Efficient Epidermal Growth Factor Receptor Targeting Oligonucleotide as a Potential Molecule for Targeted Cancer Therapy
Abstract
:1. Introduction
2. Results and Discussion
2.1. Truncation and Chemical Modification of EGFR Aptamer
2.2. CL-4RNV616 Specifically Recognized Recombinant EGFR Protein with Enhanced Serum Stability
2.3. CL-4RNV616 Aptamer Specifically Recognized EGFR Protein in Human Cancer Cells
2.4. CL-4RNV616 Aptamer Initiated Strong Cytotoxicity in EGFR Positive Cancer Cells
2.5. CL-4RNV616 Aptamer Was Eligible for Clinical Cancer Diagnosis
3. Materials and Methods
3.1. Buffers and Sequence Information
3.2. Truncation of Aptamer
3.3. Cell Culture
3.4. ELONA Assay
3.5. TUNEL Apoptosis Assay
3.6. Fluorescence Imaging
3.7. Cell Viability Assay
3.8. Flow Cytometry Assay
3.9. Determination of Aptamer Affinity
3.10. Immunohistochemistry Assay
3.11. Statistical Analysis
Supplementary Materials
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
EGFR | Epidermal growth factor receptor |
MFI | Mean fluorescence intensity |
TUNEL | Terminal deoxynucleotidyl transferase dUTP nick end labeling |
References
- Herbst, R.S. Review of epidermal growth factor receptor biology. Int. J. Radiat. Oncol. 2004, 59, 21–26. [Google Scholar] [CrossRef] [PubMed]
- Sigismund, S.; Avanzato, D.; Lanzetti, L. Emerging functions of the EGFR in cancer. Mol. Oncol. 2018, 12, 3–20. [Google Scholar] [CrossRef] [PubMed]
- Di Noia, V.; D’Argento, E.; Pilotto, S.; Grizzi, G.; Caccese, M.; Iacovelli, R.; Tortora, G.; Bria, E. Necitumumab in the treatment of non-small-cell lung cancer: Clinical controversies. Expert Opin. Biol. Ther. 2018, 18, 937–945. [Google Scholar] [CrossRef] [PubMed]
- Wang, M.; Zhao, J.; Zhang, L.M.; Li, H.; Yu, J.P.; Ren, X.B.; Wang, C.L. Combined Erlotinib and Cetuximab overcome the acquired resistance to epidermal growth factor receptors tyrosine kinase inhibitor in non-small-cell lung cancer. J. Cancer Res. Clin. 2012, 138, 2069–2077. [Google Scholar] [CrossRef] [PubMed]
- Chakravarthy, M.; AlShamaileh, H.; Huang, H.; Tannenberg, R.K.; Chen, S.; Worrall, S.; Dodd, P.R.; Veedu, R.N. Development of DNA aptamers targeting low-molecular-weight amyloid-beta peptide aggregates in vitro. Chem. Commun. 2018, 54, 4593–4596. [Google Scholar] [CrossRef]
- Hughes, Q.W.; Le, B.T.; Gilmore, G.; Baker, R.I.; Veedu, R.N. Construction of a Bivalent Thrombin Binding Aptamer and Its Antidote with Improved Properties. Molecules 2017, 22, 1770. [Google Scholar] [CrossRef] [PubMed]
- Wang, T.; Chen, C.; Larcher, L.M.; Barrero, R.A.; Veedu, R.N. Three decades of nucleic acid aptamer technologies: Lessons learned, progress and opportunities on aptamer development. Biotechnol. Adv. 2019, 37, 28–50. [Google Scholar] [CrossRef]
- Lipi, F.; Chen, S.X.; Chakravarthy, M.; Rakesh, S.; Veedu, R.N. In vitro evolution of chemically-modified nucleic acid aptamers: Pros and cons, and comprehensive selection strategies. RNA Biol. 2016, 13, 1232–1245. [Google Scholar] [CrossRef]
- Goldsworthy, V.; LaForce, G.; Abels, S.; Khisamutdinov, E.F. Fluorogenic RNA Aptamers: A Nano-platform for Fabrication of Simple and Combinatorial Logic Gates. Nanomaterials 2018, 8, 984. [Google Scholar] [CrossRef]
- Halman, J.R.; Satterwhite, E.; Roark, B.; Chandler, M.; Viard, M.; Ivanina, A.; Bindewald, E.; Kasprzak, W.K.; Panigaj, M.; Bui, M.N.; et al. Functionally-interdependent shape-switching nanoparticles with controllable properties. Nucleic Acids Res. 2017, 45, 2210–2220. [Google Scholar] [CrossRef]
- AlShamaileh, H.; Wang, T.; Xiang, D.; Yin, W.; Tran, P.H.; Barrero, R.A.; Zhang, P.Z.; Li, Y.; Kong, L.; Liu, K.; et al. Aptamer-mediated survivin RNAi enables 5-fluorouracil to eliminate colorectal cancer stem cells. Sci. Rep. 2017, 7, 5898. [Google Scholar] [CrossRef] [PubMed]
- Xiang, D.X.; Shigdar, S.; Bean, A.G.; Bruce, M.; Yang, W.R.; Mathesh, M.; Wang, T.; Yin, W.; Tran, P.H.L.; Al Shamaileh, H.; et al. Transforming doxorubicin into a cancer stem cell killer via EpCAM aptamer-mediated delivery. Theranostics 2017, 7, 4071–4086. [Google Scholar] [CrossRef] [PubMed]
- Larcher, L.M.; Wang, T.; Veedu, R.N. Development of Novel antimiRzymes for Targeted Inhibition of miR-21 Expression in Solid Cancer Cells. Molecules 2019, 24, 2489. [Google Scholar] [CrossRef]
- Pi, F.; Binzel, D.W.; Lee, T.J.; Li, Z.; Sun, M.; Rychahou, P.; Li, H.; Haque, F.; Wang, S.; Croce, C.M.; et al. Nanoparticle orientation to control RNA loading and ligand display on extracellular vesicles for cancer regression. Nat. Nanotechnol. 2018, 13, 82–89. [Google Scholar] [CrossRef] [PubMed]
- Tran, P.H.L.; Wang, T.; Yin, W.; Tran, T.T.D.; Barua, H.T.; Zhang, Y.; Midge, S.B.; Nguyen, T.N.G.; Lee, B.J.; Duan, W. Development of a nanoamorphous exosomal delivery system as an effective biological platform for improved encapsulation of hydrophobic drugs. Int. J. Pharm. 2019, 566, 697–707. [Google Scholar] [CrossRef] [PubMed]
- Esposito, C.L.; Passaro, D.; Longobardo, I.; Condorelli, G.; Marotta, P.; Affuso, A.; de Franciscis, V.; Cerchia, L. A Neutralizing RNA Aptamer against EGFR Causes Selective Apoptotic Cell Death. PLoS ONE 2011, 6, e24071. [Google Scholar] [CrossRef] [PubMed]
- Zuker, M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res. 2003, 31, 3406–3415. [Google Scholar] [CrossRef]
- Lorenz, R.; Bernhart, S.H.; Höner zu Siederdissen, C.; Tafer, H.; Flamm, C.; Stadler, P.F.; Hofacker, I.L. ViennaRNA Package 2.0. Algorithms Mol. Biol. 2011, 6, 26. [Google Scholar]
- Shigdar, S.; Qiao, L.; Zhou, S.F.; Xiang, D.; Wang, T.; Li, Y.; Lim, L.Y.; Kong, L.; Li, L.; Duan, W. RNA aptamers targeting cancer stem cell marker CD133. Cancer Lett. 2013, 330, 84–95. [Google Scholar] [CrossRef] [Green Version]
- Wang, T.; Gantier, M.P.; Xiang, D.X.; Bean, A.G.; Bruce, M.; Zhou, S.F.; Khasraw, M.; Ward, A.; Wang, L.; Wei, M.Q.; et al. EpCAM Aptamer-mediated Survivin Silencing Sensitized Cancer Stem Cells to Doxorubicin in a Breast Cancer Model. Theranostics 2015, 5, 1456–1472. [Google Scholar] [CrossRef] [Green Version]
- Jirka, S.M.; Tanganyika-de Winter, C.L.; Boertje-van der Meulen, J.W.; van Putten, M.; Hiller, M.; Vermue, R.; de Visser, P.C.; Aartsma-Rus, A. Evaluation of 2′-Deoxy-2′-fluoro Antisense Oligonucleotides for Exon Skipping in Duchenne Muscular Dystrophy. Mol. Ther. Nucleic Acids 2015, 4, e265. [Google Scholar] [CrossRef]
- Sun, W.J.; Li, J.H.; Liu, S.; Wu, J.; Zhou, H.; Qu, L.H.; Yang, J.H. RMBase: A resource for decoding the landscape of RNA modifications from high-throughput sequencing data. Nucleic Acids Res. 2016, 44, D259–D265. [Google Scholar] [CrossRef]
- Wang, T.; Yin, W.; AlShamaileh, H.; Zhang, Y.; Tran, P.H.; Nguyen, T.N.; Li, Y.; Chen, K.; Sun, M.; Hou, Y.; et al. A Detailed Protein-SELEX Protocol Allowing Visual Assessments of Individual Steps for a High Success Rate. Hum. Gene. Ther. Method. 2019, 30, 1–16. [Google Scholar] [CrossRef]
- Wang, T.; Shigdar, S.; Shamaileh, H.A.; Gantier, M.P.; Yin, W.; Xiang, D.; Wang, L.; Zhou, S.F.; Hou, Y.; Wang, P.; et al. Challenges and opportunities for siRNA-based cancer treatment. Cancer Lett. 2017, 387, 77–83. [Google Scholar] [CrossRef]
- Munz, M.; Murr, A.; Kvesic, M.; Rau, D.; Mangold, S.; Pflanz, S.; Lumsden, J.; Volkland, J.; Fagerberg, J.; Riethmuller, G.; et al. Side-by-side analysis of five clinically tested anti-EpCAM monoclonal antibodies. Cancer Cell Int. 2010, 10, 44. [Google Scholar] [CrossRef]
- De Bono, J.S.; Tolcher, A.W.; Forero, A.; Vanhove, G.F.; Takimoto, C.; Bauer, R.J.; Hammond, L.A.; Patnaik, A.; White, M.L.; Shen, S.; et al. ING-1, a monoclonal antibody targeting Ep-CAM in patients with advanced adenocarcinomas. Clin. Cancer Res. 2004, 10, 7555–7565. [Google Scholar] [CrossRef]
- Schmidt, M.; Scheulen, M.E.; Dittrich, C.; Obrist, P.; Marschner, N.; Dirix, L.; Schmidt, M.; Ruttinger, D.; Schuler, M.; Reinhardt, C.; et al. An open-label, randomized phase II study of adecatumumab, a fully human anti-EpCAM antibody, as monotherapy in patients with metastatic breast cancer. Ann. Oncol. 2010, 21, 275–282. [Google Scholar] [CrossRef]
- McBryan, J.; Howlin, J.; Napoletano, S.; Martin, F. Amphiregulin: Role in mammary gland development and breast cancer. J. Mammary Gland Biol. 2008, 13, 159–169. [Google Scholar] [CrossRef]
- Camorani, S.; Crescenzi, E.; Gramanzini, M.; Fedele, M.; Zannetti, A.; Cerchia, L. Aptamer-mediated impairment of EGFR-integrin alpha v beta 3 complex inhibits vasculogenic mimicry and growth of triple-negative breast cancers. Sci. Rep. 2017, 7, 46659. [Google Scholar] [CrossRef]
- Selves, J.; Long-Mira, E.; Mathieu, M.C.; Rochaix, P.; Ilie, M. Immunohistochemistry for Diagnosis of Metastatic Carcinomas of Unknown Primary Site. Cancers 2018, 10, 108. [Google Scholar] [CrossRef]
- Kim, S.W.; Roh, J.; Park, C.S. Immunohistochemistry for Pathologists: Protocols, Pitfalls, and Tips. J. Pathol. Transl. Med. 2016, 50, 411–418. [Google Scholar] [CrossRef] [Green Version]
- Wang, T.; Larcher, L.M.; Ma, L.X.; Veedu, R.N. Systematic Screening of Commonly Used Commercial Transfection Reagents towards Efficient Transfection of Single-Stranded Oligonucleotides. Molecules 2018, 23, 2564. [Google Scholar] [CrossRef]
Name | Sequence (5′–3′) & Size (nt) |
---|---|
CL-4 | rGfCfCfUfUrArGfUrArAfCrGfUrGfCfUfUfUrGrAfUrGfUfCrGrAfUfUfCrGrAfCrArGrGrArGrGfC (39) |
CL4 RNV615 | m(UGCUUUGAUGUCGAUUCGACAGGAGGC) (27) |
CL-4 RNV616 | mUmGmCmUmUmUmGdAmUmGmUmCmGdAmUmUmCmGdAmCdAmGmGdAmGmGmC (27) |
CL-4 RNV617 | r(UGCUUUGAUGUCGAUUCGACAGGAGGC) (27) |
CL-4 RNV618 | d(TGCTTTGATGTCGATTCGACAGGAGGC) (27) |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Wang, T.; Philippovich, S.; Mao, J.; Veedu, R.N. Efficient Epidermal Growth Factor Receptor Targeting Oligonucleotide as a Potential Molecule for Targeted Cancer Therapy. Int. J. Mol. Sci. 2019, 20, 4700. https://doi.org/10.3390/ijms20194700
Wang T, Philippovich S, Mao J, Veedu RN. Efficient Epidermal Growth Factor Receptor Targeting Oligonucleotide as a Potential Molecule for Targeted Cancer Therapy. International Journal of Molecular Sciences. 2019; 20(19):4700. https://doi.org/10.3390/ijms20194700
Chicago/Turabian StyleWang, Tao, Svetlana Philippovich, Jun Mao, and Rakesh N. Veedu. 2019. "Efficient Epidermal Growth Factor Receptor Targeting Oligonucleotide as a Potential Molecule for Targeted Cancer Therapy" International Journal of Molecular Sciences 20, no. 19: 4700. https://doi.org/10.3390/ijms20194700