. Nanotech approaches to drug delivery and imaging. Drug Discov. Today 2003, 8, 1112–1120. [Google Scholar] [CrossRef]
- Wilkinson, J.M. Nanotechnology applications in medicine. Med. Device Technol. 2003, 14, 29–31. [Google Scholar] [PubMed]
- Bertinato, J.; L’Abbé, M.R. Maintaining copper homeostasis: Regulation of copper-trafficking proteins in response to copper deficiency or overload. J. Nutr. Biochem. 2004, 15, 316–322. [Google Scholar] [CrossRef] [PubMed]
- Zietz, B.P.; Dieter, H.H.; Lakomek, M.; Schneider, H.; Keßler-Gaedtke, B.; Dunkelberg, H. Epidemiological investigation on chronic copper toxicity to children exposed via the public drinking water supply. Sci. Total Environ. 2003, 302, 127–144. [Google Scholar] [CrossRef]
- Zhang, X.D.; Wu, H.Y.; Wu, D.; Wang, Y.Y.; Chang, J.H.; Zhai, Z.B.; Meng, A.M.; Liu, P.X.; Zhang, L.A.; Fan, F.Y. Toxicologic effects of gold nanoparticles in vivo by different administration routes. Int. J. Nanomed. 2010, 5, 771–781. [Google Scholar] [CrossRef] [PubMed]
- Lee, I.C.; Ko, J.W.; Park, S.H.; Lim, J.O.; Shin, I.S.; Moon, C.; Kim, S.H.; Heo, J.D.; Kim, J.C. Comparative toxicity and biodistribution of copper nanoparticles and cupric ions in rats. Int. J. Nanomed. 2016, 11, 2883–2900. [Google Scholar] [CrossRef]
- Zhu, M.; Nie, G.; Meng, H.; Xia, T.; Nel, A.; Zhao, Y. Physicochemical properties determine nanomaterial cellular uptake, transport, and fate. Acc. Chem. Res. 2012, 46, 622–631. [Google Scholar] [CrossRef] [PubMed]
- De Berardis, B.; Civitelli, G.; Condello, M.; Lista, P.; Pozzi, R.; Arancia, G.; Meschini, S. Exposure to ZnO nanoparticles induces oxidative stress and cytotoxicity in human colon carcinoma cells. Toxicol. Appl. Pharmacol. 2010, 246, 116–127. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.; Liu, C.; Yang, D.; Zhang, H.; Xi, Z. Comparative study of cytotoxicity, oxidative stress and genotoxicity induced by four typical nanomaterials: The role of particle size, shape and composition. J. Appl. Toxicol. 2009, 29, 69–78. [Google Scholar] [CrossRef] [PubMed]
- Nel, A.; Xia, T.; Mädler, L.; Li, N. Toxic potential of materials at the nanolevel. Science 2006, 311, 622–627. [Google Scholar] [CrossRef] [PubMed]
- Manke, A.; Wang, L.; Rojanasakul, Y. Mechanisms of nanoparticle-induced oxidative stress and toxicity. BioMed Res. Int. 2013, 2013, 942916. [Google Scholar] [CrossRef] [PubMed]
- Chang, Y.N.; Zhang, M.; Xia, L.; Zhang, J.; Xing, G. The toxic effects and mechanisms of CuO and ZnO nanoparticles. Materials 2012, 5, 2850–2871. [Google Scholar] [CrossRef]
- Guo, Y.; Hu, B.; Xie, Y.; Billiar, T.R.; Sperry, J.L.; Huang, M.; Xie, W. Regulation of drug-metabolizing enzymes by local and systemic liver injuries. Expert Opin. Drug Metab. Toxicol. 2016, 12, 245–251. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Zanger, U.M.; Klein, K.; Thomas, M.; Rieger, J.K.; Tremmel, R.; Kandel, B.A.; Magdy, T. Genetics, Epigenetics, and Regulation of Drug-Metabolizing Cytochrome P450 Enzymes. Clin. Pharmacol. Ther. 2014, 95, 258–261. [Google Scholar] [CrossRef] [PubMed]
- Köhler, G.I.; Bode-Böger, S.M.; Busse, R.; Hoopmann, M.; Welte, T.; Böger, R.H. Drug-drug interactions in medical patients: Effects of in-hospital treatment and relation to multiple drug use. Int. J. Clin. Pharmacol. Ther. 2000, 38, 504–513. [Google Scholar] [CrossRef] [PubMed]
- Hohl, C.M.; Dankoff, J.; Colacone, A.; Afilalo, M. Polypharmacy, adverse drug-related events, and potential adverse drug interactions in elderly patients presenting to an emergency department. Ann. Emerg. Med. 2001, 38, 666–671. [Google Scholar] [CrossRef] [PubMed]
- Müller, F.; Fromm, M.F. Transporter-mediated drug–drug interactions. Pharmacogenomics 2011, 12, 1017–1037. [Google Scholar] [CrossRef] [PubMed]
- Pirmohamed, M.; Park, B.K. Cytochrome P450 enzyme polymorphisms and adverse drug reactions. Toxicology 2003, 192, 23–32. [Google Scholar] [CrossRef]
- Haarmann-Stemmann, T.; Bothe, H.; Abel, J. Growth factors, cytokines and their receptors as downstream targets of arylhydrocarbon receptor (AHR) signaling pathways. Biochem. Pharmacol. 2009, 77, 508–520. [Google Scholar] [CrossRef] [PubMed]
- Wang, Y.M.; Ong, S.S.; Chai, S.C.; Chen, T. Role of CAR and PXR in xenobiotic sensing and metabolism. Expert Opin. Drug Metab. Toxicol. 2012, 8, 803–817. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Xie, W.; Barwick, J.L.; Simon, C.M.; Pierce, A.M.; Safe, S.; Blumberg, B.; Evans, R.M. Reciprocal activation of xenobiotic response genes by nuclear receptors SXR/PXR and CAR. Genes Dev. 2000, 14, 3014–3023. [Google Scholar] [CrossRef] [PubMed]
- Kakizaki, S.; Yamamoto, Y.; Ueda, A.; Moore, R.; Sueyoshi, T.; Negishi, M. Phenobarbital induction of drug/steroid-metabolizing enzymes and nuclear receptor CAR. Biochim. Biophys. Acta (BBA)-Gen. Subj. 2003, 1619, 239–242. [Google Scholar] [CrossRef]
- Faucette, S.R.; Zhang, T.C.; Moore, R.; Sueyoshi, T.; Omiecinski, C.J.; LeCluyse, E.L.; Negishi, M.; Wang, H. Relative activation of human pregnane X receptor versus constitutive androstane receptor defines distinct classes of CYP2B6 and CYP3A4 inducers. J. Pharmacol. Exp Ther. 2007, 320, 72–80. [Google Scholar] [CrossRef] [PubMed]
- Ma, Q. Induction of CYP1A1. The AHR/DRE paradigm transcription, receptor regulation, and expanding biological roles. Curr. Drug Metab. 2001, 2, 149–164. [Google Scholar] [CrossRef] [PubMed]
- Morgan, E.T. Regulation of cytochrome p450 by inflammatory mediators: Why and how? Drug Metab. Dispos. 2001, 29, 207–212. [Google Scholar] [PubMed]
- Kakehashi, A.; Hagiwara, A.; Imai, N.; Nagano, K.; Nishimaki, F.; Banton, M.; Wanibuchi, H. Mode of action of ethyl tertiary-butyl ether hepatotumorigenicity in the rat: Evidence for a role of oxidative stress via activation of CAR, PXR and PPAR signaling pathways. Toxicol. Appl. Pharmacol. 2013, 273, 390–400. [Google Scholar] [CrossRef] [PubMed]
- Manna, P.; Ghosh, M.; Ghosh, J.; Das, J.; Sil, P.C. Contribution of nano-copper particles to in vivo liver dysfunction and cellular damage: Role of IκBα/NF-κB, MAPKs and mitochondrial signal. Nanotoxicology 2012, 6, 1–21. [Google Scholar] [CrossRef] [PubMed]
- Liao, M.; Liu, H. Gene expression profiling of nephrotoxicity from copper nanoparticles in rats after repeated oral administration. Environ. Toxicol. Pharmacol. 2012, 34, 67–80. [Google Scholar] [CrossRef] [PubMed]
- Mallick, P.; Taneja, G.; Moorthy, B.; Ghose, R. Regulation of drug-metabolizing enzymes in infectious and inflammatory disease: Implications for biologics–small molecule drug interactions. Expert Opin. Drug Metab. Toxicol. 2017, 13, 605–616. [Google Scholar] [CrossRef] [PubMed]
- Zordoky, B.N.; El-Kadi, A.O. Role of NF-κB in the regulation of cytochrome P450 enzymes. Curr. Drug Metab. 2009, 10, 164–178. [Google Scholar] [CrossRef] [PubMed]
- Ghosh, M.; Pal, S.; Sil, P.C. Taurine attenuates nano-copper-induced oxidative hepatic damage via mitochondria-dependent and NF-κB/TNF-α-mediated pathway. Toxicol. Res. 2014, 3, 474–486. [Google Scholar] [CrossRef]
- Lei, R.; Yang, B.; Wu, C.; Liao, M.; Ding, R.; Wang, Q. Mitochondrial dysfunction and oxidative damage in the liver and kidney of rats following exposure to copper nanoparticles for five consecutive days. Toxicol. Res. 2015, 4, 351–364. [Google Scholar] [CrossRef]
- Chen, Z.; Meng, H.; Xing, G.; Chen, C.; Zhao, Y.; Jia, G.; Chai, Z. Acute toxicological effects of copper nanoparticles in vivo. Toxicol. Lett. 2006, 163, 109–120. [Google Scholar] [CrossRef] [PubMed]
- Achour, B.; Al Feteisi, H.; Lanucara, F.; Rostami-Hodjegan, A.; Barber, J. Global proteomic analysis of human liver microsomes: Rapid characterization and quantification of hepatic drug-metabolizing enzymes. Drug Metab. Dispos. 2017, 45, 666–675. [Google Scholar] [CrossRef] [PubMed]
- Meyer, U.; Nyffeler, M.; Engler, A.; Urwyler, A.; Schedlowski, M.; Knuesel, I.; Tee, B.K.; Feldon, J. The time of prenatal immune challenge determines the specificity of inflammation-mediated brain and behavioral pathology. J. Neurosci. 2006, 26, 4752–4762. [Google Scholar] [CrossRef] [PubMed]
- Chantratita, N.; Tandhavanant, S.; Myers, N.D.; Seal, S.; Arayawichanont, A.; Kliangsa-ad, A.; Hittle, L.E.; Ernst, R.K.; Emond, M.J.; Werfel, M.M.; et al. Survey of innate immune responses to Burkholderia pseudomallei in human blood identifies a central role for lipopolysaccharide. PLoS ONE 2013, 8, e81617. [Google Scholar] [CrossRef] [PubMed]
- Brewer, C.T.; Chen, T. Hepatotoxicity of Herbal Supplements Mediated by Modulation of Cytochrome P450. Int. J. Mol. Sci. 2017, 18, 2353. [Google Scholar] [CrossRef] [PubMed]
- Peng, Y.; Wu, H.; Zhang, X.; Zhang, F.; Qi, H.; Zhong, Y.; Wang, Y.; Sang, H.; Wang, G.; Sun, J. A comprehensive assay for nine major cytochrome P450 enzymes activities with 16 probe reactions on human liver microsomes by a single LC/MS/MS run to support reliable in vitro inhibitory drug–drug interaction evaluation. Xenobiotica 2015, 45, 961–977. [Google Scholar] [CrossRef] [PubMed]
- Rao, M.N.; Biju, B.; Ansar, A.K.; Mujeeb, S.; Ramesh, M.; Srinivas, N.R. ‘Open access’ generic method for continuous determination of major human CYP450 probe substrates/metabolites and its application in drug metabolism studies. Xenobiotica 2003, 33, 1233–1245. [Google Scholar] [CrossRef] [PubMed]
Target | Sequences of Primers (5′ to 3′) | Base Number |
---|---|---|
CYP1A2 F | GGTGGAATCGGTGGCTAAT | 19 |
CYP1A2 R | AGTCCTTGCTGCTCTTCACG | 20 |
CYP2C11 F | AATCCGCAGTCTGAGTTTACCC | 22 |
CYP2C11 R | GGTTTCTGCCAATTACACGTTCT | 23 |
CYP2D6 F | AGCTTCAACACCGCTATGGT | 20 |
CYP2D6 R | CAGCAGTGTCCTCTCCATGA | 20 |
CYP2E1 F | CCTTTCCCTCTTCCCATCC | 19 |
CYP2E1 R | AACCTCCGCACATCCTTCC | 19 |
CYP3A1 F | TGCCATCACGGACACAGA | 18 |
CYP3A1 R | ATCTCTTCCACTCCTCATCCTTAG | 24 |
PXR F | GACGGCAGCATCTGGAACTAC | 21 |
PXR R | TGATGACGCCCTTGAACATG | 20 |
CAR F | CCACGGGCTATCATTTCCAT | 20 |
CAR R | CCCAGCAAACGGACAGATG | 19 |
AHR F | TGGACAAACTCTCCGTTCTAAGG | 23 |
AHR R | GATTTTAATGCAACATCAAAGAAGCT | 26 |
GAPDH F | GATGGTGAAGGTCGGTGTG | 19 |
GAPDH R | ATGAAGGGGTCGTTGATGG | 19 |
Analytes | Regression Equation | Correlation Coefficient (R2) | Linear Range (ng/mL) | LLOQ (ng/mL) |
---|---|---|---|---|
Phenacetin | y = 166.9x + 1.3728 | 0.9995 | 200–1400 | 50 |
Tolbutamide | y = 176.97x + 0.6415 | 0.9996 | 200–1400 | 50 |
dextromethorphan | y = 128.91x + 1.3531 | 0.9999 | 200–1400 | 50 |
chlorzoxazone | y = 110.85x + 4.8935 | 0.9999 | 200–1400 | 50 |
Testosterone | y = 212.16x + 49.721 | 0.9994 | 800–11,200 | 100 |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Tang, H.; Xu, M.; Shi, F.; Ye, G.; Lv, C.; Luo, J.; Zhao, L.; Li, Y. Effects and Mechanism of Nano-Copper Exposure on Hepatic Cytochrome P450 Enzymes in Rats. Int. J. Mol. Sci. 2018, 19, 2140. https://doi.org/10.3390/ijms19072140
Tang H, Xu M, Shi F, Ye G, Lv C, Luo J, Zhao L, Li Y. Effects and Mechanism of Nano-Copper Exposure on Hepatic Cytochrome P450 Enzymes in Rats. International Journal of Molecular Sciences. 2018; 19(7):2140. https://doi.org/10.3390/ijms19072140
Chicago/Turabian StyleTang, Huaqiao, Min Xu, Fei Shi, Gang Ye, Cheng Lv, Jie Luo, Ling Zhao, and Yinglun Li. 2018. "Effects and Mechanism of Nano-Copper Exposure on Hepatic Cytochrome P450 Enzymes in Rats" International Journal of Molecular Sciences 19, no. 7: 2140. https://doi.org/10.3390/ijms19072140