Rice Bran Phenolic Compounds Regulate Genes Associated with Antioxidant and Anti-Inflammatory Activity in Human Umbilical Vein Endothelial Cells with Induced Oxidative Stress
Abstract
:1. Introduction
2. Results
2.1. Cytotoxicity of RB Phenolic Extracts on HUVECs
2.2. Effect of RB Phenolic Extracts on Antioxidant Genes under Oxidative Stress Conditions
2.3. Effect of RB Phenolic Extracts on Anti-Inflammatory Genes under Oxidative Stress Conditions
3. Discussion
3.1. Effect on Antioxidant Genes under Oxidative Stress Conditions
3.2. Effect on Anti-Inflammatory Genes under Oxidative Stress Conditions
Immunomodulatory Genes
4. Materials and Methods
4.1. Reagents
4.2. Rice Bran Derived Phenolic Extract Preparation
4.3. Cell Culture Conditions
4.4. Cytotoxicity Assay
4.5. Experimental Design and Induction of Oxidative Stress
4.6. Ribonucleic Acid (RNA) Extraction
4.7. Complementary Deoxyribonucleic Acid (cDNA)
4.8. Primer Sequences
4.9. Quantitative Real-Time Polymerase Chain Reaction (qPCR)
4.10. Statistical Analysis
5. Conclusions
Author Contributions
Funding
Acknowledgments
Conflicts of Interest
Abbreviations
ADP | Adenosine diphosphate |
ATP | adenosine triphosphate |
ANOVA | analysis of variance |
CVD | cardiovascular disease |
cDNA | complementary deoxyribonucleic acid |
Ct | cycle threshold |
DMSO | dimethyl sulfoxide |
eNOS | endothelial nitric oxide synthase |
CD73 | ecto-5′-nucleotidase |
CD39 | ectonucleoside triphosphate diphosphohydrolase 1 |
HO1 | eNOS heme oxygenase 1 |
HUVECs | human umbilical vein endothelial cells |
H2O2 | hydrogen peroxide |
ICAM1 | intercellular adhesion molecule 1 |
NOX4 | nicotinamide adenine dinucleotide phosphate oxidase 4 |
NQO1 | nicotinamide adenine dinucleotide phosphate: quinone oxidoreductase 1 |
Nrf2 | nuclear factor erythroid 2-related factor 2 |
PBS | phosphate buffered saline |
qPCR | quantitative real-time polymerase chain reaction |
ROS | reactive oxygen species |
RNA | ribonucleic acid |
RB | rice bran |
SEM | standard error of the mean |
References
- Fuentes, E.; Palomo, I. Mechanisms of endothelial cell protection by hydroxycinnamic acids. Vasc. Pharmacol. 2014, 63, 155–161. [Google Scholar] [CrossRef]
- Reuland, D.J.; McCord, J.M.; Hamilton, K.L. The role of nrf2 in the attenuation of cardiovascular disease. Exerc. Sport Sci. Rev. 2013, 41, 162–168. [Google Scholar] [CrossRef] [PubMed]
- Luo, S.; Lei, K.; Xiang, D.; Ye, K. Nqo1 is regulated by pten in glioblastoma, mediating cell proliferation and oxidative stress. Oxid. Med. Cell. Longev. 2018, 2018. [Google Scholar] [CrossRef] [PubMed]
- Loboda, A.; Damulewicz, M.; Pyza, E.; Jozkowicz, A.; Dulak, J. Role of nrf2/ho-1 system in development, oxidative stress response and diseases: An evolutionarily conserved mechanism. Cell. Mol. Life Sci. 2016, 73, 3221–3247. [Google Scholar] [CrossRef] [PubMed]
- He, W.; Kwesiga, M.P.; Gebreyesus, E.; Liu, S. Nitric oxide and oxidative stress-mediated cardiovascular functionality: From molecular mechanism to cardiovascular disease. In Vascular Biology; IntechOpen: London, UK, 2019. [Google Scholar]
- Zelko, I.N.; Folz, R.J. Regulation of oxidative stress in pulmonary artery endothelium. Modulation of extracellular superoxide dismutase and nox4 expression using histone deacetylase class I inhibitors. Am. J. Respirat. Cell Mol. Biol. 2015, 53, 513–524. [Google Scholar] [CrossRef] [PubMed]
- Callcott, E.T.; Blanchard, C.L.; Oli, P.; Santhakumar, A.B. Pigmented rice-derived phenolic compounds reduce biomarkers of oxidative stress and inflammation in human umbilical vein endothelial cells. Mol. Nutr. Food Res. 2018, 62, 1800840. [Google Scholar] [CrossRef] [PubMed]
- Antonioli, L.; Pacher, P.; Vizi, E.S.; Haskó, G. Cd39 and cd73 in immunity and inflammation. Trends Mol. Med. 2013, 19, 355–367. [Google Scholar] [CrossRef] [PubMed]
- Ungvari, Z.; Bagi, Z.; Feher, A.; Recchia, F.A.; Sonntag, W.E.; Pearson, K.; De Cabo, R.; Csiszar, A. Resveratrol confers endothelial protection via activation of the antioxidant transcription factor nrf2. Am. J. Physiol. Heart Circul. Physiol. 2010, 299, H18–H24. [Google Scholar] [CrossRef] [PubMed]
- Park, J.S.; Jung, J.S.; Jeong, Y.H.; Hyun, J.W.; Le, T.K.V.; Kim, D.H.; Choi, E.C.; Kim, H.S. Antioxidant mechanism of isoflavone metabolites in hydrogen peroxide-stimulated rat primary astrocytes: Critical role of hemeoxygenase-1 and expression. J. Neurochem. 2011, 119, 909–919. [Google Scholar] [CrossRef]
- Butsat, S.; Siriamornpun, S. Antioxidant capacities and phenolic compounds of the husk, bran and endosperm of thai rice. Food Chem. 2010, 119, 606–613. [Google Scholar] [CrossRef]
- Caiazzo, E.; Tedesco, I.; Spagnuolo, C.; Russo, G.L.; Ialenti, A.; Cicala, C. Red wine inhibits aggregation and increases atp-diphosphohydrolase (cd39) activity of rat platelets in vitro. Nat. Product Commun. 2016, 11, 1934578X1601100618. [Google Scholar] [CrossRef]
- Calabriso, N.; Massaro, M.; Scoditti, E.; D’Amore, S.; Gnoni, A.; Pellegrino, M.; Storelli, C.; De Caterina, R.; Palasciano, G.; Carluccio, M.A. Extra virgin olive oil rich in polyphenols modulates vegf-induced angiogenic responses by preventing nadph oxidase activity and expression. J. Nutr. Biochem. 2016, 28, 19–29. [Google Scholar] [CrossRef] [PubMed]
- Manach, C.; Williamson, G.; Morand, C.; Scalbert, A.; Rémésy, C. Bioavailability and bioefficacy of polyphenols in humans. I. Review of 97 bioavailability studies. Am. J. Clin. Nutr. 2005, 81, 230S–242S. [Google Scholar] [CrossRef] [PubMed] [Green Version]
- Satta, S.; Mahmoud, A.M.; Wilkinson, F.L.; Yvonne Alexander, M.; White, S.J. The role of nrf2 in cardiovascular function and disease. Oxid. Med. Cell. Longev. 2017, 2017. [Google Scholar] [CrossRef] [PubMed]
- Patel, R.; Maru, G. Polymeric black tea polyphenols induce phase ii enzymes via nrf2 in mouse liver and lungs. Free Rad. Biol. Med. 2008, 44, 1897–1911. [Google Scholar] [CrossRef] [PubMed]
- Ugusman, A.; Zakaria, Z.; Hui, C.K.; Nordin, N.A.M.M. Piper sarmentosum inhibits icam-1 and nox4 gene expression in oxidative stress-induced human umbilical vein endothelial cells. BMC Complement. Altern. Med. 2011, 11, 31. [Google Scholar] [CrossRef]
- Shalini, V.; Pushpan, C.K.; Sindhu, G.; Jayalekshmy, A.; Helen, A. Tricin, flavonoid from njavara reduces inflammatory responses in hpbmcs by modulating the p38mapk and pi3k/akt pathways and prevents inflammation associated endothelial dysfunction in huvecs. Immunobiology 2016, 221, 137–144. [Google Scholar] [CrossRef]
- Iiyama, K.; Hajra, L.; Iiyama, M.; Li, H.; DiChiara, M.; Medoff, B.D.; Cybulsky, M.I. Patterns of vascular cell adhesion molecule-1 and intercellular adhesion molecule-1 expression in rabbit and mouse atherosclerotic lesions and at sites predisposed to lesion formation. Circul. Res. 1999, 85, 199–207. [Google Scholar] [CrossRef]
- Förstermann, U.; Li, H. Therapeutic effect of enhancing endothelial nitric oxide synthase (enos) expression and preventing enos uncoupling. Br. J. Pharmacol. 2011, 164, 213–223. [Google Scholar] [CrossRef]
- Leikert, J.r.F.; Räthel, T.R.; Wohlfart, P.; Cheynier, V.; Vollmar, A.M.; Dirsch, V.M. Red wine polyphenols enhance endothelial nitric oxide synthase expression and subsequent nitric oxide release from endothelial cells. Circulation 2002, 106, 1614–1617. [Google Scholar] [CrossRef]
- Madeira, S.V.F.; Auger, C.; Anselm, E.; Chataigneau, M.; Chataigneau, T.; De Moura, R.S.; Schini-Kerth, V.B. Enos activation induced by a polyphenol-rich grape skin extract in porcine coronary arteries. J. Vasc. Res. 2009, 46, 406–416. [Google Scholar] [CrossRef] [PubMed]
- Kanthi, Y.M.; Sutton, N.R.; Pinsky, D.J. Cd39: Interface between vascular thrombosis and inflammation. Curr. Atheroscl. Rep. 2014, 16, 425. [Google Scholar] [CrossRef] [PubMed]
- Bono, M.R.; Fernández, D.; Flores-Santibáñez, F.; Rosemblatt, M.; Sauma, D. Cd73 and cd39 ectonucleotidases in t cell differentiation: Beyond immunosuppression. FEBS Lett. 2015, 589, 3454–3460. [Google Scholar] [CrossRef] [PubMed]
- Jian, R.; Sun, Y.; Wang, Y.; Yu, J.; Zhong, L.; Zhou, P. Cd73 protects kidney from ischemia-reperfusion injury through reduction of free radicals. Apmis 2012, 120, 130–138. [Google Scholar] [CrossRef] [PubMed]
- Covarrubias, R.; Chepurko, E.; Reynolds, A.; Huttinger, Z.M.; Huttinger, R.; Stanfill, K.; Wheeler, D.G.; Novitskaya, T.; Robson, S.C.; Dwyer, K.M. Role of the cd39/cd73 purinergic pathway in modulating arterial thrombosis in mice. Arterioscl. Thromb. Vasc. Biol. 2016, 36, 1809–1820. [Google Scholar] [CrossRef]
- Melzig, M. Inhibition of adenosine deaminase activity of aortic endothelial cells by selected flavonoids. Planta Medica 1996, 62, 20–21. [Google Scholar] [CrossRef] [PubMed]
- Rao, S.; Callcott, E.T.; Santhakumar, A.B.; Chinkwo, K.A.; Vanniasinkam, T.; Luo, J.; Blanchard, C.L. Profiling polyphenol composition and antioxidant activity in australian-grown rice using uhplc online-abts system. J. Cereal Sci. 2018, 80, 174–179. [Google Scholar] [CrossRef]
- Muller, P.; Janovjak, H.; Miserez, A.; Dobbie, Z. Processing of gene expression data generated by quantitative real-time rt pcr (vol 32, pg 1378, 2002). Biotechniques 2002, 33, 514. [Google Scholar]
Gene | Forward Primer | Reverse Primer |
---|---|---|
Nrf2 | ATGACAATGAGGTTTCTTCGG | CAATGAAGACTGGGCTCTC |
NQO1 | ACATCACAGGTAAACTGAAGG | TCAGATGGCCTTCTTTATAAGC |
HO1 | AACTCCCTGGAGATGACTC | CTCAAAGAGCTGGATGTTGAG |
eNOS | GTTACCAGCTAGCCAAAGTC | TCTGCTCATTCTCCAGGTG |
NOX4 | TATCCAGTCCTTCCGTTGG | CCAATTATCTTCTGTATCCCATCTG |
ICAM-1 | GATAGCCAACCAATGTGCT | TTCTGGAGTCCAGTACACG |
CD39 | TCAAATGTAGTGTGAAAGGCTC | TACACTCCTCAAAGGCTCTG |
CD73 | CATTCCTGAAGATCCAAGCA | AGGAGCCATCCAGATAGAC |
β-actin | GAAGATCAAGATCATTGCTCCTC | ATCCACATCTGCTGGAAGG |
© 2019 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).
Share and Cite
Saji, N.; Francis, N.; Blanchard, C.L.; Schwarz, L.J.; Santhakumar, A.B. Rice Bran Phenolic Compounds Regulate Genes Associated with Antioxidant and Anti-Inflammatory Activity in Human Umbilical Vein Endothelial Cells with Induced Oxidative Stress. Int. J. Mol. Sci. 2019, 20, 4715. https://doi.org/10.3390/ijms20194715
Saji N, Francis N, Blanchard CL, Schwarz LJ, Santhakumar AB. Rice Bran Phenolic Compounds Regulate Genes Associated with Antioxidant and Anti-Inflammatory Activity in Human Umbilical Vein Endothelial Cells with Induced Oxidative Stress. International Journal of Molecular Sciences. 2019; 20(19):4715. https://doi.org/10.3390/ijms20194715
Chicago/Turabian StyleSaji, Nancy, Nidhish Francis, Christopher L. Blanchard, Lachlan J. Schwarz, and Abishek B. Santhakumar. 2019. "Rice Bran Phenolic Compounds Regulate Genes Associated with Antioxidant and Anti-Inflammatory Activity in Human Umbilical Vein Endothelial Cells with Induced Oxidative Stress" International Journal of Molecular Sciences 20, no. 19: 4715. https://doi.org/10.3390/ijms20194715