Oxidative Stress-Protective and Anti-Melanogenic Effects of Loliolide and Ethanol Extract from Fresh Water Green Algae, Prasiola japonica
Abstract
:1. Introduction
2. Results
2.1. Antioxidant Effect of Loliolide
2.2. Anti-Melanogenic Effect of Loliolide
2.3. Antioxidant and Anti-Melanogenesis Effect of Pj-EE
3. Discussion
4. Materials and Methods
4.1. Materials
4.2. Cell Culture and Drug Treatment
4.3. ABTS Assay
4.4. MTT Assay
4.5. Extraction of Pj-EE
4.6. RT-PCR and Real-Time-PCR Assay
4.7. Western Blotting Analysis
4.8. Melanin Contents and Secretion Analysis
4.9. Preliminary Human Skin Irritation Patch Test
4.10. Statistical Analysis
Author Contributions
Funding
Conflicts of Interest
Abbreviations
Pj-EE | P. japonica ethanol extract |
MMPs | Matrix metalloproteinases |
NRF2 | Nuclear factor (erythroid-derived 2)-like 2 |
HO-1 | Heme oxygenase-1 |
MITF | Microphthalmia-associated transcription factor |
α-MSH | α-melanocyte-stimulating hormone |
ROS | Reactive oxygen species |
UV | Ultraviolet |
PI3K | Phosphatidylinositol-4,5-bisphosphate 3-kinase |
AKT | Protein kinase B |
MC1R | Melanocortin 1 receptor |
CREB | cAMP response element-binding protein |
RT-PCR | Reverse transcription-polymerase chain reaction |
MTT | 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide |
ABTS | 2,2′-Azino-bis (3-ethylbenzothiazoline-6-sulphonic acid) diammonium salt |
References
- Bouwstra, J.A.; Ponec, M. The skin barrier in healthy and diseased state. Biochim. Biophys. Acta Biomembr. 2006, 1758, 2080–2095. [Google Scholar] [CrossRef] [PubMed]
- Brenneisen, P.; Briviba, K.; Wlaschek, M.; Wenk, J.; Scharffetter-Kochanek, K. Hydrogen peroxide (H2O2) increases the steady-state mRNA levels of collagenase/MMP-1 in human dermal fibroblasts. Free Radic. Biol. Med. 1997, 22, 515–524. [Google Scholar] [CrossRef]
- Hong, Y.H.; Kim, D.; Nam, G.; Yoo, S.; Han, S.Y.; Jeong, S.G.; Kim, E.; Jeong, D.; Yoon, K.; Kim, S.; et al. Photoaging protective effects of BIOGF1K, a compound-K-rich fraction prepared from Panax ginseng. J. Ginseng Res. 2018, 42, 81–89. [Google Scholar] [CrossRef] [PubMed]
- Hong, Y.H.; Lee, H.S.; Jung, E.Y.; Han, S.H.; Park, Y.; Suh, H.J. Photoprotective effects of topical ginseng leaf extract using Ultraflo L against UVB-induced skin damage in hairless mice. J. Ginseng Res. 2017, 41, 456–462. [Google Scholar] [CrossRef] [PubMed]
- Boespflug, A.; Caramel, J.; Dalle, S.; Thomas, L. Treatment of NRAS-mutated advanced or metastatic melanoma: Rationale, current trials and evidence to date. Ther. Adv. Med. Oncol. 2017, 9, 481–492. [Google Scholar] [CrossRef] [PubMed]
- Curry, J.L.; Pinto, W.; Nickoloff, B.J.; Slominski, A.T. Human keratinocytes express functional α-MSH (MC1-R) receptors. In Vitro Cell. Dev. Biol. Anim. 2001, 37, 234–236. [Google Scholar] [CrossRef]
- Balogun, E.; Hoque, M.; Pengfei, G.; Killeen, E.; Green, C.J.; Foresti, R.; Jawed, A.; Motterlini, R. Curcumin activates the haem oxygenase-1 gene via regulation of Nrf2 and the antioxidant-responsive element. Biochem. J. 2003, 371, 887–895. [Google Scholar] [CrossRef] [PubMed]
- Deng, X.; Rui, W.; Zhang, F.; Ding, W. PM 2.5 induces Nrf2-mediated defense mechanisms against oxidative stress by activating PIK3/AKT signaling pathway in human lung alveolar epithelial A549 cells. Cell Biol. Toxicol. 2013, 29, 143–157. [Google Scholar] [CrossRef] [PubMed]
- Suzuki, I.; Cone, R.D.; Im, S.; Nordlund, J.; Abdel-Malek, Z.A. Binding of melanotropic hormones to the melanocortin receptor MC1R on human melanocytes stimulates proliferation and melanogenesis. Endocrinology 1996, 137, 1627–1633. [Google Scholar] [CrossRef] [PubMed]
- Hsiao, J.J.; Fisher, D.E. The roles of microphthalmia-associated transcription factor and pigmentation in melanoma. Arch. Biochem. Biophys. 2014, 563, 28–34. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Chae, J.K.; Subedi, L.; Jeong, M.; Park, Y.U.; Kim, C.Y.; Kim, H.; Kim, S.Y. Gomisin N Inhibits melanogenesis through regulating the PI3K/AKT and MAPK/ERK signaling pathways in melanocytes. Int. J. Mol. Sci. 2017, 18, 471. [Google Scholar] [CrossRef] [PubMed]
- Lee, D.Y.; Lee, J.; Jeong, Y.T.; Byun, G.H.; Kim, J.H. Melanogenesis inhibition activity of floralginsenoside A from Panax ginseng berry. J. Ginseng Res. 2017, 41, 602–607. [Google Scholar] [CrossRef] [PubMed]
- Saini, D.K.; Pabbi, S.; Shukla, P. Cyanobacterial pigments: Perspectives and biotechnological approaches. Food Chem. Toxicol. 2018, 120, 616–624. [Google Scholar] [CrossRef] [PubMed]
- Chalamaiah, M.; Yu, W.; Wu, J. Immunomodulatory and anticancer protein hydrolysates (peptides) from food proteins: A review. Food Chem. 2018, 245, 205–222. [Google Scholar] [CrossRef] [PubMed]
- Akoto, L.; Stellaard, F.; Irth, H.; Vreuls, R.J.; Pel, R. Improved fatty acid detection in micro-algae and aquatic meiofauna species using a direct thermal desorption interface combined with comprehensive gas chromatography-time-of-flight mass spectrometry. J. Chromatogr. A 2008, 1186, 254–261. [Google Scholar] [CrossRef] [PubMed]
- Sun, Y.Y.; Wang, H.; Guo, G.L.; Pu, Y.F.; Yan, B.L.; Wang, C.H. Isolation, purification, and identification of antialgal substances in green alga Ulva prolifera for antialgal activity against the common harmful red tide microalgae. Environ. Sci. Pollut. Res. Int. 2016, 23, 1449–1459. [Google Scholar] [CrossRef] [PubMed]
- Yang, H.H.; Hwangbo, K.; Zheng, M.S.; Cho, J.H.; Son, J.K.; Kim, H.Y.; Baek, S.H.; Choi, H.C.; Park, S.Y.; Kim, J.R. Inhibitory effects of (−)-loliolide on cellular senescence in human dermal fibroblasts. Arch. Pharm. Res. 2015, 38, 876–884. [Google Scholar] [CrossRef] [PubMed]
- Chung, C.Y.; Liu, C.H.; Burnouf, T.; Wang, G.H.; Chang, S.P.; Jassey, A.; Tai, C.J.; Huang, C.J.; Richardson, C.D.; Yen, M.H.; et al. Activity-based and fraction-guided analysis of Phyllanthus urinaria identifies loliolide as a potent inhibitor of hepatitis C virus entry. Antivir. Res. 2016, 130, 58–68. [Google Scholar] [CrossRef] [PubMed]
- Cheng, S.Y.; Huang, K.J.; Wang, S.K.; Wen, Z.H.; Chen, P.W.; Duh, C.Y. Antiviral and anti-inflammatory metabolites from the soft coral Sinularia capillosa. J. Nat. Prod. 2010, 73, 771–775. [Google Scholar] [CrossRef] [PubMed]
- Seo, D.W.; Kim, H.J.; Jang, S.K.; Jun, M.; Joo, S.S. Screening of functional components derived from fresh water laver, Prasiola japonica, and its pharmacological properties. J. Biomed. Res. 2013, 14, 83–90. [Google Scholar] [CrossRef]
- Lobner, D. Comparison of the LDH and MTT assays for quantifying cell death: Validity for neuronal apoptosis? J. Neurosci. Methods 2000, 96, 147–152. [Google Scholar] [CrossRef]
- Rittié, L.; Fisher, G.J. UV-light-induced signal cascades and skin aging. Ageing Res. Rev. 2002, 1, 705–720. [Google Scholar] [CrossRef]
- Lim, Y.-J.; Lee, E.H.; Kang, T.H.; Ha, S.K.; Oh, M.S.; Kim, S.M.; Yoon, T.-J.; Kang, C.; Park, J.-H.; Kim, S.Y. Inhibitory effects of arbutin on melanin biosynthesis of α-melanocyte stimulating hormone-induced hyperpigmentation in cultured brownish guinea pig skin tissues. Arch. Pharm. Res. 2009, 32, 367–373. [Google Scholar] [CrossRef] [PubMed]
- Oh, M.-J.; Hamid, M.A.; Ngadiran, S.; Seo, Y.-K.; Sarmidi, M.R.; Park, C.S. Ficus deltoidea (Mas cotek) extract exerted anti-melanogenic activity by preventing tyrosinase activity in vitro and by suppressing tyrosinase gene expression in B16F1 melanoma cells. Arch. Dermatol. Res. 2011, 303, 161–170. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ando, H.; Funasaka, Y.; Oka, M.; Ohashi, A.; Furumura, M.; Matsunaga, J.; Matsunaga, N.; Hearing, V.J.; Ichihashi, M. Possible involvement of proteolytic degradation of tyrosinase in the regulatory effect of fatty acids on melanogenesis. J. Lipid Res. 1999, 40, 1312–1316. [Google Scholar] [PubMed]
- Thaipong, K.; Boonprakob, U.; Crosby, K.; Cisneros-Zevallos, L.; Byrne, D.H. Comparison of ABTS, DPPH, FRAP, and ORAC assays for estimating antioxidant activity from guava fruit extracts. J. Food Compos. Anal. 2006, 19, 669–675. [Google Scholar] [CrossRef]
- Li, X.; Wang, X.; Chen, D.; Chen, S. Antioxidant activity and mechanism of protocatechuic acid in vitro. Funct. Foods Health Dis. 2011, 1, 232–244. [Google Scholar]
- Masaki, H. Role of antioxidants in the skin: Anti-aging effects. J. Dermatol. Sci. 2010, 58, 85–90. [Google Scholar] [CrossRef] [PubMed]
- Suttner, D.M.; Dennery, P.A. Reversal of HO-1 related cytoprotection with increased expression is due to reactive iron. FASEB J. 1999, 13, 1800–1809. [Google Scholar] [CrossRef] [PubMed]
- Chakraborty, A.K.; Funasaka, Y.; Komoto, M.; Ichihashi, M. Effect of arbutin on melanogenic proteins in human melanocytes. Pigm. Cell Res. 1998, 11, 206–212. [Google Scholar] [CrossRef]
- Schwahn, D.J.; Xu, W.; Herrin, A.B.; Bales, E.S.; Medrano, E.E. Tyrosine levels regulate the melanogenic response to α-melanocyte-stimulating hormone in human melanocytes: Implications for pigmentation and proliferation. Pigm. Cell Res. 2001, 14, 32–39. [Google Scholar] [CrossRef]
- Yang, C.; Zhang, X.; Fan, H.; Liu, Y. Curcumin upregulates transcription factor Nrf2, HO-1 expression and protects rat brains against focal ischemia. Brain Res. 2009, 1282, 133–141. [Google Scholar] [CrossRef] [PubMed]
- Motohashi, H.; Yamamoto, M. Nrf2–Keap1 defines a physiologically important stress response mechanism. Trends Mol. Med. 2004, 10, 549–557. [Google Scholar] [CrossRef] [PubMed]
- Hwang, E.; Park, S.Y.; Yin, C.S.; Kim, H.T.; Kim, Y.M.; Yi, T.H. Antiaging effects of the mixture of Panax ginseng and Crataegus pinnatifida in human dermal fibroblasts and healthy human skin. J. Ginseng Res. 2017 41, 69–77. [CrossRef]
- Buttke, T.M.; Sandstrom, P.A. Oxidative stress as a mediator of apoptosis. Immunol. Today 1994, 15, 7–10. [Google Scholar] [CrossRef]
- Kaspar, J.W.; Niture, S.K.; Jaiswal, A.K. Nrf2: INrf2 (Keap1) signaling in oxidative stress. Free Radic. Biol. Med. 2009, 47, 1304–1309. [Google Scholar] [CrossRef] [PubMed]
- Solomon, S.; Burkholder, J.B.; Ravishankara, A.; Garcia, R.R. Ozone depletion and global warming potentials of CF3I. J. Geophys. Res. Atmos. 1994, 99, 20929–20935. [Google Scholar] [CrossRef]
- De Gruijl, F. Skin cancer and solar UV radiation. Eur. J. Cancer 1999, 35, 2003–2009. [Google Scholar] [CrossRef]
- D’Mello, S.A.; Finlay, G.J.; Baguley, B.C.; Askarian-Amiri, M.E. Signaling pathways in melanogenesis. Int. J. Mol. Sci. 2016, 17, 1144. [Google Scholar] [CrossRef] [PubMed]
- Tsao, Y.T.; Kuo, C.Y.; Kuan, Y.D.; Lin, H.C.; Wu, L.H.; Lee, C.H. The extracts of Astragalus membranaceus inhibit melanogenesis through the ERK signaling pathway. Int. J. Med. Sci. 2017, 14, 1049–1053. [Google Scholar] [CrossRef] [PubMed]
- Wynn, T.A.; Chawla, A.; Pollard, J.W. Macrophage biology in development, homeostasis and disease. Nature 2013, 496, 445. [Google Scholar] [CrossRef] [PubMed]
- Foyer, C.H.; Noctor, G. Redox homeostasis and antioxidant signaling: A metabolic interface between stress perception and physiological responses. Plant Cell 2005, 17, 1866–1875. [Google Scholar] [CrossRef] [PubMed]
- Borek, C. Antioxidant health effects of aged garlic extract. J. Nutr. 2001, 131, 1010S–1015S. [Google Scholar] [CrossRef] [PubMed]
- Re, R.; Pellegrini, N.; Proteggente, A.; Pannala, A.; Yang, M.; Rice-Evans, C. Antioxidant activity applying an improved ABTS radical cation decolorization assay. Free Radic. Biol. Med. 1999, 26, 1231–1237. [Google Scholar] [CrossRef]
- Van Meerloo, J.; Kaspers, G.J.; Cloos, J. Cell Sensitivity Assays: The MTT Assay, Cancer Cell Culture; Springer: Berlin, Germany, 2011; pp. 237–245. [Google Scholar]
- Vance, E.D.; Brookes, P.C.; Jenkinson, D.S. An extraction method for measuring soil microbial biomass C. Soil Biol. Biochem. 1987, 19, 703–707. [Google Scholar] [CrossRef]
- Pfaffl, M.W. A new mathematical model for relative quantification in real-time RT–PCR. Nucleic Acids Res. 2001, 29, e45. [Google Scholar] [CrossRef] [PubMed]
- Varkonyi-Gasic, E.; Wu, R.; Wood, M.; Walton, E.F.; Hellens, R.P. Protocol: A highly sensitive RT-PCR method for detection and quantification of microRNAs. Plant Methods 2007, 3, 12. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Ye, J.; Coulouris, G.; Zaretskaya, I.; Cutcutache, I.; Rozen, S.; Madden, T.L. Primer-BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC Bioinform. 2012, 13, 134. [Google Scholar] [CrossRef] [PubMed]
- Mahmood, T.; Yang, P.-C. Western blot: Technique, theory, and trouble shooting. N. Am. J. Med. Sci. 2012, 4, 429. [Google Scholar] [PubMed]
- Kurien, B.T.; Scofield, R.H. Western blotting. Methods 2006, 38, 283–293. [Google Scholar] [CrossRef] [PubMed]
- Zor, T.; Selinger, Z. Linearization of the Bradford protein assay increases its sensitivity: Theoretical and experimental studies. Anal. Biochem. 1996, 236, 302–308. [Google Scholar] [CrossRef] [PubMed]
- Abe, H.; Ohya, N.; Yamamoto, K.F.; Shibuya, T.; Arichi, S.; Odashima, S. Effects of glycyrrhizin and glycyrrhetinic acid on growth and melanogenesis in cultured B16 melanoma cells. Eur. J. Cancer Clin. Oncol. 1987, 23, 1549–1553. [Google Scholar] [CrossRef]
Name | Sequence (5′ to 3′) | |
---|---|---|
MMP-1 | F | TGTGGTGTCTCACAGCTTCC |
R | TTGTCCCGATGATCTCCCCT | |
MMP-2 | F | AAAACGGACAAAGAGTTGGCA |
R | CTGGGGCAGTCCAAAGAACT | |
MMP-3 | F | TGTTAGGAGAAAGGACAGTGGTC |
R | CGTCACCTCCAATCCAAGGAA | |
MMP-9 | F | ACGATGACGAGTTGTGGTCC |
R | TCGCTGGTACAGGTCGAGTA | |
HO-1 | F | ACTTCCCAGAAGAGCTGCAC |
R | GCTTGAACTTGGTGGCACTG | |
GAPDH | F | CACCATCTTCCAGGAGCGAG |
R | CTCAGTGTAGCCCAGGATGC |
© 2018 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Park, S.H.; Choi, E.; Kim, S.; Kim, D.S.; Kim, J.H.; Chang, S.; Choi, J.S.; Park, K.J.; Roh, K.-B.; Lee, J.; et al. Oxidative Stress-Protective and Anti-Melanogenic Effects of Loliolide and Ethanol Extract from Fresh Water Green Algae, Prasiola japonica. Int. J. Mol. Sci. 2018, 19, 2825. https://doi.org/10.3390/ijms19092825
Park SH, Choi E, Kim S, Kim DS, Kim JH, Chang S, Choi JS, Park KJ, Roh K-B, Lee J, et al. Oxidative Stress-Protective and Anti-Melanogenic Effects of Loliolide and Ethanol Extract from Fresh Water Green Algae, Prasiola japonica. International Journal of Molecular Sciences. 2018; 19(9):2825. https://doi.org/10.3390/ijms19092825
Chicago/Turabian StylePark, Sang Hee, Eunju Choi, Sunggyu Kim, Dong Sam Kim, Ji Hyeon Kim, SeokGu Chang, Jae Seok Choi, Kyung Ja Park, Kyung-Baeg Roh, Jongsung Lee, and et al. 2018. "Oxidative Stress-Protective and Anti-Melanogenic Effects of Loliolide and Ethanol Extract from Fresh Water Green Algae, Prasiola japonica" International Journal of Molecular Sciences 19, no. 9: 2825. https://doi.org/10.3390/ijms19092825